Application of PagLBD16.2 gene in regulation and control of plant type development of poplar

Abstract

The invention is applicable to the technical field of gene engineering, and provides application of a PagLBD16.2 gene in regulation and control of plant type development of poplar trees, and a nucleotide sequence of the PagLBD16.2 gene is shown as SEQ ID NO.3. The invention also provides a method for preparing the PagLBD16.2 gene. According to the regulation and control mode, through overexpression of the PagLBD16.2 gene, the plant height of the transgenic poplar is lower than that of the wild type 84K, the internode diameter is lower than that of the wild type 84K, and the internode number is larger than that of the wild type 84K. The plant type development of the poplar is regulated and controlled through overexpression of the poplar gene PagLBD16.2, and the poplar gene PagLBD16.2 has important significance for promoting genetic improvement and breeding of the poplar.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to the application of the PagLBD16.2 gene in regulating the development of poplar plant types. Background Art

[0002] Poplar is the common name for deciduous trees of the genus Populus in the Salicaceae family. There are over 100 species, primarily distributed in temperate and boreal zones of the Northern Hemisphere. Poplars play a vital role in multiple ecological, economic, and social aspects. They grow rapidly, forming dense forests in a short period of time, and possess strong soil conservation and erosion prevention capabilities. Their wood, with its clear grain, is suitable for furniture, building materials, and paper pulp, and holds high economic value. 84K poplar is a latest-generation poplar cultivar. A hybrid of Populus alba and Populus glandulosa, it boasts excellent characteristics such as easy rooting, rapid seedling and sapling growth, superior wood quality, strong wind resistance, and wide adaptability. Importantly, 84K poplar is a male asexual clone, free of catkin pollution, making it an excellent afforestation and landscaping species.

[0003] The LBD16 gene belongs to the LBD (Later alorgan boundaries domain) gene family, a family of transcription factors unique to higher plants. The LBD gene family plays an important role in physiological processes such as lateral organ development, stress response, secondary growth, regeneration, and secondary metabolite synthesis. LBD16 is primarily involved in regulating processes such as lateral root formation and plant regeneration. However, there are currently no reports on the effects of LBD16 on stem segment development in woody plants. Summary of the Invention

[0004] The purpose of the embodiments of the present invention is to provide the application of the PagLBD16.2 gene in regulating the development of poplar plant type, aiming to solve the problems raised in the above background technology.

[0005] The embodiment of the present invention is achieved by using the PagLBD16.2 gene in regulating the development of poplar plant type. The nucleotide sequence of the PagLBD16.2 gene is shown in SEQ ID NO.3.

[0006] Preferably, the regulation method is to overexpress the PagLBD16.2 gene, so that the plant height of the transgenic poplar is lower than that of the wild type 84K, the internode diameter is lower than that of the wild type 84K, the number of internodes is more than that of the wild type 84K, and the overexpression of the PagLBD16.2 gene will cause the transgenic poplar to branch early.

[0007] Preferably, the steps include:

[0008] (1) Gene cloning: Design amplification primers and use 84K poplar genomic cDNA as a template to obtain the coding sequence of the PagLBD16.2 gene by PCR amplification;

[0009] (2) Construction of a plant expression vector for the PagLBD16.2 gene;

[0010] (3) Transgenic transformation: The overexpression vector containing the PagLBD16.2 gene was transferred into 84K poplar plants using the Agrobacterium-mediated method. After pre-culture, infection, dark culture, adventitious bud induction, bud rooting induction, propagation, and hardening, the plants were transplanted into the greenhouse.

[0011] (4) Identification, propagation and screening.

[0012] Preferably, in step (2), the plant expression vector is pCAMBIA1300-35S-GFP.

[0013] Preferably, in step (3), the method of Agrobacterium infection is the immersion method.

[0014] The embodiments of the present invention propose that overexpression of the poplar gene PagLBD16.2 can regulate the development of poplar plant type, which is of great significance for promoting poplar genetic improvement and breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The coding sequence of the PagLBD16.2 gene provided in the embodiment of the present invention is cloned into the expression vector pCAMBIA1300-35S-GFP containing a strong 35S promoter by homologous recombination.

[0016] Figure 2 The results of the transcriptional expression test of 35Spro::PagLBD16.2-GFP transgenic poplar provided in the embodiments of the present invention are as follows;

[0017] Figure 3 Overexpression of PagLBD16.2 provided in the embodiments of the present invention reduces poplar plant height;

[0018] Figure 4 Overexpression of PagLBD16.2 provided in the embodiments of the present invention reduces the internode diameter of poplars and increases the number of internodes of poplars, and overexpression of the PagLBD16.2 gene causes transgenic poplars to branch early. DETAILED DESCRIPTION

[0019] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0020] The specific implementation of the present invention is described in detail below with reference to specific embodiments.

