Recombinant mussel mucin structure modification method

Abstract

The invention discloses a recombinant mussel mucin structure modification method which comprises the following steps: S1, optimizing a mussel mucin gene sequence, and cloning the optimized mussel mucin gene sequence into an expression vector to construct a recombinant plasmid; s2, transforming the recombinant plasmids into competent cells, and culturing to obtain engineering bacteria; s3, culturing and fermenting the engineering bacteria, centrifugally collecting thalli, adding a bacteria breaking solution to break the thalli, purifying and collecting eluent, and dialyzing to obtain dialysate containing non-viscous recombinant mussel mucin; and S4, adding a chemical oxidizing agent and a reinforcing agent into the dialysate containing the non-viscous recombinant mussel mucin, and reacting to obtain the high-viscosity recombinant mussel mucin. According to the brand-new chemical structure modification method of the recombinant mussel mucin, through the synergistic effect of the high-selectivity oxidizing agent and the reinforcing agent, the protein tertiary structure is unfolded, the reaction activation energy is reduced, efficient and synchronous completion of tyrosine hydroxylation and DOPA quinone crosslinking is achieved, and the modification rate is increased by 7 times or above compared with that of a traditional chemical method.

Description

Technical Field

[0001] The present invention relates to the technical field of biomedicine, and in particular to a method for modifying the structure of recombinant mussel mucin. Background Art

[0002] Mussel mucin is a waterproof, biocompatible, and biodegradable bioadhesive secreted by marine organisms called mussels. It promotes cell attachment and crawling, wound healing, broad-spectrum adhesion, and the formation of a water-resistant protective film, finding applications in cosmetics, biomedicine, and other fields. Mefp-5 is one such small-molecule mucin that plays a major role in adhesion. Its amino acid sequence contains numerous tyrosine residues that can be oxidized to the amino acid 3,4-dihydroxy-L-phenylalanine (DOPA), which is key to its interfacial adhesion.

[0003] Mefp-5 is a rare natural resource, and its extraction process results in significant losses. The extraction methods used are highly toxic, and artificial synthesis often produces harmful byproducts that cannot be removed. Furthermore, the resulting adhesive strength is lower than that of natural mussel mucin. However, genetically engineered mussel proteins offer advantages such as eco-friendliness, high purity, high yield, and low cost. Therefore, developing a method for producing recombinant mussel mucin Mefp-5 using genetically engineered bacteria has significant application value.

[0004] The adhesive strength of mussel mucin depends on the DOPA content. Recombinant mussel mucin expressed through genetic engineering is typically non-adhesive or has very low adhesiveness. Tyrosine residues in the recombinant protein must be modified with DOPA to produce an adhesive protein. Tyrosine modification in mussel mucin has been a difficult problem. Currently, tyrosinase is commonly used for biooxidative modification of tyrosine residues, but this faces challenges such as high cost, enzyme inactivation, and removal of the added modifying enzyme. While chemical modification methods (such as those described in CN103520766A with modifiers such as permanganate and iodine) can avoid residual modifying enzymes, their reaction efficiency and modification rate are generally low. To achieve effective adhesion, the reaction often requires high oxidant concentrations. However, high oxidant concentrations accelerate the quinone formation rate of DOPA, leading to excessive protein cross-linking and, in turn, reduced adhesion. Furthermore, relying solely on oxidants makes it difficult to achieve sufficient modification of protein sites, resulting in weaker adhesion properties compared to enzymatic modification methods. Summary of the Invention

[0005] In order to solve the problems mentioned in the above background technology, the present invention provides a method for modifying the structure of recombinant mussel mucin.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions: A method for modifying the structure of recombinant mussel mucin comprises the following steps: S1. After optimizing the mussel mucin gene sequence, clone it into an expression vector to construct a recombinant plasmid; S2. Transforming the recombinant plasmid into competent cells and culturing them to obtain engineered bacteria; S3. The engineered bacteria were cultured and fermented, the cells were collected by centrifugation, the cells were broken by adding a lytic solution, the eluate was collected and purified, and dialyzed to obtain a dialysate containing non-viscous recombinant mussel mucin; S4. Adding a chemical modifier and an enhancer to the dialysate containing the non-viscous recombinant mussel mucin to react, thereby obtaining a recombinant mussel mucin with high viscosity.

[0007] Preferably, in step S1, the optimized mussel mucin gene sequence is shown in SEQ ID NO: 1: SEQ ID NO: 1 AGCAGCGAGG AATACAAAGG CGGTTACTAT CCGGGCAACA CTTATCATTA CCACTCCGGTGGCTCCTACC ATGGTTCTGG CTACCACGGT GGCTATAAGG GTAAGTACTA TGGTAAAGCG AAAAAGTACTACTACAAATA CAAGAACAGC GGCAAGTACA AATATCTGAA AAAGGCGCGC AAATATCACC GCAAAGGCTATAAGAAATAC TACGGCGGTG GTTCTAGC.

