Preparation method of edible flower phenol amide compound and application of edible flower phenol amide compound in prevention and treatment of non-alcoholic fatty liver disease

By extracting and purifying TCS from edible flowers and using NADES solvent and acid extraction purification methods, the problem of limited therapeutic effect of non-alcoholic fatty liver disease was solved, and the protection and health improvement of liver cells were achieved, which is in line with the development trend of natural medicine.

CN120694979APending Publication Date: 2025-09-26JIANGNAN UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510928199.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-07
Publication Date
2025-09-26

AI Technical Summary

Technical Problem

In the existing technology, the treatment drugs for non-alcoholic fatty liver disease have side effects or limited effects, and the bioactive substances in edible flowers are not fully utilized, which limits their application in functional foods and medicines.

Method used

The phenolic amide compound tricoumaryl spermidine (TCS) was extracted from edible flowers using natural deep eutectic solvent (NADES). A combination of acid extraction and NADES solvent was used to improve extraction efficiency and purity. TCS was used to activate SIRT1 protein to improve liver cell health.

Benefits of technology

TCS can effectively inhibit lipid accumulation in hepatocytes, improve oxidative stress and inflammation, reduce the expression of cell aging markers, activate SIRT1 protein, and provide protection against non-alcoholic fatty liver disease. It is natural in origin, has low side effects, and is suitable for long-term use.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120694979A_ABST
    Figure CN120694979A_ABST
Patent Text Reader

Abstract

The invention discloses a preparation method of an edible flower phenol amide compound and application of the edible flower phenol amide compound in prevention and treatment of non-alcoholic fatty liver disease, and particularly relates to the field of development of new application of food raw materials. The edible flower phenol amide compound N1, N5, N10-coumaroyl spermidine (TCS) can be green extracted by using a natural deep-eutectic solvent (NADES), and can inhibit free fatty acid-induced liver cell lipid accumulation and improve fatty acid-caused liver cell fatty degeneration; oxidative stress and inflammation induced by free fatty acid are inhibited, and expression of senescence-related markers is inhibited, so that development of NAFLD is effectively inhibited.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of development of new uses of food raw materials, and in particular to a preparation method of an edible phenolic amide compound and application thereof in preventing and treating non-alcoholic fatty liver disease. Background Art

[0002] Edible flowers are flowers that can be safely eaten after proper processing and have a wide range of applications in the food industry and culinary fields. Rich in nutrients and bioactive compounds, such as flavonoids, phenolic acids, pentacyclic triterpenes, and steroids, edible flowers have been reported to exhibit a variety of pharmacological effects, including antioxidant, anti-inflammatory, antibacterial, and anti-tumor properties. Consequently, the consumption of edible flowers has increased annually. By incorporating edible flowers into various functional foods (such as baked goods, dairy products, and beverages), cosmetics, health supplements, and pharmaceuticals, they can be developed. Despite the rich bioactive compounds found in edible flowers, current identification and extraction technologies for these compounds remain incomplete. Many bioactive compounds in edible flowers have yet to be systematically identified, and their functions remain underdeveloped, severely limiting their application in functional foods and pharmaceuticals. More effective exploration of bioactive compounds in edible flowers and research into their health benefits are crucial for achieving targeted nutrition and disease prevention and treatment using edible flowers.

[0003] Phenolamides, also known as hydroxycinnamic acid amides or phenylamides, are formed from phenolic acids (such as coumaric acid and ferulic acid) and polyamines (such as spermidine and spermine). They exist and play a variety of roles in plants. Phenolamides are widely present in plants and are concentrated in metabolically active parts of plants, such as seeds, fruits, and flowers. These parts are typically the primary synthesis and storage sites for plant secondary metabolites (such as phenolic compounds). The distribution, type, and chemical structure of phenolamides may vary among different plants. For example, oat seeds (particularly the bran) are the primary source of oat phenolamides (such as p-coumaryl-5-hydroxyanthranilic acid, feruloyl-5-hydroxyanthranilic acid, and caffeoyl-5-hydroxyanthranilic acid). Hemp seeds contain cannabinoid phenolamides, such as N-trans-caffeoyltyramide. Pepper fruits contain capsaicinoid phenolamides, such as capsaicin and dihydrocapsaicin. Various cinnamamides (such as N-trans-feruloyltyramide) are found in wolfberry fruits. Our previous research also identified a coumaroylspermidine (TCS; CAS No. 364368-18-3) from rose flowers, a coumaramide, and found it to have a significant protective effect against alcohol-induced hepatocyte apoptosis. However, the protective effect of TCS against non-alcoholic fatty liver disease (NAFLD) has not yet been reported.

