Application of LRR receptor kinase PcBAK1 in improving fungal disease resistance of poplar
By overexpressing the LRR receptor kinase PcBAK1 gene in poplar trees, the problems of limited improvement in poplar trees' resistance to fungal diseases and low conversion efficiency were solved, achieving the effect of improving poplar trees' resistance and reducing the use of chemical pesticides.
Patent Information
- Application Number
- CN202510971926.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-15
- Publication Date
- 2025-09-23
AI Technical Summary
Existing technologies have limited improvements in poplar's resistance to fungal diseases, low conversion efficiency, and problems such as exogenous gene expression interfering with normal growth. Chemical control poses an environmental pollution risk.
The LRR receptor kinase PcBAK1 gene was overexpressed. By constructing an overexpression vector and transforming poplar tissue, the expression level of PcBAK1 was increased to enhance the resistance of poplar to Diplodia populina.
It significantly improves the resistance of poplar trees to Diplodia populi, reduces the use of chemical pesticides, reduces environmental pollution, and does not affect the growth rate of poplar trees.
Smart Images

Figure CN120683168A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular biology, and particularly relates to application of LRR receptor kinase PcBAK1 in improving poplar resistance to fungal diseases. Background Art
[0002] Poplars (Populus spp.), as a core economic tree species in the world's plantations, have long been threatened by brown spot disease caused by Marssonina brunnea. This pathogen degrades plant cell walls and inhibits immune signal transduction by secreting effector proteins (such as the MbSSP1 extracellular protease), leading to the spread of brown spots on leaves, loss of photosynthetic capacity, and serious reduction in wood quality. According to statistics from the International Union for Forestry Research (IUFRO), the average annual yield reduction in poplar planting areas worldwide due to brown spot disease is 12-15%, with economic losses exceeding US$5 billion. The disadvantages of traditional reliance on chemical control (such as triazole fungicides) are becoming increasingly significant. It not only induces pathogens to produce drug-resistant mutations, but also causes irreversible damage to soil microbial communities.
[0003] In the field of disease resistance breeding, despite attempts to utilize gene editing technologies (e.g., CRISPR / Cas9 to knock out disease-susceptibility genes) or introduce exogenous disease-resistance genes (e.g., NPR1 and WRKY33), these strategies face challenges in woody plants, such as low transformation efficiency and phenotypic instability. For example, transgenic poplars overexpressing the Arabidopsis PR1 gene reduced lesion area by approximately 25%, but were accompanied by growth defects such as reduced branching and impaired lignin synthesis. In recent years, the LRR receptor kinase BAK1 has garnered significant attention due to its pivotal role in plant pattern immunity (PTI). In Arabidopsis, AtBAK1 has been shown to recognize the bacterial flagellin flg22 by interacting with the FLS2 receptor, activating the MAPK cascade and inducing a burst of reactive oxygen species (ROS). However, functional studies of its woody homolog, PcBAK1, have long been lacking. There are no reports of transforming Italian poplar I-214 with this gene, and there is also a lack of efficient and stable transformation systems designed for poplar.
[0004] The present invention aims to solve key problems in the existing technology, such as limited improvement of poplar disease resistance, low transformation efficiency, and interference of exogenous gene expression with normal growth, and provide a sustainable molecular breeding solution for the prevention and control of poplar fungal diseases. Summary of the Invention
[0005] In order to overcome the above technical problems, the present invention provides the use of LRR receptor kinase PcBAK1 or its encoding nucleic acid in improving poplar resistance to fungal diseases and a method for improving poplar resistance to fungal diseases, providing a sustainable molecular breeding solution for the prevention and control of poplar fungal diseases.
[0006] In a first aspect, the present invention provides a use of LRR receptor kinase PcBAK1 or its encoding nucleic acid in improving poplar resistance to fungal diseases. The amino acid sequence of the protein encoded by the LRR receptor kinase PcBAK1 is as SEQ ID NO.1.
[0007] In certain embodiments, the nucleotide sequence of the LRR receptor kinase PcBAK1 is shown as SEQ ID NO.2.
[0008] In certain embodiments, the poplar is Italian poplar, preferably Italian poplar 1-214.
[0009] In certain embodiments, the fungus comprises Marssonina brunnea.
[0010] In certain embodiments, the use comprises the step of increasing the expression level of the LRR receptor kinase PcBAK1 in poplar.
[0011] On the other hand, the present invention also provides a method for improving poplar resistance to fungal diseases, the method comprising the following steps:
[0012] (1) Construct an overexpression vector for the LRR receptor kinase PcBAK1;
[0013] (2) transforming the constructed overexpression vector into poplar tissue or poplar cells;
[0014] (3) Cultivate and screen transgenic poplars with improved resistance to fungal diseases.
