Application of NAT10 gene in preparation of medicine for inhibiting proliferation and metastasis of lung adenocarcinoma

Abstract

The invention provides application of an NAT10 gene in preparation of drugs for inhibiting proliferation and metastasis of lung adenocarcinoma, and belongs to the technical field of biological medicines. The problems of how to improve the diversification of lung adenocarcinoma treatment and how to reduce some adverse reactions are solved. The application comprises application of the NAT10 gene in preparation of drugs for inhibiting proliferation and metastasis of lung adenocarcinoma, and the Gene ID of the NAT10 gene is 55226. A solid theoretical foundation is laid mainly for developing drugs and therapies for inhibiting lung adenocarcinoma metastasis by targeting NAT10.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and particularly relates to the application of NAT10 gene in preparing drugs for inhibiting the proliferation and metastasis of lung adenocarcinoma. Background Art

[0002] Lung adenocarcinoma is the leading cancer worldwide, accounting for 18% of new cancer deaths and 11.4% of new cancer diagnoses. Current treatment options for lung adenocarcinoma are as follows: 1. Surgery carries certain risks, requiring assessment of the patient's cardiopulmonary function and other physical conditions. Furthermore, some patients may experience reduced quality of life due to surgical damage, and postoperative complications such as lung infection, respiratory problems, pleural effusion, chronic pain, and decreased respiratory function may occur. 2. Radiation therapy can cause side effects such as radiation pneumonitis, esophagitis, radiation dermatitis, bone marrow suppression, and systemic reactions (such as fatigue, weakness, and loss of appetite), requiring careful precautions. 3. Chemotherapy: During treatment, physicians will closely monitor the patient's physical response and address potential adverse reactions, including gastrointestinal reactions such as nausea, vomiting, diarrhea, constipation, and loss of appetite; hematologic toxicities such as leukopenia, anemia, and thrombocytopenia; hair loss; and effects on liver and kidney function. 4. Targeted therapies may develop drug resistance, requiring subsequent adjustments to the treatment plan. Different targeted drugs have varying side effects, such as rash, diarrhea, and liver damage. 5. Immunotherapy may cause immune-related adverse reactions, such as rash, diarrhea, hepatitis, and endocrine disruption. Severe immune-related adverse reactions can be life-threatening and require close monitoring and timely treatment. Given the diversity of existing treatments, which come with their own drawbacks, there is an urgent need to find a technology that is both effective and reduces these drawbacks. Summary of the Invention

[0003] In view of this, the present invention aims to propose the use of NAT10 gene in the preparation of drugs for inhibiting the proliferation and metastasis of lung adenocarcinoma, so as to solve the problem of how to improve the diversification of lung adenocarcinoma treatment and reduce some adverse reactions.

[0004] To achieve the above objectives, the present invention adopts the following technical solution: The present invention provides a use of a NAT10 gene in preparing a drug for inhibiting the proliferation and metastasis of lung adenocarcinoma, wherein the NAT10 gene has NCBI Gene ID: 55226.

[0005] The present invention provides a recombinant vector combination. The recombinant vector uses the px458 vector as a starting vector and is connected to the gene shown in SEQ ID NO.1 and / or SEQ ID NO.2.

[0006] The present invention provides a recombinant biological system, wherein the biological cell system contains the above-mentioned recombinant vector or the gene shown in SEQ ID NO.1 and / or SEQ ID NO.2.

[0007] It is further defined that the biological cell line is a microbial cell line or an animal cell line.

[0008] The present invention provides an application of the above-mentioned recombinant vector or the above-mentioned biological cell line in preparing a drug for inhibiting the proliferation and metastasis of lung adenocarcinoma.

[0009] The present invention provides an siRNA, wherein the sense strand of the siRNA is shown as SEQ ID NO.11, and the antisense strand of the siRNA is shown as SEQ ID NO.12.

[0010] The present invention provides an application of the above-mentioned siRNA in preparing a medicine for inhibiting the proliferation and metastasis of lung adenocarcinoma.

[0011] The present invention provides a recombinant biological cell line containing the above-mentioned siRNA.

[0012] It is further defined that the biological cell line is a microbial cell line or an animal cell line.

[0013] The present invention provides an application of the above-mentioned recombinant biological cell line in preparing a drug for inhibiting the proliferation and metastasis of lung adenocarcinoma.