[0021] Example 1: Application of the PagLBD16.2 gene in regulating the development of poplar plant type, comprising the following steps:

[0022] (1) Gene cloning: The protein sequence of the Arabidopsis thaliana AtLBD16 gene was searched on the Tair website. The closest homologous gene in the 84K poplar (Populus albax) (Populus glandulosa) genome, PagLBD16.2, was obtained through sequence alignment. Amplification primers were designed using SnapGene software, and the PagLBD16.2 protein coding sequence was obtained by PCR amplification using the 84K poplar genomic cDNA as a template. The specific process is as follows:

[0023] 1. Extraction of total RNA from 84K poplar leaves:

[0024] Prepare 0.2 g of poplar leaves, grind them into powder under liquid nitrogen, and extract RNA using the Tiangen Biochemical Technology Co., Ltd. kit (RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit);

[0025] 2. Reverse transcription of RNA into cDNA:

[0026] 84K poplar cDNA was obtained using the All-Gold EasyScript One-Step gDNA Removal and cDNA Synthesis Kit;

[0027] 3. PCR amplification of target gene PagLBD16.2:

[0028] 3.1. Analysis and design of primers for homologous amplification of the coding region of PagLBD16.2:

[0029] PagLBD16.2-F:

[0030] GAGCTCGGTACCATGGCATCATCTGTGACTGGCAC (as shown in SEQ ID NO. 1);

[0031] PagLBD16.2-R:

[0032] GACTCTAGAGGATCCGTTCCTCATCATTCTAAGTGCC (as shown in SEQ ID NO. 2);

[0033] 3.2. The PCR reaction system is shown in Table 1:

[0034] Table 1

[0035] Components volume cDNA 1 μl ForwardPrimmer 1 μl ReversPrimmer 1 μl 2×PhantaMaxMasterMix 25 μl <![CDATA[ddH2O]]> 22 μl Total 50 μl

[0036] 3.3. PCR reaction conditions are shown in Table 2:

[0037] Table 2

[0038]

[0039] 3.4. Identification by 1% agarose gel electrophoresis:

[0040] Weigh 0.5 g of agarose, add 50 ml of 1×TAE, heat to melt, cool to room temperature, add 5 μl of nucleic acid dye, and after the agarose gel has cooled, add the PCR product to the sample wells and electrophorese for 15 minutes. Excise the target band with a scalpel, place it in a 1.5 ml centrifuge tube, and weigh it. According to the instructions of the DNA gel recovery kit from Beijing Quanshijin Biotechnology Co., Ltd., recover the target gene fragment of 648 bp in length, the nucleotide sequence of which is shown in SEQ ID NO. 3.

[0041] (2) Construction of plant expression vector of PagLBD16.2 gene: The coding sequence of PagLBD16.2 gene was cloned into the expression vector pCAMBIA1300-35S-GFP containing 35S strong promoter by homologous recombination method. Figure 1 The specific process is as follows:

[0042] 1. Double enzyme digestion of pCAMBIA1300-35S-GFP vector: Select KpnⅠ and BamHI as the restriction sites, add the reaction system according to Table 3, and digest at 37℃ for 20 minutes:

[0043] Table 3

[0044]

[0045]

[0046] 2. Use the homologous recombination kit purchased from Tiangen Biochemical Technology Beijing Co., Ltd. to connect the target gene and the vector;

[0047] 3. Transform the ligation product into competent E. coli TOP 10, place on ice for 30 minutes, heat shock for 45 seconds, and place on ice again for 2 minutes. Add 600 μl LB liquid culture medium and place in a constant temperature shaker at 37°C, 220 rpm, and recover for 1 hour. Pipette 100 μl of activated E. coli and evenly spread it on LB solid medium containing Kana antibiotics. Incubate at 37°C inverted for 12-16 hours. After colonies grow, pick a single clone and place it in 700 μl LB liquid medium containing Kana antibiotics. Grow at 37°C for 6 hours. After adding the reaction system according to Table 4, perform colony PCR and identify by agarose gel electrophoresis. Pick the bacterial solution with the target band and send it to the company for sequencing. Screen the positive clones and name the vector 35Spro::PagLBD16.2-GFP:

[0048] Table 4

[0049] Components volume bacterial liquid 1 μl ForwardPrimmer 1 μl ReversPrimmer 1 μl 2×TaqMasterMix 10 μl <![CDATA[ddH2O]]> 7 μl Total 20ul

[0050] (3) Transgenic transformation: The overexpression vector containing the coding sequence of the PagLBD16.2 gene was transferred into 84K poplar by Agrobacterium-mediated method. After pre-culture, infection, dark culture, adventitious bud induction, bud rooting induction, propagation, and hardening, the seedlings were transplanted into the greenhouse as follows:

[0051] 1. Leaf pre-culture: Take leaves from wild-type 84K tissue culture seedlings that are 4-5 weeks old and in good growth condition. In a clean bench, use sterile disinfected instruments to scratch the leaves perpendicular to the veins. Spread the leaves with the front side facing up onto the pre-culture medium without antibiotics and culture at 25°C for 2 days.

