SNP (Single Nucleotide Polymorphism) site related to length of fourth web of bee and application of SNP site in improvement of bee germplasm resources

Abstract

The invention relates to the technical field of bee breeding, in particular to an SNP (Single Nucleotide Polymorphism) site related to the fourth web length of bees and application of the SNP site in improvement of bee germplasm resources. The SNP site comprises a nucleotide sequence as shown in SEQ ID NO.1, the 301st site of the nucleotide sequence is a polymorphic mutation site, and the mutation type is C / T. The SNP site related to the length of the fourth web of the bee is obtained through screening, and detection of the length of the fourth web of the bee can be achieved by identifying the genotype of the SNP site. The SNP locus provided by the invention can be used for improving germplasm resources of bees, and has important significance in the field of breeding high-quality bees.

Description

Technical Field

[0001] The present invention relates to the technical field of bee breeding, and in particular to a SNP site associated with the length of the fourth stomata of bees and an application thereof in improving bee germplasm resources. Background Art

[0002] Chinese honey bee ( Apis cerana The Chinese honey bee, a subspecies of the Oriental honey bee, is a primary pollinator in forest communities and traditional agriculture. It thrives naturally on staple crops and scattered nectar-producing plants. The Chinese honey bee possesses many unique advantages, including its ability to utilize scattered nectar sources, its ability to collect relatively low-concentration nectar, its high reproductive capacity, and its tolerance to cold and heat and disease.

[0003] The development of molecular markers for the Chinese honey bee facilitates accurate species identification, improves breeding efficiency and accuracy, and fosters the development of superior bee varieties. The fourth stomata, located on the bee's abdomen, contain wax lenses for beeswax secretion. The length of the fourth stomata indirectly reflects the bee's ability to secrete wax and, consequently, its ability to build honey and wax nests. Developing molecular markers for this trait will facilitate the breeding of high-quality bee varieties. Summary of the Invention

[0004] In order to solve the problems existing in the prior art, the present invention provides a SNP site associated with the length of the fourth stomata of honeybees and its application in improving honeybee germplasm resources.

[0005] In a first aspect, the present invention provides a SNP site associated with the length of the fourth stern of honey bees, comprising a nucleotide sequence as shown in SEQ ID NO. 1, wherein position 301 of the nucleotide sequence is a polymorphic mutation site, and the mutation type is C / T; The nucleotide sequence shown in SEQ ID NO.1 includes: .

[0006] In a second aspect, the present invention provides a KASP primer pair for amplifying the SNP site of claim 1, comprising: F1: 5'-AGAAATTATGATTTTAAACTGAAAAC-3', F2: 5'-AGAAATTATGATTTTAAACTGAAAT-3', R: 5'-TCGATCTGACGTATTGCAATTGT-3'.

[0007] Furthermore, F1 and F2 carry different fluorescent markers (also called fluorescent tags), respectively, and the fluorescent markers include: one or more of FAM, TET, HEX, ROX, Cy3, Cy5, Alexa Fluor, SYBR Green, DAPI, FITC or Texas Red.

[0008] For example, GAAGGTGACCAAGTTCATGCT (FAM) was linked to the 5' end of F1, and GAAGGTCGGAGTCAACGGATT (HEX) was linked to the 5' end of F2.

[0009] In a third aspect, the present invention provides a detection kit, comprising the aforementioned SNP site and the KASP primer pair according to claim 2.

[0010] In a fourth aspect, the present invention provides use of the SNP site, or the KASP primer pair, or the detection kit in any one or more of the following: (1) Detecting the length of the fourth sternum of honey bees; (2) Molecular marker-assisted breeding of honey bees; (3) Improvement of honey bee germplasm resources.

[0011] Furthermore, the bee is an oriental honey bee, preferably a cerana cerana cerana cerana.

[0012] Furthermore, the application includes: The polymorphism of the aforementioned SNP site of the honeybee is detected, and the length trait of the fourth stomata of the honeybee is determined according to the detection results.

[0013] Furthermore, the detection includes one or more of sequencing, probe detection, molecular beacon or PCR.

[0014] Furthermore, the determining of the fourth stomata length trait of the bee according to the detection result includes: Regarding the polymorphism of the aforementioned SNP sites, the test results showed that the length of the fourth ventral plate of the C / C genotype Chinese bee was significantly shorter than that of the C / T genotype Chinese bee.