[0014] Compared with the existing technology, the beneficial effect of the present invention is that NAT10 silencing can reduce the metastasis and proliferation ability of lung adenocarcinoma cells, laying a solid theoretical foundation for the development of drugs and therapies targeting NAT10 to inhibit lung adenocarcinoma metastasis. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] The accompanying drawings, which constitute part of the present invention, are provided to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are provided to explain the present invention and do not constitute an undue limitation of the present invention. In the accompanying drawings: Figure 1 Schematic diagram of NAT10 knockout; Figure 2 The results of A549 cells 48 hours after knockout vector transfection; a is the cells under bright field; b is the cells under fluorescence microscope; Figure 3 Figure 1 is the result of NAT10 knockout detection; a is the result of outer primer identification; b is the result of inner primer identification; Figure 4 The top two off-target predicted sites and detection results for sgRNA1; Figure 5The top two off-target predicted sites and detection results for sgRNA2; Figure 6 The figure shows the detection results of NAT10 knockout efficiency; a is the RNA level detection; b is the protein level detection; c is the RNA ac4C level detection; Figure 7 This is the result of screening the downstream target genes of NAT10; Figure 8 Figure 1 is the result of identifying the CXCL5 ac4C modification site; Figure 9 This is the result of identification of DEK ac4C modification sites; Figure 10 The negative control verifies the credibility of the experimental system and the results of ac4C modification changes at four sites of CXCL5 mRNA; among them, a is the acRIP negative control; b is CXCL5 site1-3; c is CXCL5 site4; Figure 11 The results of DEK ac4C modification site identification are shown in Figure 1. Among them, a is the DEK ac4C site; b is the DEK None-ac4C site; Figure 12 The graph shows the changes in CXCL5 and DEK mRNA stability; a is CXCL5 mRNA stability; b is DEK mRNA stability; Figure 13 This is the result of phenotypic changes of NAT10 knockout cell line under microscope; Figure 14 The graph shows the measurement results of relative cell proliferation rate; Figure 15 This figure shows the effect of NAT10 on the invasion and migration of lung adenocarcinoma cells. Figure 16 Figure 1 shows the effect of NAT10 on the adhesion of lung adenocarcinoma cell A549. Figure 17 This figure shows the changes in the cytoskeleton in A549 cells after NAT10 knockout; Figure 18 The results of the effect of NAT10 silencing on the metastasis of lung adenocarcinoma cells are shown in Figure 1, where a is a schematic diagram of tail vein injection; b is the relative growth rate of mouse body weight; c is the number of lung metastases in mice; d is a picture of mouse lung metastases and HE staining and immunohistochemical analysis of mouse lung metastasis sections. DETAILED DESCRIPTION

[0016] The following will be combined with the accompanying drawings in the embodiments of the present invention to clearly and completely explain the technical solutions in the embodiments of the present invention. It should be noted that the embodiments of the present invention and the features therein can be combined with each other in the absence of conflict, and the embodiments described are only part of the embodiments of the present invention, not all of the embodiments.

[0017] Example 1. Construction of a recombinant vector targeting NAT10 1. This embodiment uses two sgRNAs to cut and edit the target DNA. Since the px458 vector used expresses gRNA from the U6 promoter, in order to successfully express the gRNA, the two sgRNAs are selected to be disassembled into the U6 promoter and then inserted into the BbsI and BsaI restriction sites in the vector respectively. Since two sgRNAs are inserted, the two sgRNAs are successively connected to the vector. Taking the connection of one sgRNA to the vector as an example, after the connection is successful, the next sgRNA is also connected. The sgRNA sequences are shown in SEQ ID NO.1 and SEQ ID NO.2. SEQ ID NO.1: CCAGGTATTCGTATATTCGA; SEQ ID NO.2: CCTACGGACCATGAACTCAC. The schematic diagram of CRISPR-Cas9 sgRNA design is shown in FIG. Figure 1 NAT10 Gene ID: 55226, hg38_dna range = chr11: 34095309-34157228.

[0018] 2. Annealing and synthesizing double-stranded DNA: sgRNAs were designed to cover the common exons of different NAT10 gene transcripts, located in exon 5 and the intron between exon 5 and exon 4. The two selected sgRNAs were modified and restriction sites were added to synthesize oligos, which were then converted into double-stranded DNA. The reaction system is shown in Table 1, and the reaction conditions are shown in Table 2.

[0019] Table 1

[0020] Table 2

[0021] 3. Construction of recombinant vector: Using the px458 vector as a template, the vector was linearized by double enzyme digestion. The enzyme digestion system is shown in Table 3 and the enzyme digestion system was placed at 37°C.

[0022] Table 3

[0023] The purified vector and double-stranded DNA were mixed at a ratio of 1:9 and an equal amount of Solution I was added for ligation, transformation, and plating. Single clones were then identified. After successful ligation, the plasmid was sequenced.