[0008] Preferably, in step S1, the expression vector is pET22b(+), which carries an Ampicillin resistance marker and contains a T7 promoter, a signal peptide coding sequence, and a C-terminal 6×His tag functional module.

[0009] Preferably, in step S2, the method for transforming the recombinant plasmid into competent cells is a heat shock method, specifically: taking the recombinant plasmid and adding it to Transetta (DE3) competent cells, ice bathing, heat shocking, ice bathing, adding LB medium and shaking culture, and spreading the transformed bacterial liquid on an LB agar plate containing Ampicillin for culture.

[0010] Preferably, in step S3, the engineered bacteria culture and fermentation conditions are as follows: the fermentation medium is LB medium containing Ampicillin (50 μg / mL), the fermentation temperature is 37°C, the rotation speed is 500-800 rpm, the IPTG induction concentration is 0.5 mM, the dissolved oxygen is 40%-60%, and the fermentation time is 36-42 h.

[0011] Preferably, in step S3, the composition of the lysis solution is: 20-30 mM Tris-HCl, 400-600 mM NaCl, 0.05-0.15 mM EDTA, pH 7-8.

[0012] Preferably, in step S3, the conditions for disrupting the bacteria are: 3-5°C, pressure 100-1500 bar, disruption 2-4 times, 5000-15000 rpm, 5-15 min centrifugation to collect the supernatant.

[0013] Preferably, in step S4, the chemical oxidant is selected from any one or more of permanganate, chlorate, perchlorate, peroxide, nitrate, Br2, I2, and S8.

[0014] Preferably, in step S4, the enhancer includes a denaturant and a catalyst, the denaturant is selected from any one of urea, guanidine hydrochloride, and guanidine isothiocyanate; the catalyst is selected from any one of manganese dioxide, copper oxide, vanadate, titanium dioxide, and zinc oxide.

[0015] Preferably, the mussel mucin is any one of Mefp-1, Mefp-3, Mefp-5, and Mefp-6.

[0016] The present invention modifies non-adhesive recombinant mussel mucin by using a chemical oxidant (such as potassium permanganate) and an enhancer (such as urea + manganese dioxide). The possible mechanisms are as follows: (1) Structural exposure and activation: The urea in the enhancer destroys the tertiary structure of mussel mucin, causing its molecular chain to unfold, exposing the originally embedded active sites (such as tyrosine residues), significantly improving the accessibility of the modification reaction; at the same time, urea acts as a denaturant to reduce the intermolecular interaction energy of the system and cooperates with manganese dioxide to reduce the reaction activation energy, thereby overcoming the technical defects of low reaction efficiency and insufficient site modification in traditional chemical modification methods. (2) Precursor conversion: Potassium permanganate (KMnO4) hydroxylates the exposed tyrosine (Tyr) benzene ring to generate DOPA (DOPA) with adhesive activity, which supplements the key functional groups of mucin. (3) Cross-linking and curing: The catechol group of DOPA is further oxidized to o-quinone, forming a three-dimensional cross-linked network through covalent bonds (such as Michael addition, Schiff base reaction) or non-covalent interactions (such as π-π stacking). This process is accompanied by protein conformation adjustment and surface charge neutralization, ultimately simulating the natural oxidative curing mechanism of mussel mucin, giving the material significant adhesion strength, water resistance and degradation resistance.

[0017] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides a novel method for chemically modifying recombinant mussel mucin. Through the synergistic effect of a highly selective oxidant and an enhancer, it solves the core problems of low reaction efficiency and insufficient site modification in traditional technologies. The specific advantages are as follows: 1. Breakthrough Improvement in Reaction Efficiency and Modification Rate: Traditional chemical modification methods suffer from low reaction efficiency and inadequate modification of active sites (such as Tyr / DOPA) due to protein structural shielding and energy barrier limitations. This new method uses an enhancer (such as urea + manganese dioxide) to unfold the mucin tertiary structure, fully exposing the active sites. This, in conjunction with an oxidant (such as KMnO4), reduces the reaction activation energy, achieving efficient, simultaneous completion of tyrosine hydroxylation (Tyr→DOPA) and DOPA quinone crosslinking. This efficiency improvement is over seven times greater than traditional chemical methods, and even surpasses enzymatic modification.

[0018] 2. Environmental friendliness and process simplification: Abandoning the traditional enzymatic method's reliance on tyrosinase, the reaction system is constructed using chemical oxidants and enhancers to avoid the unstable activity of exogenous enzyme proteins, harsh reaction conditions, and the difficulty of separating enzyme residues. The process has strong compatibility and no risk of biological contamination.

