Primers for amplifying molecular markers of glycyrrhiza uralensis, glycyrrhiza inflate and glycyrrhiza glabra and application of primers

By designing specific primers for PCR amplification and using InDel molecular markers to quickly identify Glycyrrhiza uralensis, Glycyrrhiza inflata and Glycyrrhiza glabra, the problems of complex identification and insufficient resolution in existing technologies were solved, and rapid and accurate licorice species differentiation was achieved.

CN120683292APending Publication Date: 2025-09-23NORTHWEST UNIV +1
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510810360.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-17
Publication Date
2025-09-23

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly and accurately distinguish between Glycyrrhiza uralensis, Glycyrrhiza inflata and Glycyrrhiza glabra. Traditional morphological identification has large errors, DNA sequencing methods are costly and complex, and SNP and SSR molecular identification technologies have insufficient resolution.

Method used

Specific primers were designed for PCR amplification, and InDel molecular markers were used to determine the type of licorice by the length of the PCR amplification product. Specific upstream and downstream primers were used for genomic DNA amplification to achieve rapid identification of the three licorice species.

Benefits of technology

The rapid and accurate identification of the three types of licorice was achieved with simple operation, low cost, easy judgment of test results, high resolution, and suitable for large-scale testing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120683292A_ABST
    Figure CN120683292A_ABST
Patent Text Reader

Abstract

The invention provides a primer for amplifying molecular markers of glycyrrhiza uralensis, glycyrrhiza inflate and glycyrrhiza glabra and application of the primer. The nucleotide sequences of the primer are as follows: 5 '-TCCCGCCATAACTTACCTA-3' and 5 '-GAAATGCAGGACCAAAAGGA-3'. The primer can be used for identifying glycyrrhiza uralensis, glycyrrhiza inflate and glycyrrhiza glabra. According to the method, rapid identification of the three species of the Xinjiang glycyrrhiza uralensis, the glycyrrhiza glabra and the glycyrrhiza inflate can be achieved at the same time only through one-time PCR, the method has the advantages of being easy to operate and low in price, and the detection result is easy to judge, high in conservative type, accurate and reliable.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of biotechnology, relates to identification of liquorice species, and particularly relates to primers for amplifying molecular markers of uralensis, inflated fruit and glabra and applications thereof. Background Art

[0002] Licorice (RADIX GLYCYRRHIZAE) refers to the legume plant Ural Licorice ( Glycyrrhiza uralensis Fisch. )、Glycyrrhiza uralensis ( Glycyrrhiza inflata Batal. )、Glycyrrhiza glabra( Glycyrrhiza glabra Linn. Among them, Ural Glycyrrhiza uralensis is the most widely used in traditional Chinese medicine.

[0003] Licorice root varieties vary in morphological characteristics from both different and even within the same origin, and genetic variation is diverse both within and between species. This poses significant challenges for identifying interspecific relationships, taxonomic identification, and the effective utilization of active ingredients. The three types of licorice root mentioned above exhibit highly similar morphological characteristics, making them difficult to distinguish, especially in their dried form. This has led to a proliferation of counterfeit products in the market, seriously impacting clinical efficacy and the conservation of germplasm resources.

[0004] Traditional morphological identification relies on experience and has a high error rate. Sequencing methods based on DNA barcodes (such as ITS and rbcL) are accurate but costly, time-consuming, and difficult to meet the needs of large-scale testing. In addition, although molecular identification techniques such as SNP (single nucleotide polymorphism) and SSR (simple sequence repeat) provide important genetic evidence for distinguishing plant species, the operational procedures in actual applications are relatively complex. More importantly, the resolution of these markers is sometimes insufficient to accurately distinguish closely related species, hybrids, or local varieties with complex genetic backgrounds. When intraspecific genetic diversity is low or the degree of differentiation between target species is not high, the amount of information provided by SSR or SNP sites may be limited, resulting in unclear or unreliable identification results. Summary of the Invention

[0005] In view of the defects and shortcomings of the existing technology, the purpose of the present invention is to provide a primer and application for amplifying molecular markers of Ural, Glycyrrhiza inflata and Glycyrrhiza glabra, so as to solve the technical problems of complex operation and insufficient resolution when using molecular identification technologies such as SNP and SSR in the existing technology to distinguish Ural, Glycyrrhiza inflata and Glycyrrhiza glabra.