[0015] The present invention has the following beneficial effects: The present invention screened a single nucleotide polymorphism (SNP) site that has been verified to be associated with the length of the fourth sac of the Chinese honeybee. By detecting the polymorphism of this SNP site, the length of the fourth sac of honeybees can be identified. The SNP site provided by the present invention and its application can be further applied to molecular marker-assisted breeding of honeybees to cultivate high-quality honeybee varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the technical solutions in the present invention or the prior art, a brief introduction is given below to the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0017] Figure 1This is an association diagram between different genotypes of the Chr12_1162897 locus of the Chinese honeybee and the fourth stern length trait of individual honeybees provided in Example 2 of the present invention. DETAILED DESCRIPTION

[0018] To make the objectives, technical solutions, and advantages of the present invention more clear, the technical solutions of the present invention will be clearly and completely described below in conjunction with the accompanying drawings. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention.

[0019] Unless otherwise specified, the experimental methods involved in the following examples are all conventional methods in the art. For example, reference can be made to experimental manuals in the art, or the conditions recommended by the manufacturer's instructions.

[0020] Unless otherwise specified, the experimental materials and reagents involved in the following examples can be obtained from commercial sources.

[0021] Example 1 The present invention conducted genome-wide association analysis on honey bee data and obtained a SNP site (Chr12_1162897). The screening process is as follows: 1. This invention is based on samples from 110 colonies of Apis cerana cerana, targeting the length of the fourth ventral plate. Genomic DNA was extracted from the thorax tissue of the dissected worker bees. Library construction was then performed using the Truseq Nano DNA HT Kit (Illumina, USA). The DNA was randomly fragmented into 350 bp fragments. The DNA library was obtained through end-repair, PloyA tailing, sequencing adapter addition, amplification, and purification. The insert size of the library was quality-checked using an Agilent 2100, and the effective concentration of the library was accurately quantified using qPCR. Once the quality met the standards, the DNA library was constructed.

[0022] 2. Genome Sequencing, Alignment, and SNP Identification: After successful sample library construction, genome sequencing was performed on the Illumina HiseqPE150 platform (Illumina, USA). Low-quality reads were removed during sequencing to ensure quality [quality control criteria: reads containing more than 10% unknown nucleotides, reads containing adapter sequences, and reads with low-quality (phred quality < 5) bases exceeding 50% of the sequence length]. Finally, high-quality paired-end clean reads of at least 4.5G were generated for each honey bee sample, with Q20 and Q30 values ​​exceeding 90% and 85%, respectively.

[0023] 3. High-quality paired-end clean reads were aligned to the reference genome, Apis cerana (Genbank accession number: PRJNA738447), using BWA 0.7.8 software. Alignment results were deduplicated using SAMTOOLS 1.15 software. The average alignment rate for the population samples was maintained at over 95%, and the average sequencing depth across the genome was over 20X.

[0024] 4. A Bayesian model in SAMTOOLS 1.15 software was used to detect cluster SNPs. High-quality SNPs were screened based on quality control criteria (removing SNPs with a sequencing error rate >1% (Q20 quality control), removing SNPs with a base spacing of <5 between adjacent SNPs, and removing SNPs with a coverage depth exceeding 1 / 3 to 5 times the average). Detected SNPs were annotated using ANNOVAR 20130520 software to identify exons, introns, alternative splice sites, upstream and downstream regions, and intergenic regions, and to distinguish between synonymous and nonsynonymous SNPs.

[0025] 5. Genome-wide association analysis: Genome-wide association studies (GWAS) were performed using mrMLM 1.3 software to clarify the association between the fourth ventral plate length trait and SNPs. The SNP quality control standard was MAF>5%, and the multilocus random mixed linear model was selected as the model.

[0026] 6. Finally, the present invention screened and obtained multiple SNP sites related to the fourth stern length trait, as follows: Table 1 Association between the fourth stern length phenotype of honey bees and SNPs

[0027] One of the most significant is Chr12_1162897, located at position 1162897 on honeybee chromosome 12, with a C / T polymorphism. Bees with the C / C polymorphism have significantly shorter fourth sterns than those with the C / T polymorphism.