[0004] Modern people's high-fat, high-sugar diets, sedentary lifestyles, and chronic sleep deprivation are highly susceptible to NAFLD, contributing to its increasing prevalence worldwide. From 2005 to 2019, the burden of NAFLD-related liver complications in my country increased significantly, suggesting that NAFLD has become a serious public health issue. Currently, the main medications used to treat NAFLD include insulin sensitizers (such as metformin and thiazolidinediones), antioxidants (such as vitamin E), lipid-lowering drugs (such as statins and fibrates), GLP-1 receptor agonists (such as liraglutide and semaglutide), and FXR agonists (such as obeticholic acid). However, all of these drugs have side effects or limited effectiveness. Take vitamin E and obeticholic acid as examples. Vitamin E can reduce liver inflammation and fibrosis and is particularly suitable for non-diabetic patients with NAFLD, but long-term use requires caution regarding cardiovascular risks. Obeticholic acid can improve liver inflammation and fibrosis, but may cause itching and dyslipidemia. Summary of the Invention

[0005] The present invention provides the use of an edible phenolic amide compound in preparing a medicament for preventing and treating non-alcoholic fatty liver disease.

[0006] In one embodiment of the present invention, the edible phenolic amide compound is TCS.

[0007] In one embodiment of the present invention, the edible flowers are subjected to TCS extraction using natural deep eutectic solvents (NADES).

[0008] In one embodiment of the present invention, the edible flowers are one or more of lotus, rose, safflower, peanut flower, cherry blossom, orange blossom, and dandelion flower.

[0009] In one embodiment of the present invention, the method for extracting TCS from edible flowers using NADES specifically comprises the following steps:

[0010] (1) Acid extraction and purification of edible flowers: The dried edible flowers were broken into powder, and then a dilute hydrochloric acid solution with a pH value of 1.5 to 2.0 was added at a solid-liquid ratio of 1:5 to 20 g / mL. After mixing and shaking, an ice-water bath (0 to 4°C) was used for ultrasonication for 20 to 60 minutes. After ultrasonication, the supernatant was collected by centrifugation. A dilute hydrochloric acid solution with a pH value of 1.5 to 2.0 was added to the filter residue at a solid-liquid ratio of 1:5 to 20 g / mL. The filter residue was ultrasonically extracted for 20 to 60 minutes in an ice-water bath. This process was repeated several times. Finally, the filter residue obtained by centrifugation was washed to neutrality and freeze-dried to powder.

[0011] (2) Preparation of NADES: Hydrogen bond acceptor (HBA) and hydrogen bond donor (HBD) were mixed in a molar ratio of 1:1-3, 10-30% deionized water was added based on the total mass of the final NADES system, and ultrasonication was performed at 60-100°C until a transparent, homogeneous and stable liquid was formed;

[0012] (3) Extraction of tricoumaryl spermidine from edible flowers using NADES solvent: Take the edible flowers that have been freeze-dried after acid extraction, add NADES at a solid-liquid ratio of 1:10-30, g / mL, extract, mix and shake, and ultrasonicate for 20-60 minutes; centrifuge and filter to obtain a crude extract of tricoumaryl spermidine.

[0013] In one embodiment of the present invention, in step (2), the HBA comprises one of choline chloride and betaine.

[0014] In one embodiment of the present invention, in step (2), the HBD comprises one of fructose, glucose, sucrose, urea, glycerol, ethylene glycol, proline, lactic acid, citric acid, and malic acid.

[0015] In one embodiment of the present invention, in step (2), the HBA is betaine.

[0016] In one embodiment of the present invention, in step (2), the HBD is lactic acid.

[0017] Beneficial effects of the present invention:

[0018] (1) Edible flowers including lotus, rose, safflower, peanut flower, cherry blossom, orange blossom, and dandelion flower contain TCS compounds. Among them, lotus, rose, and safflower have higher TCS content, exceeding 1000 mg TCS / kg dried flower.