[0006] In order to solve the above technical problems, the present invention adopts the following technical solutions: A primer for amplifying molecular markers of Glycyrrhiza uralensis, Glycyrrhiza inflata and Glycyrrhiza glabra comprises an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is 5'-TCCCGCCATCAACTTACCTA-3', and the nucleotide sequence of the downstream primer is 5'-GAAATGCAGGACCAAAAGGA-3'.

[0007] The present invention also protects the use of the primers described above for identifying Glycyrrhiza uralensis, Glycyrrhiza inflata and Glycyrrhiza glabra.

[0008] The present invention also has the following technical features: Specifically, the application uses primers for amplifying molecular markers of Glycyrrhiza uralensis, Glycyrrhiza inflata and Glycyrrhiza glabra as amplification primers, and uses the genomic DNA of the sample to be tested as the amplification template to perform PCR amplification to obtain PCR products; if the PCR product includes a specific amplification band with a length of 450bp, it indicates that the sample to be tested is Glycyrrhiza uralensis; if the PCR product includes a specific amplification band with a length of 795bp, it indicates that the sample to be tested is Glycyrrhiza inflata; if the PCR product includes a specific amplification band with a length of 475bp, it indicates that the sample to be tested is Glycyrrhiza glabra.

[0009] Specifically, the PCR amplification system is: 10 μL of PCR amplification buffer premixed with DNA polymerase, 0.5 μL of upstream primer, 0.5 μL of downstream primer, 50 ng of amplification template, and the total volume of the system is supplemented to 20 μL with H2O.

[0010] Specifically, the PCR amplification program was as follows: pre-denaturation at 94°C for 30 s; denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, 34 cycles; and extension at 72°C for 2 min.

[0011] The beneficial technical effects of the present invention compared with the prior art are as follows: Based on the indel molecular markers found in the genomes of three types of licorice, specific primers were designed. These primers were used to amplify the genomic DNA of licorice samples. The specific species of licorice can be determined based on the length of the PCR amplification product. This method can simultaneously achieve rapid identification of three species (Glycyrrhiza uralensis, Glycyrrhiza glabra, and Glycyrrhiza inflata) using a single PCR assay. This method offers the advantages of simple operation and low cost, and the test results are easy to interpret, highly conservative, and accurate and reliable. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is the 1% agarose gel electrophoresis of Glycyrrhiza uralensis genomic DNA. Figure 1Middle: Lane M is a DNA marker, and the bands from bottom to top are: 250bp, 1000bp, 2500bp, 5000bp, 7500bp, 10000bp, 15000bp; Lanes 1 to 45 are genomic DNA of Glycyrrhiza uralensis.

[0013] Figure 2 1% agarose gel electrophoresis of multiple Glycyrrhiza uralensis samples. Figure 2 Middle: Lane M is a DNA marker, and the bands from bottom to top are: 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp; Lanes 1 to 12 are PCR amplification products of Ural Glycyrrhiza samples.

[0014] Figure 3 The results of agarose gel electrophoresis of multiple Glycyrrhiza inflata samples are shown. Figure 3 Middle: Lane M is a DNA marker, and the bands from bottom to top are: 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp; Lanes 1 to 16 are PCR amplification products of Glycyrrhiza inflata samples.

[0015] Figure 4 Agarose gel electrophoresis results of multiple Glycyrrhiza glabra samples. Figure 4 Middle: Lane M is a DNA marker, and the bands from bottom to top are: 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp; Lanes 1 to 16 are PCR amplification products of Glycyrrhiza glabra samples. DETAILED DESCRIPTION

[0016] It should be noted that all reagents and kits used in the present invention are those known in the art unless otherwise specified, for example: The commercially available PCR amplification reagent used was AccuPrime™ Pfx DNA Polymerase (Thermo Fisher Scientific, Catalog No. 12344032).

[0017] The commercially available Tiangen DNA Extraction Kit (Cat. No. DP305) was used to extract genomic DNA from Glycyrrhiza uralensis.

[0018] In accordance with the above technical solution, specific embodiments of the present invention are given below. It should be noted that the present invention is not limited to the following specific embodiments, and all equivalent changes made on the basis of the technical solution of this application fall within the protection scope of the present invention.