[0019] 3. Product purity advantage: No exogenous protein needs to be introduced or removed throughout the process. The resulting mucin has a single component and a clear structure, meeting the needs of high-end applications such as medical devices.

[0020] 4. Industrial adaptability: The reaction system is compatible with continuous flow processes and has the potential for large-scale production, providing an efficient and controllable solution for applications in fields such as biomedical adhesives and marine anti-corrosion coatings. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0022] Figure 1 Vector construction map.

[0023] Figure 2 Enzyme digestion identification results.

[0024] Figure 3 WB test results; Lane M represents protein marker, lane 1 represents bacterial-like protein at the 0th induction point, and lanes 2 and 3 represent bacterial-like protein after induction.

[0025] Figure 4 Coomassie brilliant blue test results; Lane M represents protein marker, lane 1 is the sample before purification, lane 2 is the flow-through sample, lanes 3-6 are the washed samples, and lanes 7-8 are the eluted samples.

[0026] Figure 5 Protein adhesion test results; Where 1 and 5 are the unmodified Mefp-5 eluate samples from Example 3; 2 is the tyrosinase-modified Mefp-5 sample from Comparative Example 1; 3 is the iodine-modified Mefp-5 sample from Comparative Example 2; 4 is the Mefp-5 sample co-modified with an oxidant and an enhancer from Example 4; 6 is the tyrosinase control sample; 7 is the iodine control sample; and 8 is the oxidant and enhancer control sample. The Mefp-5 protein content in each sample is 1 mg / mL.

[0027] Figure 6 The standard curve of DOPA content was determined by NBT / potassium glycine staining method.

[0028] Figure 7 DOPA content determination results after protein modification; Wherein, M5 is the unmodified Mefp-5 protein, M5-1 is the tyrosinase-modified Mefp-5 sample in Comparative Example 1, M5-2 is the iodine-modified Mefp-5 sample in Comparative Example 2, and M5-3 is the Mefp-5 sample co-modified with an oxidant and an enhancer in Example 4. The Mefp-5 protein content is 1 mg / mL. DETAILED DESCRIPTION

[0029] To make the objectives, technical solutions, and advantages of the embodiments of the present invention more clear, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention.

[0030] Unless otherwise specified, the raw materials and reagents used in the present invention are commercially available or can be prepared by known methods.

[0031] Example 1: Construction of mussel mucin Mefp-5 expression vector Gene design and plasmid construction were conducted based on the mussel mucin Mefp-5 sequence included in GenBank (accession number: AAL35297.1). The N-terminal signal peptide (amino acids 1-18) was removed, and the mature peptide coding sequence (amino acids 19-102) was designed. The sequence was optimized using codons preferred by Escherichia coli. The optimized gene sequence (SEQ ID NO: 1) was cloned into the expression vector pET22b(+) to construct the recombinant plasmid pET22b(+)-M5. The vector carries an ampicillin resistance marker and contains a T7 promoter, a signal peptide coding sequence, and a C-terminal 6×His tag functional module for efficient expression and purification of the target protein.

[0032] The Mefp-5 gene fragment was inserted by double enzyme digestion with NdeI and XhoI, replacing the XhoI (158) to NdeI (288) region to ensure that the Mefp-5 gene could be correctly integrated into the vector. The specific plasmid construction work was entrusted to Nanjing GenScript Biotechnology Co., Ltd. The vector construction picture is shown in the figure. Figure 1 shown.

[0033] (2) Transformation and screening: The constructed recombinant plasmid pET22b(+)-M5 was transformed into Transetta (DE3) competent cells (purchased from TransGen Biotech) by heat shock method. The specific steps are as follows: Take 1 μL of recombinant plasmid and add it to 50 μL Transetta (DE3) competent cells and place it on ice for 30 minutes. Heat shock at 42℃ for 90 seconds, then quickly place it on ice for 2 minutes; add 500 μL LB medium and culture at 37℃ with shaking for 1 hour; spread the transformed bacterial liquid on LB agar plate containing Ampicillin (50 μg / mL) and culture at 37℃ for 14 hours. Pick a single clone and inoculate it into LB liquid medium containing Ampicillin (50 μg / mL), culture it at 37℃ with shaking for 12 hours for subsequent verification experiments.

[0034] (3) Verification of positive clones: extract the recombinant plasmid, perform double enzyme digestion with MluI and XhoI, analyze the digestion products by agarose gel electrophoresis, and compare them with KB Ladder DNA molecular weight standards. DNA fragments of different sizes migrate at different speeds in an electric field. By comparing with the standard, it can be determined whether the size of the digested band is consistent with the expected size. Extract the recombinant plasmid, verify the correctness of the inserted sequence by double enzyme digestion and sequencing (SEQ ID NO: 1). The agarose gel electrophoresis results are as follows: Figure 2 The results showed that the size of the enzyme-digested band was consistent with the expected size, indicating that the inserted sequence was correct.