[0024] 4. Construction of NAT10 knockout A549 lung adenocarcinoma cell line The recombinant vector obtained in Example 1 was transfected into A549 cells with a density of about 70%-80% using 1.5 μL Lipofectamine 3000 and 1 μL p3000. 24 hours after cell transfection, the cell transfection efficiency was observed using a fluorescence microscope. The results are as follows: Figure 2 shown.

[0025] Subsequently, 1 μg / mL puromycin was added to the culture medium and cultured for 48 hours for drug screening. The cells were then plated in 96-well plates by limiting dilution. Knockout identification primers were designed at both ends of the knockout site, and the surviving clones with only the 367bp knockout band were screened as homozygous clones. The test results are as follows: Figure 3 The detection primers are shown in Table 4.

[0026] Table 4

[0027] 5. Verification of NAT10 knockout efficiency in A549 lung adenocarcinoma cell line Collect the monoclonal cells obtained in step 4 and detect the knockout efficiency of the NAT10 gene using molecular biology methods (such as Western Blot, qPCR, etc.).

[0028] (1) Off-target detection The knockout cell lines were tested for off-target effects. The possible off-target sites of the two sgRNAs were predicted on the Crispor website. The top two off-target sites were selected for testing. The PCR products of the off-target primers were sent to the company for sequencing. The sequencing results were compared with the original sites. The sequencing results were as follows: Figure 4-5 As shown, neither sgRNA produced off-target effects.

[0029] (2) Detection of knockout efficiency at the RNA level RNA was extracted from wild-type and NAT10 knockout cell lines, and cDNA was obtained by reverse transcription and used as a template for real-time fluorescence quantitative PCR. The quantitative data were collected and analyzed. The results were as follows Figure 6 As shown in (a), NAT10 knockout efficiency was significant, and NAT10 expression was significantly downregulated (***P < 0.001). qPCR primers are shown in Table 5, and the reaction system is shown in Table 6.

[0030] Table 5

[0031] Table 6

[0032] Reaction conditions: 95°C for 2 min, 95°C for 10 s, 58°C for 1 min, 40 cycles (3) Protein level detection of knockout efficiency Cell proteins were extracted using RIPA, and the expression of NAT10 protein in A549 wild-type (WT) and NAT10 knockout cell lines was detected by Western Blot. Figure 6 As shown in b, the expression level of NAT10 knockout cell line was significantly decreased compared with the control group.

[0033] (4) Detection of knockout efficiency by RNA ac4C level The RNA collected in step (2) was spotted onto an N+ membrane and cross-linked by UV irradiation. Methylene blue staining was used as a control. The membrane was incubated with ac4C antibody (1:1000 dilution) at 4°C overnight. The next day, peroxidase-conjugated secondary antibody was diluted 1:10000 and incubated at room temperature for 1 hour. The ECL color development kit was used for development on the Mini-REPORT Tetra electrophoresis system. The results are shown in Figure 2. Figure 6 As shown in c, the ac4C level in cells was significantly downregulated after NAT10 knockout.

[0034] 6. Screening of NAT10 downstream target genes RNA-seq and acRIP-seq high-throughput sequencing analysis were used to obtain information on differentially expressed genes and differential ac4C modification sites. Combined with the differential acetylation profiles of ac4C RNA in lung adenocarcinoma and adjacent tissues, a total of 87 genes were screened as important pathogenic genes / therapeutic targets for ac4C-mediated lung adenocarcinoma, such as Figure 7 As shown. At the RNA level, RT-qPCR was used, and at the protein level, Western blot and RIP experiments were used to detect the downstream pathogenic genes / therapeutic targets predicted by acRIP-seq analysis, respectively, to verify the association between the knocked-down genes and the predicted targets. CXCL5 These four sites on mRNA have ac4C modification. Compared with Input, NAT10 After knockout (NAT10-KO), the enrichment of these four fragments decreased to varying degrees, which also indicates that the ac4C modification at these four sites is affected. NAT10 Influence. DEK One of the sites of mRNA has ac4C modification. NAT10After knockout, the enrichment of this fragment decreased to varying degrees, which also indicates that the ac4C modification at this site is affected. NAT10 Impact, such as Figure 8-11 shown.

[0035] Actinomycin D was used to detect the stability of mRNA. At 3 hours and 6 hours after the addition of actinomycin D, the mRNA in wild-type lung adenocarcinoma cells CXCL5 and DEK The degradation rate of mRNA is slower than NAT10 Therefore, it can be concluded that the stability of target gene mRNA is affected by the level of ac4C modification and NAT10 The lack of it reduces the NAT10 Influence of ac4C modification CXCL5 and DEK mRNA stability to regulate its expression. Figure 12 shown.