[0052] 2. Preparation of Agrobacterium infection solution: Pick up the

[0053] A single colony of Agrobacterium (GV3101 competent cells) expressing the 35Spro::PagLBD16.2-GFP vector was inoculated into 100 mL of liquid LB medium containing Kana and Rif antibiotics and cultured at 28°C and 180 rpm until the OD value reached 0.6-0.8.

[0054] 3. Infection and co-cultivation: In a clean bench, place the pre-cultured leaves in the Agrobacterium solution and soak for 15 minutes. Slowly shake 2-3 times in the middle to ensure that the injured part of the leaf is fully exposed to the solution. After the infection is completed, remove the leaf with sterile tweezers and place it on a pre-sterilized filter paper to absorb excess solution. Finally, inoculate the infected leaf on the co-cultivation medium without antibiotics and culture it in the dark at 25°C for 3 days.

[0055] 4. Resistance culture: In a clean bench, place the leaves that have been dark-treated for 3 days on pre-sterilized filter paper to absorb excess bacteria, then transfer them to differentiation screening medium. Induce and screen hygromycin-resistant adventitious buds at 25°C with 16h light / 8h dark.

[0056] 5. After 10 days of selective culture, use sterile tweezers to place the light green dense callus or leaves with adventitious buds on a new selective culture medium in a clean bench to provide the callus or adventitious buds with more adequate nutrition for differentiation.

[0057] 6. Continue selective culture for about 2 weeks. When the adventitious buds grow to more than 3-4 cm, cut them off individually with a sterile scalpel in a clean bench and place them on a rooting medium containing screening pressure (50 mg / L hygromycin) and sterilization (200 mg / L timentin) for rooting culture. After two weeks, the adventitious buds will grow adventitious roots. After rooting, subculture and propagate (the first subculture medium contains timentin and hygromycin, and subsequent subcultures only contain timentin);

[0058] 7. The culture medium formula used for the above genetic transformation is shown in Table 5, 1L (NaOH adjusted to pH 5.8-6.0):

[0059] Table 5

[0060]

[0061] (4) Identification of transgenic plants: 18 resistant plants were obtained through the above transformation method. Leaves of the resistant plants were cut and their genomic DNA was extracted. Identification primers were designed and PCR was used to identify positive transgenic plants. The details are as follows:

[0062] 1. Rapid extraction of genomic DNA steps:

[0063] 0.2 g of poplar leaves were placed in a 2 ml centrifuge tube containing small steel balls, quickly frozen in liquid nitrogen, and ground into powder using a grinder. 400 μl of Edwards was added, and the mixture was shaken and ground for 15 seconds, followed by centrifugation at 12,000 rpm for 3 minutes. The supernatant was placed in a 1.5 ml centrifuge tube, and an equal volume of isopropanol (400 μl) was added and mixed by pipetting. After an ice bath for 30 minutes, the mixture was centrifuged at 12,000 rpm for 5 minutes, and the supernatant was discarded. 400 μl of 70% ethanol was added to the precipitate, and the mixture was centrifuged at 12,000 rpm for 2 minutes. The supernatant was discarded and dried at 28°C overnight. 15 μl of ddH2O was added to the precipitate and stored at 4°C.

[0064] 2. PCR identification of transgenic poplars:

[0065] Forward primers were designed based on the PagLBD16.2 genomic sequence, and reverse primers were designed based on the vector pCAMBIA1300-35S-GFP. PCR amplification was performed followed by electrophoresis. Positive transgenic plants were verified by agarose gel electrophoresis using plasmid 35Spro::PagLBD16.2-GFP as a positive control and wild-type 84K poplar as a negative control.

[0066] 2.1. Identification primers:

[0067] PagLBD16.2-F: ATGGCATCATCTGTGACTGGCAC (as shown in SEQ ID NO. 4);

[0068] GFP-R: CTACCTGTTCCATGGCCAACAC (as shown in SEQ ID NO. 5);

[0069] 2.2. The PCR reaction system is shown in Table 6:

[0070] Table 6

[0071] Components volume DNA 1 μl ForwardPrimmer 1 μl ReversPrimmer 1 μl 2×PhantaMaxMasterMix 10 μl <![CDATA[ddH2O]]> 7 μl Total 20 μl

[0072] 2.3. PCR reaction conditions are shown in Table 7:

[0073] Table 7

[0074]

[0075]

[0076] 2.4. 10 μl of PCR product was subjected to 1% agarose gel electrophoresis, and 4 positive plants successfully transformed with 35Spro::PagLBD16.2-GFP were identified.