[0015] In certain embodiments, the amino acid sequence of the protein encoded by the LRR receptor kinase PcBAK1 is as SEQ ID NO.1.
[0016] In certain embodiments, the nucleotide sequence of the LRR receptor kinase PcBAK1 is shown as SEQ ID NO.2.
[0017] In certain embodiments, the poplar is Italian poplar, preferably Italian poplar 1-214.
[0018] In certain embodiments, the fungus comprises Marssonina brunnea.
[0019] Compared to existing technologies, the present invention discovered that infection with Diplodia spp. can induce upregulated expression of the PcBAK1 gene in Populus spp. (Italy Populus I-214). Furthermore, transgenic poplar plants overexpressing the PcBAK1 gene were constructed. Experimental results indicate that the PcBAK1 gene can be used to improve plant resistance to Diplodia spp. and to cultivate new transgenic plant varieties resistant to Diplodia spp. The method provided by the present invention can improve plant disease resistance, thereby reducing the use of chemical pesticides and alleviating environmental pollution. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1 Analysis of the gene expression pattern of PcBAK1.
[0021] Figure 2 Construction of PcBAK1-overexpressing Italian poplar lines; (A) PcBAK1-overexpressing Italian poplar lines took root in a culture medium containing 10 mg / L Kan, (B) PCR identification of positive plants, (C) measurement of the relative expression levels of PcBAK1 in different PcBAK1-overexpressing Italian poplar lines.
[0022] Figure 3 PcBAK1 positively regulates poplar resistance to infection by Diplodia populina; (A) The plant height and root length growth rates of PcBAK1-overexpressing Italian poplar lines were consistent with those of wild-type plants. (B) Representative images of PcBAK1-overexpressing Italian poplar lines and wild-type plants 4 days after inoculation with Diplodia populina. (C) The areas of lesions and healthy areas were calculated using ImageJ, and the lesion area was expressed as the ratio of lesion area to healthy area. (D) Determination of the relative biomass of Diplodia populina in Italian poplar leaves.
[0023] Figure 4 The SA and JA pathways are involved in PcBAK1-mediated poplar defense against Diplodia populina. DETAILED DESCRIPTION
[0024] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples, unless otherwise specified, are conventional methods. The test materials used in the following examples, unless otherwise specified, were purchased from conventional biochemical reagent stores.
[0025] I-214 poplar differentiation medium: 2.41 g WPM medium powder, 25 g sucrose, 7.8 g agar, and then add plant hormones to a final concentration of 0.2 mg / L 6-BA, 0.02 mg / L NAA, and 0.002 mg / L TDZ. Add deionized water to 1 L, adjust the pH to 6.8, and autoclave at 121°C for 20 minutes.
[0026] I-214 poplar rooting medium: 2.41 g WPM medium powder, 30 g sucrose, 7.8 g agar, dilute to 1 L with deionized water, adjust pH to 6.8, and sterilize by autoclaving at 121°C for 20 minutes.
[0027] Example 1 Analysis of the relative expression of PcBAK1 in Populus Italiana I-214 induced by infection with Diplodia populus
[0028] Wild-type I-214 poplar leaves were inoculated by spore spray inoculation, and relative gene expression was analyzed by qRT-PCR. The specific steps are as follows.
[0029] 1) 3-4 week-old I-214 poplar sterile tissue culture seedlings were removed from the culture flasks and gently rinsed under running sterile water until the residual culture medium on the roots was completely removed. The seedlings were then transferred to a transparent culture box filled with sterile water and placed in a constant temperature incubator maintained at 25°C with a 16-h light and 8-h dark cycle for 2 days of hydroponic adaptation.
[0030] 2) When inoculating, use a sterile spray bottle to mix the spore suspension (1*10 7 ) evenly spray the underside of the leaves, ensuring the atomized droplets completely cover the leaf surface. Immediately after spraying, cover the entire plant with a transparent plastic cover to create an airtight, moisturizing environment. Return the plant to the original incubator under the same culture conditions and remove the plastic cover after 3 days.
[0031] 3) Collect inoculated leaf samples from 0 to 8 days after inoculation. For each plant, collect the 3rd, 4th, and 5th leaves from the top and combine them together to form the inoculated leaf sample for that plant. All samples were quickly frozen in liquid nitrogen and stored at -80°C until use.
[0032] 4) The relative expression level of PcBAK1 was determined by qRT-PCR. Actin from Populus Italiana I-214 was used as a normalization reference gene. The specific qRT-PCR primer sequences are shown in Table 1.