[0019] (2) The present invention uses NADES green solvent to extract TCS from edible flowers. Compared with the system using choline chloride as the HBA, the system using betaine as the HBA can extract more TCS; among them, the betaine-lactic acid system extracts the highest TCS content. The present invention uses NADES green solvent to extract TCS, which is greener and more environmentally friendly, and can achieve the same effect as ethanol in extracting TCS.

[0020] (3) The TCS prepared by the present invention inhibits the accumulation of hepatocyte lipids induced by free fatty acids (FFA) and improves fatty degeneration of hepatocytes caused by fatty acids; TCS can inhibit oxidative stress and inflammation induced by free fatty acids and inhibit the expression of aging-related markers.

[0021] (4) NAFLD patients often show decreased SIRT1 expression or activity, especially in models induced by obesity and high-fat diet. Decreased SIRT1 activity is closely related to liver fat accumulation and increased inflammation. TCS and the background compound spermidine (Spermidine, SPD) can activate NAD-dependent deacetylase sirtuin-1 (NAD-dependent deacetylase sirtuin-1, SIRT1), and SPD can exert health benefits by acting on SIRT1. Using AutoDock4 software, molecular docking of coumaroylspermidine compounds (Coumaroylspermidine) with different substitution sites and numbers of p-coumaric acid (p-CA) was performed to simulate and screen out compounds with high affinity for SIRT1 protein. The compounds used included p-CA and SPD as controls, as well as three mono-substituted compounds (Mono-coumaroylspermidine, MCS), three di-substituted compounds (Di-coumaroylspermidine, DCS) and tri-substituted TCS. The results of SIRT1 targeted molecular docking screening showed that as the number of p-CA substitutions increased, its binding free energy with SIRT1 protein decreased and the inhibition constant decreased, that is, the interaction between the two was enhanced, indicating that TCS had the most significant effect, exceeding SPD.

[0022] (5) TCS is derived from dietary plants, which is in line with the development trend of natural medicine and may be more easily accepted by patients. As an edible compound, TCS may have low toxic side effects and is suitable for long-term use. TCS may effectively inhibit the progression of NAFLD through multiple mechanisms (such as antioxidant, anti-inflammatory, and regulation of lipid accumulation). Therefore, TCS may effectively improve the health status of NAFLD patients and enhance their quality of life. By preventing NAFLD from progressing to severe liver disease, TCS may reduce the social medical burden. Therefore, the research and development and application of TCS may promote the development of the natural medicine and health industry and create employment opportunities. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The TCS content in different edible flowers in Example 1;

[0024] Figure 2 To determine the concentration of TCS in rose flowers using NADES extraction;

[0025] Figure 3Characterization diagrams of TCS (AC) and standard TCS (DF) after further purification in Example 2; A is the ultraviolet absorption liquid chromatogram of purified TCS at 293 nm, and Figures B and C are respectively the extracted ion chromatograms of a specific m / z at a retention time of 31.3 min; D is the ultraviolet absorption liquid chromatogram of standard TCS at 293 nm, and Figures E and F are respectively the extracted ion chromatograms of a specific m / z at a retention time of 31.2 min;

[0026] Figure 4 TCS treatment improves fatty acid-induced hepatic steatosis;

[0027] Figure 5 TCS improves fatty acid-induced oxidative stress damage;

[0028] Figure 6 Improve fatty acid-induced inflammation in TCS;

[0029] Figure 7 Effects of TCS on fatty acid-induced cell senescence. DETAILED DESCRIPTION

[0030] Sources of reagents used in the present invention:

[0031] Sources of NADES and HPLC reagents: Choline chloride, betaine, fructose, glucose, sucrose, urea, glycerol, ethylene glycol, proline, citric acid, and malic acid were purchased from Aladdin; lactic acid was purchased from Macklin; HPLC grade acetonitrile (Sigma-Aldrich)

[0032] Cells and reagents were obtained from: HepG2 cells (ATCC, HB-8065), sodium oleate (Sigma, O7501), sodium palmitate (Sigma, P9767), defatted bovine serum albumin (BSA; Sigma, B2064), and 4% paraformaldehyde fixative (Biyuntian, P0099).