[0036] 7. Effects of NAT10 protein and its mediated ac4C RNA modification on lung adenocarcinoma cells (1) The wild-type and NAT10 knockout cell lines were compared to detect cell cycle, cell proliferation, invasion and metastasis, and cell apoptosis, respectively, to reveal the effect of RNA modification-related factor NAT10 on the biological behavior of human lung adenocarcinoma cells. NAT10 Phenotypic changes of knockout cell lines. Phenotypic differences of the two cells were observed under a microscope. The wild-type A549 cells were relatively loose, while the knockout group was compact. It is speculated that the wild-type cells have a significantly stronger motility than the knockout group. NAT10 Knockout cell lines. Figure 13 shown.

[0037] (2) Effect of NAT10 knockout on A549 cell proliferation 1×10 3 Cells were plated in 96-well plates at a density of 10 cells / well and cultured for the designated time points (0, 24, 48, and 72 hours). 20 μL of CCK-8 reagent was added to each well and incubated for 4 hours. Absorbance at 450 nm was measured using a microplate reader. The first day's measurement was used as the 0-hour data. Cell proliferation was measured over four consecutive days, with a 72-hour follow-up period.

[0038] Through MTT experiment, it was found that NAT10 Overexpression in lung adenocarcinoma cells CXCL5 and DEK Saved by NAT10 The slower proliferation rate caused by the deletion elucidates the NAT10 Able to regulate CXCL5 and DEKThe expression of α affects the proliferation of A549 cells. Figure 14 shown.

[0039] Gene ID of CXCL5: 6374, Gene ID of DEK: 7913; CXCL5-F: AGTGGTAGCCTCCCTGAAGAAC (SEQ ID NO.7); CXCL5-R: CTTCTCTGCTGAAGACTGGGAA (SEQ ID NO.8); DEK-F: GTCCGAGAAAGAACCCGAA (SEQ ID NO.9); DEK-R :TTTCCCTCTTGCCTTCCAC (SEQ ID NO. 10).

[0040] (3) Effects of NAT10 knockout on A549 cell invasion and migration assays Cell invasion and migration experiments were performed in 24-well plates. Matrigel was added to the upper chamber of the Transwell in the invasion experiment, but no Matrigel was added in the migration experiment. 1×10 5 Cells were added to the upper chamber, and 15% FBS culture medium was added to the lower chamber. After 48 hours of culture, the cells were fixed in 4% paraformaldehyde for 30 minutes, stained with 0.1% crystal violet for 5 minutes, rinsed, and photographed and counted.

[0041] The results of the Transwell experiment showed that NAT10 , CXCL5 and DEK Both can promote the invasion and migration of A549 cells. NAT10 The loss of β-actin leads to decreased invasion and migration abilities of A549 cells. CXCL5 and DEK Recovery can save NAT10 The results of the experiment are as follows: Figure 15 As shown. WT: A549 cells, NAT10-KO+Vector: NAT10 deficiency + overexpression of empty vector; NAT10+CXCL5: NAT10 deficiency + overexpression of CXCL5; NAT10+ DEK : NAT10 deletion + overexpression DEK ; NAT10 deficiency + overexpression of CX / DEK: NAT10 deficiency + overexpression of DEK and CXCL5.

[0042] (4) Effect of NAT10 knockout on A549 cell adhesion assay Collagen I, fibronectin, laminin, and poly-lysine were added to DMEM and cultured at 37°C for 1 hour. After blocking with 0.5% BSA, 2×104 Cells were cultured in DMEM containing 10% FBS for 30 minutes. Colonies were fixed and stained with 0.1% crystal violet for 10 minutes before imaging and counting for statistical analysis.

[0043] The experimental results show that NAT10 , CXCL5 and DEK Both can promote the adhesion of A549 cells to the extracellular matrix. NAT10 The absence of β-actin leads to decreased adhesion of A549 cells to the extracellular matrix. CXCL5 and DEK Recovery can save NAT10 The results of the experiment are as follows: Figure 16 shown.

[0044] (5) Effects of NAT10 knockout on the cytoskeleton in A549 cells As described in Examples 5.3 and 5.4, NAT10 The absence of α-terminal phosphodiesterase can affect cell migration and invasion, so immunofluorescence technology was used to further detect whether it has an effect on the cytoskeleton. Figure 17 As shown, when NAT10 After the loss of F-actin, the position of the cytoskeleton protein marked by F-actin changed, and a large amount of protein retracted to the vicinity of the cell nucleus, from which it can be inferred that NAT10 It affects the cytoskeleton and directly regulates the cell's motility.