[0033] Table 1 qRT-PCR primer sequences
[0034] Primer name Sequence (5'-3') PcBAK1 qRT-F AGTTGAGATGATCATCAGCATG(SEQ ID NO.3) PcBAK1 qRT-R CATGCTTCTTGAACTTATC(SEQ ID NO.4) PcActin-F GCCCTTCCACATGCCATCCT(SEQ ID NO.5) PcActin-R TCCCGTTCAGCTGTGGTTGT(SEQ ID NO.6)
[0035] Test results such as Figure 1 As shown in the figure, the relative expression of PcBAK1 gene in wild-type seedlings of Italian Populus I-214 after induction treatment with Diplodia populi for 0, 1, 3, 5 and 7 days was detected by qRT-PCR technology, which proved that the infection of Diplodia populi would induce a significant increase in the expression level of PcBAK1 in Italian Populus I-214.
[0036] Example 2 Obtaining a PcBAK1 Overexpressing Transgenic Line
[0037] The amino acid sequence of the protein encoded by the LRR receptor kinase PcBAK1 in poplar is shown in SEQ ID NO.1, and the nucleotide sequence of the gene is shown in SEQ ID NO.2.
[0038] 1. Use EcoRI restriction endonuclease to perform single enzyme digestion on the PRI101 vector at 37°C overnight. The enzyme digestion system is shown in Table 2.
[0039] Table 2 Enzyme digestion system
[0040]
[0041]
[0042] In order to perform homologous recombination with the pRI101 vector, the gene sequence of PcBAK1 (SEQ ID NO. 1) was cloned using primers with 18 bp overlapping homology arms on both sides of the pRI101 restriction site. The primers used for connecting PcBAK1 to pRI101 were pRI101-PcBAK1-F: 5'-TCCTCGCCCTTGCTCACCATGGATCCATGTGGGCGATCTGGAC CTC-3' (SEQ ID NO. 7), pRI101-PcBAK1-R: 5'-CCGTCGACCCCGGGGGTACCGGATCCTCTTGGTCCAGACAATT CATCT-3' (SEQ ID NO. 8). The linearized plasmid was then homologously recombined with the corresponding recovered target gene fragment. The homologous recombination reaction used the homologous recombination enzyme ClonExpress II One Step Cloning Kit (Novozymes), and the reaction conditions were 37°C water bath for 30 minutes. The specific reaction system is shown in Table 3. After verification, the overexpression vector of the PcTMK1 gene was obtained.
[0043] Table 3 Homologous recombination reaction system
[0044] Component name volume Linearized plasmid 2 Insert 1 CEII Buffer 4 Exnase II 2 Sterile deionized water 11
[0045] 2. Obtaining the I-214 poplar PcBAK1 overexpression strain by Agrobacterium infection
[0046] 1) Agrobacterium activation and expansion
[0047] Agrobacterium GV3101 containing the pRI101::PcBAK1 overexpression vector was streaked onto LB solid medium containing the corresponding antibiotics and cultured at 28°C for 48 hours. A single colony was picked and inoculated into LB liquid medium containing the same concentration of antibiotics and cultured at 28°C, 200 rpm, and OD600 = 0.6 (approximately 18 hours). 1 mL of the activated bacterial solution was transferred to 50 mL of fresh LB medium and cultured at 28°C, oscillating for 6 hours to OD600 = 0.6. The cells were collected by centrifugation at 4°C, 5000 rpm for 5 minutes, resuspended in liquid differentiation medium to OD600 = 0.3, and 150 μM acetosyringone was added for later use.
[0048] 2) Poplar leaf transformation
[0049] Young leaves of Populus Italiana I-214 tissue culture seedlings were incised with a 3 mm wound and immersed in an Agrobacterium suspension for 7 minutes. The leaves were rinsed three times with sterile water to remove surface bacteria. After drying with filter paper, the leaves were spread flat on antibiotic-free differentiation medium and incubated in the dark for 48 hours to induce callus.
[0050] 3) Resistance screening and regeneration
[0051] Leaves were transferred to differentiation medium containing 200 mg / L timentin for sterilization. After 8 days, they were transferred to screening medium containing 30 mg / L Kan for continued selection, with the medium changed every 8 days. When shoots reached 3 cm in length, they were excised and transferred to rooting medium containing 10 mg / L Kan. Positive plants were selected and gene expression was verified. The primer sequences used are shown in Table 1.
[0052] Test results such as Figure 2 As shown, Italian poplar I-214 transgenic plants overexpressing PcBAK1 were successfully obtained. The PcBAK1 gene expression level of the transgenic line was 24.16 times that of the wild type. There was no significant difference in plant height and root length between the transgenic line and the wild type.