[0033] Method and steps for determining TCS content in different edible flowers:

[0034] The extracts described in the examples were diluted 10-fold with methanol, filtered through a 0.22 μM filter, and analyzed using a high-performance liquid chromatograph (HPLC). Chromatographic conditions: HPLC analysis was performed on a Waters Arc™ HPLC chromatograph (Waters, Milford, MA) equipped with a Waters 2998 PAD detector (Waters, Milford, MA). The chromatographic column was a Waters XBridge C18 (4.6 mm × 250 mm, 5 μm). The mobile phase consisted of 0.1% acetic acid solution and acetonitrile. The gradient elution rate was 15% to 85%, the elution time was 45 min, the flow rate was 1.0 mL / min, the detection wavelength was 293.1 nm, and the column temperature was 25°C.

[0035] LC-MS method: LC-MS analysis was performed on a SHIMADZU LC-2050C 3D single quadrupole liquid chromatography-mass spectrometer (SHIMADZU, Kyoto, Japan). The chromatographic column was Waters C18 (4.6 mm × 150 mm, 3.5 μm), column temperature 35°C. The mobile phase was 0.1% formic acid solution and acetonitrile. The gradient elution rate was 15% to 85%, the elution time was 45 min, and the flow rate was 0.5 mL / min. In addition, the ESI-MS operating conditions were set as follows: ionization mode, positive (ESI+) and negative (ESI-); desolvation temperature, 450°C; capillary voltage, 3 kV; nebulizer gas flow rate, 2 L / min. The full MS scan range was 100–1000 m / z. The extracted ion chromatogram (XIC) and product ion spectrum of the specific m / z were recorded.

[0036] HPLC Methods: Preparative HPLC analyses were performed on a Shimadzu HPLC system controller CBM-20A (Shimadzu, Suzhou, China), equipped with a Shimadzu HPLC solution transfer unit LC-20AT (Shimadzu, Suzhou, China), a Shimadzu HPLC UV-visible detector SPD-20A (Shimadzu, Suzhou, China), and a Shimadzu FRC-10A fraction collector (Shimadzu, Kyoto, Japan). The chromatographic column was a Shimadzu Shim-pack GIST C18 (20 mm × 250 mm, 5 μm). The mobile phase consisted of aqueous solution and methanol. The gradient elution rate was 5% to 95% with an elution time of 20 min at a flow rate of 10 mL / min. The detection wavelength was 293 nm, and the column temperature was 25°C.

[0037] Example 1

[0038] TCS extraction of edible flowers by ethanol:

[0039] The edible flowers (lotus, rose, safflower, peanut flower, cherry, orange flower, dandelion flower) were ground into powder, 10g was taken and added to 100mL 95% ethanol, ultrasonic extraction was performed for 30min, the filtrate was retained after filtration, and 100mL 95% ethanol was added to the residue. The above extraction operation was repeated 3 times. The 3 filtrates were combined, vacuum evaporated using a rotary evaporator at 40°C, and then redissolved with 10mL methanol. The obtained extract was stored at -20°C until use. The content of TCS in edible flowers is as follows: Figure 1 As shown in the figure, the TCS content in lotus, rose and safflower is relatively high, all exceeding 1000 mg TCS / kg dried flower.

[0040] Example 2

[0041] A method for extracting and purifying rose TCS using NADES green solvent comprises the following steps:

[0042] (1) Acid extraction and purification of roses: The dried roses were broken into powder, and then a dilute hydrochloric acid solution with a pH value of 1.8 was added at a solid-liquid ratio of 1:10. After mixing and oscillating, the mixture was ultrasonicated in an ice-water bath for 30 minutes. After ultrasonication, the supernatant was collected by centrifugation. A dilute hydrochloric acid solution with a pH value of 1.8 was added to the residue at a solid-liquid ratio of 1:10, and ultrasonic extraction was performed in an ice-water bath. This process was repeated three times. Finally, the residue obtained by centrifugation was repeatedly rinsed with deionized water until neutral, and the residue was freeze-dried to powder and stored at low temperature until use.

[0043] (2) Preparation and screening of NADES solvents: HBA (betaine) and HBD (lactic acid) were mixed in a molar ratio of 1:2, and 20% deionized water was added based on the total mass of the final NADES system. The mixture was ultrasonicated at 80°C until a transparent, uniform, and stable liquid was formed. If no solid was precipitated when the mixture was allowed to stand at room temperature, the preparation was successful.