[0045] Example 2. Application of NAT10 in the preparation of drugs for inhibiting lung adenocarcinoma cell metastasis 1. Construction of si-NAT10: siRNA was designed using the siDESIGN Center ( https: / / horizondiscovery.com / en / ordering-and-calculation-tools / sidesign-center ) and synthesized by Jima Gene (Suzhou, China).

[0046] 2. Place 2×10 6 A549 wild-type cells were injected into the tail vein of nude mice. Every three days, each group was injected with 500 μg of siRNA / kg (mouse body weight). The experimental group was injected with si-NAT10, while the control group was injected with si-NC to evaluate their therapeutic potential. Body weight gain of the mice was monitored every three days. After 7 weeks, the mice were euthanized. Lungs were then excised and fixed for immunohistochemical analysis. The number of lung metastases was counted.

[0047] Immunohistochemical analysis procedures: Paraffin-embedded tissue sections were deparaffinized with xylene, hydrated with graded ethanol, and then microwaved in sodium citrate buffer for antigen retrieval. After blocking in 30% H₂O₂, sections were incubated with anti-NAT10 antibodies (1:500) and anti-Ki67 antibodies (1:500) overnight at 4°C. HRP-conjugated rabbit secondary antibodies were then added to the sections and incubated at room temperature for 30 minutes. Finally, diaminobenzidine was used as the chromogen, and hematoxylin was used as the nuclear counterstain. Images were acquired using a digital slide scanning and application system (Easyscan 6, MOTIC) and processed using MOTIC's professional software and network system.

[0048] si-NAT10-sense: AGUGGAAGGUGGUGGGCUAUU (SEQ ID NO.11); si-NAT10-antisense: UAGCCCACCACCUUCCACUUU (SEQ ID NO.12); si-NC-sense:UUCUCCGAACGUGUCACGUTT (SEQ ID NO.13); si-NC-antisense:ACGUGACACGUUCGGAGAATT (SEQ ID NO. 14); The results are as follows Figure 18 As shown, mice injected with si-NAT10 via the tail vein exhibited a higher weight gain rate than mice injected with wild-type cells due to their reduced metastatic capacity. The number of lung metastases in mice injected with si-NAT10 was significantly lower than in mice injected with si-NC cells. Eosin-hematoxylin staining confirmed that the lung metastases were indeed composed of tumor cells. NAT10 expression within tumors of mice injected with si-NAT10 via the tail vein was lower than that of mice injected with si-NC cells. Furthermore, expression of Ki67 (proliferating cell-associated antigen), a marker of tumor proliferation, was consistent with that of NAT10. These results demonstrate that silencing NAT10 can reduce the metastatic and proliferative capacity of lung adenocarcinoma cells, laying a solid theoretical foundation for the development of drugs and therapies targeting NAT10 to inhibit lung adenocarcinoma metastasis.

Claims

1. Use of the NAT10 gene in the preparation of a drug for inhibiting the proliferation and metastasis of lung adenocarcinoma, characterized in that: The NCBI Gene ID of the NAT10 gene is 55226.

2. A recombinant vector combination, characterized in that: The recombinant vector uses the px458 vector as a starting vector and is connected to the gene shown in SEQ ID NO.1 and / or SEQ ID NO.

2.

3. A recombinant biological cell line, characterized in that The biological cell contains the recombinant vector according to claim 2 or the gene shown in SEQ ID NO.1 and / or SEQ ID NO.

2.

4. The recombinant biological cell line according to claim 3, characterized in that The biological cell line is a microbial cell line or an animal cell line.

5. Use of the recombinant vector according to claim 2 or the biological cell line according to claim 3 or 4 in the preparation of a drug for inhibiting the proliferation and metastasis of lung adenocarcinoma.

6. An siRNA, characterized in that The sense strand of the siRNA is shown in SEQ ID NO.11, and the antisense strand of the siRNA is shown in SEQ ID NO.

12.

7. Use of the siRNA according to claim 6 in the preparation of a drug for inhibiting the proliferation and metastasis of lung adenocarcinoma.

8. A recombinant biological cell line, characterized in that The biological cell line contains the siRNA according to claim 6.

9. The recombinant biological cell line according to claim 8, characterized in that The biological cell line is a microbial cell line or an animal cell line.

10. Use of the recombinant biological cell line according to claim 9 in the preparation of a drug for inhibiting the proliferation and metastasis of lung adenocarcinoma.

Images