[0077] (5) Identification of expression levels in transgenic plants: Total RNA was extracted from the 35Spro::PagLBD16.2-GFP transgenic poplar lines, and the expression level of the PagLBD16.2 gene was detected using real-time fluorescence quantitative PCR. The results of real-time fluorescence quantitative PCR were as follows: Figure 2 As shown, strains #1 and #2 had the highest expression levels. Therefore, #1 and #2 were selected as subsequent experimental materials. The specific steps are as follows:

[0078] 1. Poplar total RNA was extracted using the kit from Tiangen Biochemical Technology Co., Ltd.

[0079] (RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit);

[0080] 2. Poplar RNA reverse transcription was performed using the Full Gold EasyScript One-Step gDNA Removal and cDNA Synthesis Kit;

[0081] 3. Detection of PagLBD16.2 expression by real-time quantitative PCR:

[0082] The cDNA obtained by reverse transcription was GreenqPCR SuperMix fluorescent quantitative enzyme was used to quantitatively measure gene expression, as follows:

[0083] 3.1. Real-time PCR reaction system is shown in Table 8:

[0084] Table 8

[0085]

[0086] 3.2. Fluorescence real-time quantitative PCR amplification conditions are shown in Table 9:

[0087] Table 9

[0088]

[0089] The amplification step was repeated 40 times, and the fluorescence signal was collected after each cycle; 65-95°C, increasing by 0.5°C in 5 seconds, and the melting curve was drawn.

[0090] (6) Transgenic phenotypic analysis: Select transgenic lines #1 and #2 with high expression levels and wild type 84K, propagate more than 20 plants of each line, select 15 tissue culture seedlings with consistent growth and culture them in soil at 24°C, 16h light / 8h dark, and culture for 2 months; take wild type 84K and overexpression line soil culture seedlings that have grown for two months and measure and statistically analyze growth indicators such as plant height, number of branches, and number of internodes. 15 plants of each line were measured to explore the effect of overexpression of PagLBD16.2 gene on the growth and development of poplar trees:

[0091] By measuring and analyzing the growth phenotype, such as Figure 3 As shown in Figure 2, the plant height of transgenic poplar 35Spro::PagLBD16.2-GFP (OE#1, OE#2) was significantly lower than that of wild-type 84K, which were approximately 0.3 and 0.78 times that of the control line, respectively; Figure 4As shown in the data, the internode diameter of the overexpressing transgenic lines (OE#1, OE#2) was significantly reduced compared with the wild-type 84K; from the statistics of the internode number, the internode number of the overexpressing plants (OE#1, OE#2) was significantly higher than that of the control lines, approximately 1.24 and 1.47 times that of the control lines, respectively; according to the analysis of the measurement results of various physiological indicators, PagLBD16.2 plays an important role in the growth process of poplar and is involved in the development of poplar plant type.

[0092] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. The application of PagLBD16.2 gene in regulating the development of poplar plant type is characterized by: The nucleotide sequence of the PagLBD16.2 gene is shown in SEQ ID NO.

3.

2. The use according to claim 1, characterized in that The regulation method is to overexpress the PagLBD16.2 gene, so that the plant height of the transgenic poplar is lower than that of the wild type 84K, the internode diameter is lower than that of the wild type 84K, and the number of internodes is more than that of the wild type 84K. In addition, overexpression of the PagLBD16.2 gene will cause the transgenic poplar to branch early.

3. The use according to claim 1, characterized in that The following steps are involved: (1) Gene cloning: Design amplification primers and use 84K poplar genomic cDNA as a template to obtain the coding sequence of the PagLBD16.2 gene by PCR amplification; (2) Construction of a plant expression vector for the PagLBD16.2 gene; (3) Transgenic transformation: The overexpression vector containing the PagLBD16.2 gene was transferred into 84K poplar plants using the Agrobacterium-mediated method. After pre-culture, infection, dark culture, adventitious bud induction, bud rooting induction, propagation, and hardening, the plants were transplanted into the greenhouse. (4) Identification, propagation and screening.

4. The use according to claim 3, characterized in that In step (2), the plant expression vector is pCAMBIA1300-35S-GFP.

5. The use according to claim 3, characterized in that In step (3), the method of Agrobacterium infection is the immersion method.

Images