[0044] (3) Extraction of tricoumaryl spermidine from rose seeds using NADES solvent: Acid-extracted, freeze-dried rose flowers were extracted with NADES at a solid-to-liquid ratio of 1:20. After mixing and oscillation, the mixture was sonicated at room temperature for 30 minutes. The crude tricoumaryl spermidine extract was obtained by centrifugation and filtration.

[0045] Example 3

[0046] The preparation method is the same as that of Example 2, with the only difference being that the types of HBA and HBD in step (2) are replaced, as shown in Table 1.

[0047] Table 1 Preparation of TCS with different types of HBA and HBD

[0048]

[0049]

[0050] like Figure 2 As shown, compared with the system using choline chloride as HBA (1-10), the system using betaine as HBA (11-20) can extract more TCS; among them, the TCS content extracted by the betaine-lactic acid system (Example 2) is the highest, and there is no statistical difference with the extraction using 95% EtOH.

[0051] The crude TCS extract prepared in Example 2 was further separated and purified by preparative liquid chromatography to obtain a TCS compound with a purity of 95%; and TCS was characterized by single quadrupole liquid chromatography-mass spectrometry. Figure 3 As shown, the prepared compound (A) exhibited a peak elution time of 31.10 min at 293 nm, consistent with that of the TCS standard (D) used previously. It also exhibited a single major peak, accounting for approximately 95% of the total peak area. The m / z values ​​of the prepared compound in positive and negative ion modes were 584.36 and 582.34, respectively, indicating a molecular weight of 583 g / mol, consistent with that of TCS. This demonstrated the successful preparation of TCS.

[0052] Example 4

[0053] Effects of TCS in preventing and treating nonalcoholic fatty liver disease and anti-aging

[0054] S1. Cell activity assay of TCS in hepatocytes

[0055] HepG2 cells were seeded in 96-well cell culture plates (1×10 4 Cells) were cultured in an incubator overnight to allow them to adhere. After adherence, different concentrations of TCS (0-100 μM) (Example 2) were added. After 24 h or 48 h of intervention, the culture medium was discarded, the cells were washed once with PBS, and the prepared CCK-8 solution (Biyuntian, C0038) was added. The cells were placed in an incubator and incubated for 1 h. The absorbance (OD value) of each well at 450 nm was measured with a microplate reader. The results are shown in Figure 4 A. 25 and 50 μM, which had less effect on cell viability, were selected for subsequent experiments.

[0056] S2. Preparation of free fatty acid stock solution

[0057] 20 mM sodium palmitate and sodium oleate solutions were prepared separately (dissolved in a 75°C water bath) and mixed with equal volumes of 10% defatted BSA solution to obtain 10 mM sodium palmitate-BSA stock solutions and sodium oleate-BSA stock solutions. In addition, a 5% defatted BSA solution was prepared as a solvent control. Each solution was sterilized by filtration through a 0.22 μm membrane and stored in a -20°C refrigerator until use.

[0058] S3. Establishment of hepatocyte steatosis model and TCS pretreatment of cells

[0059] HepG2 cells were pretreated with 25 or 50 μM TCS for 24 hours. Subsequently, the free fatty acid stock solution was added to complete culture medium containing 10% FBS to prepare a high-fat medium with a final free fatty acid concentration of 500 μM (oleic acid:palmitic acid = 2:1). The model group was cultured in high-fat medium for 24 hours. The control group was cultured in complete culture medium containing the same concentration of defatted BSA as the model group for 24 hours (Control). The FFA group differed from the model group in that TCS was not added.

[0060] Protective effects of S4 and TCS on hepatocyte steatosis model

[0061] After S3 treatment, cells or culture medium were collected and the intracellular lipid droplet accumulation, reactive oxygen species (ROS) and malondialdehyde (MDA) content, and related mRNA expression were measured using oil red staining, qPCR, and flow cytometry. The experimental results showed that TCS (25 and 50 μM) pretreatment can significantly inhibit the lipid droplet accumulation of adipocytes ( Figure 4 B~C); inhibiting the production of ROS and MDA induced by fatty acids, indicating that TCS has a good antioxidant effect ( Figure 5 ); inhibited fatty acid-induced tumor necrosis factor-α (TNFα) and interleukin-1β (IL-1β), indicating that TCS has a good anti-inflammatory effect ( Figure 6 ); inhibit fatty acid-induced expression of multiple tumor suppressor genes 2A (Cyclin dependent kinaseinhibitor 2A, CDKN2A or p16), multiple tumor suppressor genes 1A (Cyclin dependent kinaseinhibitor 1A, CDKN1A or p21), and tumor suppressor protein p53 (Tumor protein p53, TP53 or p53), indicating that TCS can inhibit cell cycle arrest and senescence ( Figure 7 The above results suggest that TCS may protect against non-alcoholic fatty liver disease by regulating oxidative stress and inflammation, thereby weakening the stress defense response (cell cycle arrest and cell senescence) induced by fatty acids.