[0019] Example 1: This example provides a primer for amplifying molecular markers of Glycyrrhiza uralensis, Glycyrrhiza inflata, and Glycyrrhiza glabra, including an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer PFChr5-2 is: 5'-TCCCGCCATCAACTTACCTA-3', and the nucleotide sequence of the downstream primer PRChr5-2 is: 5'-GAAATGCAGGACCAAAAGGA-3'. Example 2: This example describes the use of the primers of Example 1 for identifying Glycyrrhiza uralensis, Glycyrrhiza inflata, and Glycyrrhiza glabra. In this application, the primers for amplifying the Glycyrrhiza uralensis molecular marker of Example 1 are used as amplification primers, and the genomic DNA of the sample to be tested is used as the amplification template. PCR amplification is performed to obtain a PCR product, which is the Glycyrrhiza uralensis molecular marker amplification product. If the PCR product includes a 450 bp specific amplification band, it indicates that the sample to be tested is Glycyrrhiza uralensis. If the PCR product includes a 795 bp specific amplification band, it indicates that the sample to be tested is Glycyrrhiza inflata. If the PCR product includes a 475 bp specific amplification band, it indicates that the sample to be tested is Glycyrrhiza glabra.

[0020] As a specific solution of this embodiment, the nucleotide sequence of the 450 bp specific amplification band is: 5'-CGGGGAAGGGGGGTGCATTGAGGAAGTTGCAGACAGGGTTAGTTGAGGCAACAACCAAAGAAATGCAGGAACAAAAATTTTCTTTTCAAGAATACCCATTATACCCCTATATGTATTTATGCATAGGACTGTAGTGTAGGGATGACAAAATGGGTTAGGCCTGTCGAGTCGTCCCGTTCAACCTGCCTTTTTTGGCGGGGCGAGTTGG GGTTCTCAACCCACCAACCCATTTTGACCTGCCTCGCATAACCCACCAAGAAAGCAGGGAAGGTTGGCCCGTCAAATTATTTTATTTTTTAAAACAATTTTGTTCTGAACATTTATTGTTTTTCTATTTTTTAAATTTTTGGCGGGCCAACACGTTGCGGGGCGAGTTGGTATTTGCAACCCACTTCTAAAATCTAACTCCCTGCCCCGCCCTATTTTAGGTAAGTTGATGGCGGGAA-3'.

[0021] As a specific solution of this embodiment, the nucleotide sequence of the 795bp specific amplification band is: 5’- CCCCGTTGGCCGGGTTTCATTTGAAGGTAGTTGCAGACAGGGTTAGTTGAGGCAACAACCGAAGAAATGCAAGAACAAAAATTTTCTTTTCAAGAATACCCATTATACCCCTATATGTATTGATGCATAGGACTGTAGTGTAGGGATGACAAAATGGGTTAGGCCTAGAGCTGGCAAAATGGGCTTAGCCCGCCGGGCCAACCCGAGTCCGCCCAAAAAAACACCGGGCTTGGACACACAAATTCGAGCCCGTTTTTAATCCGGGCTTTTTTGGTCCGGCTCGACAAAGCCCGAACCCGTAAAAGCCCGAGCTCGAAGCAGGCCACCCGAAAAACATAGGCCAAAGCCCGAGCCCGGCCCGAAAAAAGCCCGAAAAATATAGGGCTCGGACACACAAATTTGAGCCCGTTTTTAATCCGAGTTTTTTTGGCCCGGCCCGATAAAGCCCGAACCCGATGCGGGCCGACCCGAGCCCGGCCCGAATTGTCACCTCTAGTTAGGCCTGTCGAGTCGTCCCGTTTAACCTGCCTTTTTTGGCGGGGGCGGGTTGGGGTTCTCAACCCACCAACCCATTTTGACCTGCCTCGCATAACCCACCAAGAAAGCAGGGAAGGTTGGCCCGTCAAATTACTATTTTATTTTTTAAAACAATTTTTTTCTTAACATTTATTGTTTTTCTATTTTTTAAATTTTTTGGCTGGCCAACACGTCGCGGGGCGGGTTGGTATGTGCAACCCACTTCTAAAATCTAACCCCCTGCCCCGCCCTGTTTTAGGTAAGTAAATGGCGGGGAAA-3’。

[0022] As a specific solution of this embodiment, the sequence of the 475bp specific amplification band is: 5'- TTCCCGCCATCAACTTACCTAAAATAGGGCGGGGCAGGGAGTTAGATTTTAGAAGTGGGTTGCAAATACCAACCCGCCCCGCAACGTGTTGGCCCGCCAAAAAATTTAAAAAATAGAAAAACAATAAATGTTCAGAACAAAATTGTTTTAAAAAATAAAATAATAATTTGACGGGCCAACCTTCCCTGCTTTCTTGGTGGGTTATGCGAGGCAGGTCAAAATGGGTTGGTGGGTTGAGA ACCCCAACTCGCCCCGCCAAAAAAGGCAGGTTGAACGAGACGACTCGACAGGCCTAACCCATTTTGTCATCCCTACACTACAGTCCTATGCATCAATACATATAGGGGTATAATGGGTATTCTTGAAAAGAAAATTTTTGTTCCTGCATTTCTTTGGTTGTTGCCTCAACTAACCCTGTCTGCAACTATCCTCAATTGCAACCACCACTACCACCTCCTTTTGGTCCTGCATTTCA-3'.