[0028] Example 2 1. The present invention selected 106 Chinese honeybee samples to verify the association between the SNP site screened in Example 1 and the fourth sac length trait of the Chinese honeybee. Specifically, the fourth sac length of 106 bees was measured using a microscopic measurement system, and the SNP data of 106 bees were detected by gene sequencing. Finally, the fourth sac length data and SNP data of 106 bees were obtained.

[0029] The present invention further groups the genotypes according to the SNP sites, and uses SPSS 16.0 software to perform a significance analysis on the fourth stern length data of different groups to compare whether there are differences in the fourth stern length among different genotypes.

[0030] Finally, 92 Chinese bees showed C / C genotype, and 14 Chinese bees showed C / T genotype. The data were analyzed by independent sample T test. Figure 1 As shown in Table 2, there was a significant difference between the C / C genotype and the C / T genotype (P<0.05), and the length of the fourth ventral plate of the C / C genotype Chinese bee was significantly shorter than that of the C / T genotype Chinese bee.

[0031] Table 2 Comparison of the length of the fourth sternum in individuals with different genotypes at Chr12_1162897 in the Chinese honey bee

[0032] The results above indicate that the Chr12_1162897 SNP is associated with the fourth sac length trait in honey bees. Detecting this SNP in honey bees using methods such as gene sequencing can identify the length of the fourth sac in honey bees. The SNP provided by this invention can be used to breed bees that specifically possess the fourth sac length trait and improve honey bee germplasm resources.

[0033] 2. The present invention further provides a KASP primer pair for amplifying the SNP site Chr12_1162897, comprising: F1: 5'-GAAGGTGACCAAGTTCATGCTagaaattatgattttaaactgaaaaC-3', F2: 5'-GAAGGTCGGAGTCAACGGATTagaaattatgattttaaactgaaaaT-3', R: 5'-tcgatctgacgtattgcaattgt-3'.

[0034] Among them, F1 carries a FAM fluorescent label and F2 carries a HEX fluorescent label (carrying the corresponding fluorescent dyes during actual detection). Therefore, after PCR amplification, it can be detected using a fluorescence detection device, and the detection results of the FAM and HEX fluorescence channels can be used to determine whether the genotype of the sample to be tested is T / T (HEX fluorescence signal exceeds the threshold), T / C (both FAM and HEX fluorescence signals exceed the threshold), or C / C (FAM fluorescence signal exceeds the threshold).

[0035] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A SNP site associated with the length of the fourth stern of honey bees, characterized in that: The invention comprises a nucleotide sequence as shown in SEQ ID NO. 1, wherein position 301 of the nucleotide sequence is a polymorphic mutation site, and the mutation type is C / T; The nucleotide sequence shown in SEQ ID NO.1 includes: .

2. A KASP primer pair, characterized in that: include: F1: 5'-AGAAATTATGATTTTAAACTGAAAAC-3', F2: 5'-AGAAATTATGATTTTAAACTGAAAT-3', R: 5'-TCGATCTGACGTATTGCAATTGT-3'.

3. A detection kit, characterized in that The detection kit comprises the SNP site according to claim 1 and the KASP primer pair according to claim 2.

4. Use of the SNP site according to claim 1, or the KASP primer pair according to claim 2, or the detection kit according to claim 3 in any one or more of the following: (1) Detecting the length of the fourth stomata of honey bees; (2) Molecular marker-assisted breeding of honey bees; (3) Improvement of honey bee germplasm resources.

5. The use according to claim 4, characterized in that The honey bee is an oriental honey bee, preferably a cerana ....

6. The use according to claim 4 or 5, characterized in that The applications include: The polymorphism of the SNP site of the honey bee as claimed in claim 1 is detected, and the fourth stern length trait of the honey bee is determined according to the detection result.

7. The use according to claim 6, characterized in that The detection includes one or more of sequencing, probe detection, molecular beacon or PCR.

8. The use according to claim 6 or 7, characterized in that The determining of the length of the fourth stomata of the bee according to the detection results includes: Regarding the polymorphism of the SNP site as described in claim 1, the test result shows that the length of the fourth stomata of the C / C genotype Chinese bee is significantly shorter than that of the C / T genotype Chinese bee.

Images