[0062] The corresponding methods of oil red staining, ROS detection, MDA detection, and PCR experiments are as follows:

[0063] Oil red staining: HepG2 cells were seeded in 24-well cell culture plates (5×10 4 The cells were cultured in an incubator overnight to adhere to the wall. After the corresponding intervention, the culture medium was discarded and the cells were homogenized. Subsequently, a lipid peroxidation MDA detection kit (Biyuntian) was used to measure the MDA content of the cells in each treatment group. MDA levels were measured by thiobarbituric acid (TBA) colorimetry. In addition, the BCA protein concentration assay kit (Biyuntian) was used to quantify the protein concentration of each group for standardization of MDA levels.

[0064] ROS detection: DCFH-DA probe was used to detect cellular ROS levels. After entering the cell, DCFH-DA can be hydrolyzed by esterase to DCFH, which cannot pass through the cell membrane. ROS can oxidize non-fluorescent DCFH to fluorescent DCF, and the fluorescence intensity reflects the cellular ROS level. HepG2 cells were seeded in 6-well cell culture plates (3×10 cells per well). 5 Cells were collected from each group using trypsin and washed once with PBS. DCFH-DA working solution (diluted to 20 μM in serum-free DMEM) was added and incubated in a dark incubator at 37°C for 30 minutes. The dye was removed by centrifugation and the cells were resuspended in PBS. Fluorescence intensity was measured using flow cytometry, and the relative levels of ROS in each group were calculated.

[0065] MDA assay: HepG2 cells were seeded in 6-well cell culture plates (3 × 10 5 Cells were collected and incubated overnight to allow attachment. After intervention, cells were homogenized, and the MDA content of each cell group was determined using a lipid peroxidation MDA detection kit (Beyotime). MDA levels were assessed using a thiobarbituric acid (TBA) colorimetric assay. Furthermore, protein concentrations in each group were quantified using a BCA protein concentration assay kit (Beyotime) for normalization of MDA levels.

[0066] PCR experiment: HepG2 cells were seeded in 6-well cell culture plates (3×10 5Cells were cultured and placed in an incubator overnight to allow them to adhere. After the corresponding intervention, total cellular RNA was extracted using an RNA extraction kit (Novizen, RC112-01) according to the instructions, and the concentration and purity of the extracted total RNA were determined. Reverse transcription was then performed using a reverse transcription kit (Takara, RR037A), with a reaction system of 20 μL (5×Buffer 4 μL, PrimeScript RT Enzyme Mix I 1 μL, Oligo dT Primer 1 μL, Random 6mers 1 μL, Total RNA 1 μg, RNase Free dH2O). The reversed cDNA was stored in a -20°C refrigerator for later use. Premix Ex Taq TM II (Takara, RR820A) for real-time fluorescence PCR detection. The reaction system consisted of 10 μL of TB green, 0.8 μL of upstream and downstream primers, 2 μL of cDNA, and 20 μL of RNase-free dH2O. β-actin was used as an internal reference. -ΔΔT Method: Calculate the relative expression of the target gene. The primer sequences used are shown in the table below:

[0067] Table 2 Primer sequences

[0068] target gene Upstream primer (5' to 3') Downstream primer (5' to 3') TNFα CCTCTCTCTAATCAGCCCTCTG GAGGACCTGGGAGTAGATGAG IL-1β TTCGACACATGGGATAACGAGG TTTTTGCTGTGAGTCCCGGAG CDKN2A GACCTGGCTGAGGAGCTG GCATGGTTACTGCCTCTGGT CDKN1A GACCATGTGGACCTGTCACT CGGCGTTTGGAGTGGTAGA TP53 CAGCTTTGAGGTGCGTGTTT GTGGTTTCTTCTTTGGCTGGG β-actin CTTCGCGGGCGACGAT CCACATAGGAATCCTTCTGACC

[0069] Example 5

[0070] SIRT1 molecular simulation method:

[0071] Based on the crystal structure of SIRT1 protein (PDB ID: 5BTR), molecular docking was performed using AutoDock4 software with various coumaroyl spermidine monomers as ligands. A grid box was set to cover the active pocket (center coordinates: x = -20.691, y = 58.935, z = 7.224; grid point number: 127041; grid point interval: ), and after 50 molecular docking simulations, coumaroyl spermidine with high affinity to SIRT1 protein was screened out.