[0023] As a specific solution of this example, the PCR amplification system is as follows: 10 μL of 2× Taq Master Mix, 0.5 μL of upstream primer, 0.5 μL of downstream primer, 1 μL (50 ng) of amplification template, and 8 μL of H2O to make up the total volume of the system to 20 μL.

[0024] As a specific solution of this embodiment, the PCR amplification program is as follows: 94°C pre-denaturation for 30s; 98°C denaturation for 10s, 55°C annealing for 30s, 72°C extension for 1min, 34 cycles; 72°C extension for 2min, and the PCR product was stored at 4°C.

[0025] Example 3: This embodiment provides a method for obtaining primers for amplifying the licorice molecular marker of Example 1, which specifically includes the following steps: Step 1: Design primers based on the whole genome resequencing results of three licorice species, as follows: In step 1.1, detect indel markers with insertions / deletions greater than 20 bases. Primers should span the corresponding indel site and minimize the inclusion of other indel sites. Ten evenly distributed indel marker sites were selected for each chromosome. Primers were designed based on the location of the indel site in the reference genome, 500 base pairs upstream and downstream of the site.

[0026] In step 1.2, primer design parameters were as follows: primer length 18-25 bp, forward and reverse primers of similar length, GC content 40-60%, annealing temperature 55-65°C, upstream primer located within the first 180 bp, downstream primer located within the last 180 bp, and product size set between 100-500 bp. Based on these primer design parameters, 80 primer pairs were designed for amplifying licorice molecular markers. After design, they were sent to Sangon Biotech (Shanghai) Co., Ltd. for synthesis.

[0027] Step 2: Use a DNA extraction kit to obtain licorice genomic DNA (the specific species of licorice has been determined by morphology, ITS sequencing, etc.): In step 2.1, approximately 100 mg of frozen sample was selected and ground into a fine powder in a mortar. After extraction, the sample was stored in a -20°C refrigerator for later use.

[0028] In step 2.2, quickly transfer the ground sample powder to a 2.0 mL EP tube. Add 700 μl of 65°C preheated buffer GP1 and 0.7 μl of mercaptoethanol. Mix by inverting the tube upside down. Place the tube in a 65°C water bath for 20 min. Invert the tube several times while in the water bath.

[0029] In step 2.3, add 700 μl of chloroform, mix thoroughly, and centrifuge at 12,000 rpm for 5 min.

[0030] In step 2.4, carefully transfer the supernatant separated after centrifugation to a new 2.0 mL EP tube, add 700 μl of buffer GP1, and mix thoroughly.

[0031] In step 2.5, transfer the mixed liquid into the adsorption column CB3 twice, centrifuge at 12000 rpm for 30 seconds, and discard the waste liquid in the collection tube.

[0032] In step 2.6, 500 μl of buffer GD (the specified volume of anhydrous ethanol must be added before use) was added to the adsorption column CB3, and the mixture was centrifuged at 12,000 rpm for 30 s. The waste liquid in the collection tube was discarded.

[0033] In step 2.7, add 600 μl of rinse solution PW to the adsorption column CB3 (make sure to add the specified volume of anhydrous ethanol before use), centrifuge at 12,000 rpm for 30 seconds, and discard the waste liquid in the collection tube.

[0034] Step 2.8, repeat step 6, 2 times.

[0035] In step 2.9, return the adsorption column CB3 to the collection tube and centrifuge at 12,000 rpm for 2 minutes. Discard the waste liquid from the collection tube. Place the adsorption column CB3 in a new 1.5 mL EP tube and leave it at room temperature for several minutes until the residual rinse solution in the adsorption column CB3 is completely dry (determine if there is no ethanol smell).

[0036] Step 2.10: Add 65 μl of elution buffer TE to the middle filter membrane of adsorption column CB3 and let it stand at room temperature for 3-5 minutes to allow the elution buffer to fully elute the DNA.