[0053] Example 3 Analysis of the effect of overexpression of PcBAK1 on the resistance of Italian Poplar I-214 to Diplodia populina
[0054] Transgenic I-214 poplar leaves were inoculated using a spore spray inoculation method. The spore suspension preparation, inoculation method, and diseased sample collection procedures were as described in Example 1. The biomass of D. poplarii was determined using qRT-PCR. Actin (Populus italica) was used as a normalization reference gene, and the relative expression of the D. poplarii EF-1α reference gene was used as a proxy for biomass accumulation. The primer sequences used were: MbEF1a-F: 5'-GCCCAGGTCATCGTTCTCAACCAC-3' (SEQ ID NO. 9), MbEF1a-R: 5'-ATCCAATCCTCGCACATCGTAACA-3' (SEQ ID NO. 10). The biomass of D. poplarii from inoculated wild-type plants was used as a control.
[0055] The results are as follows Figure 3 As shown in the figure, after the leaves of the Italian poplar I-214 PcBAK1 overexpressing transgenic strain were inoculated with a spore suspension of Diplodia populina for 4 days, the differences in disease resistance to Diplodia populina were compared, which proved that overexpression of PcBAK1 can significantly improve the resistance of transgenic Italian poplar I-214 plants to Diplodia populina.
[0056] Example 4 Overexpression of PcBAK1 affects the expression of immune-related marker genes in Italian Populus I-214
[0057] Immune marker genes in Populus Italiana I-214 include genes involved in the SA and JA defense signaling pathways: PcPR1, PcPR2, PcPAD4, PcPAL1, PcPAL2, PcWRKY73, PcCOI1, and PcWRKY40. Actin was used as an internal reference gene, and the expression levels of the target genes in wild-type plants were used as controls. qRT-PCR primers are shown in Table 2.
[0058] Table 2 qRT-PCR primers for genes related to SA and JA defense signaling pathways
[0059]
[0060]
[0061] Test results such as Figure 4 As shown in the results, overexpression of PcBAK1 significantly increased the up-regulated expression of genes related to the SA and JA defense signaling pathways in transgenic Italian poplar I-214. It can be seen that PcBAK1 overexpression lines significantly enhanced poplar resistance to pathogens, and PcBAK1 is involved in regulating the activation of the SA and JA defense signaling pathways.
[0062] In summary, infection with Diplodia spp. induces upregulation of the PcBAK1 gene in Populus variegata I-214. Overexpression of PcBAK1 significantly enhances the immune resistance of transgenic Populus variegata I-214 to Diplodia spp. without affecting its growth rate. Therefore, the small peptide signaling molecule PcBAK1 gene can be used to enhance plant resistance to Diplodia spp. and to develop new transgenic plant varieties resistant to Diplodia spp. Furthermore, improved plant disease resistance can reduce the use of chemical pesticides and reduce environmental pollution.
[0063] While the specific embodiments of the present invention have been described in detail above, these are intended to be exemplary only, and the present invention is not limited thereto. For those skilled in the art, any equivalent modifications and substitutions to the present invention are also within the scope of the present invention. Therefore, any equivalent changes and modifications made without departing from the spirit and scope of the present invention are intended to be encompassed within the scope of the present invention.
Claims
1. Use of LRR receptor kinase PcBAK1 or its encoding nucleic acid in improving poplar resistance to fungal diseases, characterized in that: The amino acid sequence of the protein encoded by the LRR receptor kinase PcBAK1 is shown in SEQ ID NO.
1.
2. The use according to claim 1, characterized in that The nucleotide sequence of the LRR receptor kinase PcBAK1 is shown in SEQ ID NO.
2.
3. The use according to claim 1, characterized in that The poplar is Italian poplar, preferably Italian poplar I-214.
4. The use according to claim 1, characterized in that The fungi include Marssonina brunnea.
5. The use according to any one of claims 1 to 4, characterized in that: The application comprises the step of increasing the expression level of LRR receptor kinase PcBAK1 in poplar.
6. A method for improving poplar resistance to fungal diseases, characterized in that: The method comprises the following steps, (1) Construct an overexpression vector for the LRR receptor kinase PcBAK1; (2) transforming the constructed overexpression vector into poplar tissue or poplar cells; (3) Cultivate and screen transgenic poplars with improved resistance to fungal diseases.
7. The method according to claim 6, characterized in that The amino acid sequence of the protein encoded by the LRR receptor kinase PcBAK1 is shown in SEQ ID NO.
1.
8. The method according to claim 6, characterized in that The nucleotide sequence of the LRR receptor kinase PcBAK1 is shown in SEQ ID NO.
2.
9. The method according to claim 6, characterized in that The poplar is Italian poplar, preferably Italian poplar I-214.
10. The method according to claim 6, characterized in that The fungi include Marssonina brunnea.
Citation Information
Patent Citations
PagVQ13 gene and application thereof in resisting fungal infection of poplar
CN117535301A
A transgenic plant having resistance to a phyto-pathogenic fungus
US20200131526A1