[0072] Table 3 SIRT1 molecular docking screening

[0073]

[0074] As shown in Table 3, the results of the SIRT1-targeted molecular docking screening show that as the number of substitutions increases, the binding free energy and inhibition constant decrease with SIRT1, indicating that the interaction between the two is enhanced. This indicates that TCS has the most significant effect, exceeding SPD.

[0075] The embodiments provided above are not intended to limit the scope of the present invention, nor are the steps described to limit their execution order. Any obvious improvements to the present invention made by those skilled in the art in combination with existing common knowledge shall fall within the scope of protection defined by the claims of the present invention.

Claims

1. Use of an edible phenolic amide compound in the preparation of a drug for preventing and treating non-alcoholic fatty liver disease, wherein the edible phenolic amide compound is N1, N5, N10-tri-p-coumaryl spermidine.

2. The use according to claim 1, characterized in that The edible flowers are one or more of the following: water lily, rose, safflower, peanut flower, cherry blossom, orange blossom and dandelion flower.

3. The use according to claim 1, characterized in that N1,N5,N10-tri-p-coumaroylspermidine was extracted from edible flowers using natural deep eutectic solvents.

4. The use according to claim 1, characterized in that The method for extracting N1, N5, N10-tri-p-coumaryl spermidine from edible flowers using a natural deep eutectic solvent comprises the following steps: (1) Acid extraction and purification of edible flowers: The dried edible flowers are broken into powder, and then diluted hydrochloric acid with a pH value of 1.5 to 2.0 is added at a solid-liquid ratio of 1:5 to 20, g / mL, mixed and shaken, and ultrasonicated at 0 to 4°C for 20 to 60 minutes. After ultrasonication, the supernatant is collected by centrifugation, and diluted hydrochloric acid with a pH value of 1.5 to 2.0 is added to the filter residue at a solid-liquid ratio of 1:5 to 20, and ultrasonicated at 0 to 4°C for 20 to 60 minutes. This process is repeated multiple times. Finally, the filter residue obtained by centrifugation is washed to neutrality, and the filter residue is freeze-dried to powder to obtain edible flower powder purified by acid extraction; (2) Preparation of natural deep eutectic solvent: mixing hydrogen bond acceptors and hydrogen bond donors, adding deionized water, and ultrasonicating at 60-100°C to obtain a natural deep eutectic solvent; (3) Extracting N1, N5, N10-tri-p-coumaryl spermidine from edible flowers using a natural low eutectic solvent: taking the edible flower powder purified by acid extraction in step (1) and the natural low eutectic solvent in step (2), mixing and shaking, and then ultrasonicating for 20 to 60 minutes; centrifuging and filtering to obtain a crude extract of N1, N5, N10-tri-p-coumaryl spermidine.

5. The use according to claim 4, characterized in that In step (2), the hydrogen bond acceptor includes one of choline chloride and betaine.

6. The use according to claim 4, characterized in that In step (2), the hydrogen bond acceptor is betaine.

7. The use according to claim 4, characterized in that In step (2), the hydrogen bond donor includes one of fructose, glucose, sucrose, urea, glycerol, ethylene glycol, proline, lactic acid, citric acid, and malic acid.

8. The use according to claim 4, characterized in that In step (2), the hydrogen bond donor is lactic acid.

9. The use according to claim 4, characterized in that In step (2), the hydrogen bond acceptor and the hydrogen bond donor are mixed in a molar ratio of 1:1 to 3; and the amount of deionized water added is 10 to 30% of the mass of the natural deep eutectic solvent.

10. The use according to claim 4, characterized in that In step (3), the mass volume ratio of the edible flower powder purified by acid extraction to the natural deep eutectic solvent is 1:10-30, g / mL.