[0037] In step 2.11, centrifuge the 1.5 mL EP tube containing the adsorption column CB3 at 12,000 rpm for 2 min, collect the solution into a 1.5 mL EP tube, and store at -20°C for later use.

[0038] Step 3: Detection of genomic DNA of Glycyrrhiza uralensis by agarose gel electrophoresis: Step 3.1: Inject an appropriate amount of 1× TBE into the electrophoresis tank; assemble the comb and gel plate.

[0039] In step 3.2, add 1 g agarose and 100 ml 1× TBE (1% gelatin) to a conical flask and heat in a microwave for 3 min.

[0040] Step 3.3: After the agarose is completely dissolved, wait for the temperature to cool to room temperature, add EB dropwise, shake well, and pour into the gel plate to gel.

[0041] Step 3.4: After gelation, start spotting.

[0042] Step 3.5: After the sample is spotted, perform constant voltage electrophoresis at 120 V for 30 min. After the electrophoresis is completed, observe and photograph the gel under a UV gel imager and store for processing.

[0043] In this embodiment, the detection results of Licorice genomic DNA are as follows Figure 1 As shown, from Figure 1 As can be seen in the figure, the genomic DNA of licorice is relatively clear, with neat and bright bands, indicating that the DNA is of good integrity and can be used for the next step of licorice molecular marker PCR amplification reaction.

[0044] Step 4: Licorice molecular marker PCR amplification reaction: PCR amplification was performed using the 80 pairs of primers designed in step 1 as amplification primers and the Licorice genomic DNA obtained in step 2 as amplification template. The PCR amplification system and procedure were exactly the same as those in Example 2.

[0045] In this embodiment, the amplified product was detected by 1% agarose gel electrophoresis at 120V for 20-30 minutes. The successfully amplified samples were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Bidirectional sequencing was used for each sample, and then the forward and reverse sequencing results were spliced ​​to ensure the accuracy of the sequencing. The final results are as follows: According to the results of agarose gel electrophoresis, it was found that the primer pair named Chr5-2 among the 80 pairs of Indel primers can clearly distinguish the three types of licorice. After sequencing and splicing, it was found that Ural Glycyrrhiza uralensis had a 450bp specific amplification band; Glycyrrhiza uralensis had a 795bp specific amplification band; and Glycyrrhiza glabra had a 475bp specific amplification band. Using the Chr5-2 primer pair as the amplification primer, some samples of known species were selected for verification. The results are as follows. Figures 2 to 4 As shown, the results showed that using the primers to perform PCR amplification on different licorice samples can obtain bands of different sizes, and thus the specific species of the three licorice can be identified.

Claims

1. A primer for amplifying molecular markers of Glycyrrhiza uralensis, Glycyrrhiza inflata and Glycyrrhiza glabra, comprising an upstream primer and a downstream primer; characterized in that: The nucleotide sequence of the upstream primer is: 5'-TCCCGCCATCA ACTTACCTA-3', and the nucleotide sequence of the downstream primer is: 5'-GAAATGCAGGACCAAAAGG A-3'.

2. Use of the primer as claimed in claim 1 for identifying Glycyrrhiza uralensis, Glycyrrhiza inflata and Glycyrrhiza glabra.

3. The use according to claim 2, characterized in that The application comprises: using the primers described in claim 1 as amplification primers and the genomic DNA of the sample to be detected as an amplification template, performing PCR amplification to obtain PCR products, and identifying the sample to be detected according to the length of the PCR product band.

4. The use according to claim 3, characterized in that If the PCR product includes a specific amplification band with a length of 450bp, it indicates that the sample to be tested is Glycyrrhiza uralensis; if the PCR product includes a specific amplification band with a length of 795bp, it indicates that the sample to be tested is Glycyrrhiza inflata; if the PCR product includes a specific amplification band with a length of 475bp, it indicates that the sample to be tested is Glycyrrhiza glabra.

Citation Information

Patent Citations

  • SSR molecular marker primer for detecting glycyrrhiza plants

    CN105063041A

  • Rapid molecular identification method for glycyrrhiza uralensis, glycyrrhiza glabra, glycyrrhiza inflate and hybrid variety thereof

    CN105543373A

  • Primer pair for identification or auxiliary identification of licorice root and application thereof

    CN109735644A

  • Method for identifying or assisting in identifying liquorice

    CN109750093A

  • SSR molecular marker primer for identifying different producing areas of radix glycyrrhizae, method and application

    CN112143827A