[0035] (4) Preservation of engineered bacteria: The verified strain was named Transetta pet22b(+)_GS-M5 and stored at -80°C for a long time after mixing with 50% glycerol.

[0036] Example 2: Expression and identification of mussel mucin Mefp-5.

[0037] Activated Transetta pet22b(+)_GS-M5 was inoculated into LB medium containing 50 g / mL of ampicillin. The fermentation temperature was 37°C, the rotation speed was 500-800 rpm, the IPTG induction concentration was 0.5 mM, the dissolved oxygen level was 50%, and the fermentation time was 40 hours. The fermentation broth was centrifuged at 9000 rpm for 10 minutes, and the supernatant was discarded. The pellet was washed three times with PBS and then centrifuged under the same conditions. The cells were collected and resuspended in PBS. The inducible cells expressed the mussel mucin Mefp-5 with a purification tag (6×His).

[0038] Take the bacterial protein at the induction point 0 and the bacterial protein after induction for protein WB test (electrophoresis system is Tricine-SDS-PAGE system), use the primary antibody ProteinFind Anti-His Mouse Monoclonal Antibody, and the secondary antibody ProteinFind Goat Anti-Mouse IgG (H+L). The WB exposure results are as follows Figure 3 The results showed that the Mefp-5 protein was located between 7 KDa and 16 KDa, close to the 16 KDa position.

[0039] Example 3: Purification and identification of mussel mucin Mefp-5 protein.

[0040] The harvested cells were resuspended in a lysis buffer (25 mM Tris-HCl, 500 mM NaCl, 0.1 mM EDTA, pH 7.5) at a 1:10 ratio. The cells were disrupted at 4°C, 1200 bar, and centrifuged three times at 9000 rpm for 10 min. The supernatant was then passed through a nickel column at a flow rate of 2 cm / min and loaded. The wash buffer consisted of 10 mM imidazole, 300 mM sodium chloride, and 20 mM Tris-HCl, pH 8.0. The elution buffer consisted of 300 mM imidazole, 300 mM sodium chloride, and 20 mM Tris-HCl, pH 8.0, at a flow rate of 2 cm / min.

[0041] After collecting the samples from each step of purification, protein electrophoresis was performed using the Tricine-SDS-PAGE system. After the electrophoresis was completed, the protein film was taken out and stained with Coomassie Brilliant Blue. After decolorization, the protein gel bands were observed. Figure 4 As shown, the results showed that the position of the purified Mefp-5 protein band was the same as that of the Mefp-5 protein identified by WB.

[0042] Example 4: Method for structural modification of mussel mucin Mefp-5 The eluate obtained in Example 3 was placed in a dialysis bag with a cutoff of 1 kDa and dialyzed overnight at 4°C using 20 mM sodium acetate buffer, pH 4.5. The dialyzate was changed twice with a sample to dialyzate ratio of 1:100.

[0043] The dialyzed liquid was collected and placed in a reaction vessel. Urea (4M), potassium permanganate (10mM), and MnO2 (0.1mM) were then added. The pH was adjusted to 4.5 and maintained for 12 hours. The reaction temperature was controlled at 4°C. After the reaction was completed, MnO2 was removed by filtration using a 0.22μm filter membrane. The reaction solution was then placed in a 1KDa dialysis bag and dialyzed overnight at 4°C. The dialyzate was 20mM, pH 4.5 sodium acetate buffer. Potassium permanganate and urea were removed by dialysis. After two dialysis cycles, functional mussel mucin was finally obtained. Example 5

[0044] The difference between this example and Example 4 is that potassium chlorate is added to a final concentration of 10 mM, and the rest is exactly the same as Example 1. Example 6

[0045] The difference between this example and Example 4 is that hydrogen peroxide was added to a final concentration of 10 mM, and the rest of the steps were identical to those of Example 1. Example 7

[0046] The difference between this embodiment and embodiment 4 is that the enhancer is 4M guanidine hydrochloride and 0.1mM copper oxide, and the rest is exactly the same as embodiment 1. Example 8

[0047] The difference between this embodiment and embodiment 4 is that the enhancer is 4M guanidine isothiocyanate and 0.1mM titanium dioxide, and the rest is exactly the same as embodiment 1.

[0048] Comparative Example 1 Mussel mucin Mefp-5 tyrosinase modification method The eluate obtained in Example 3 was placed in a dialysis bag with a cutoff of 1 kDa and dialyzed overnight at 4°C using 20 mM sodium acetate buffer, pH 4.5. The dialyzate was changed twice with a sample to dialyzate ratio of 1:100.

[0049] The dialyzed fluid was collected and tyrosinase solution was added to make the final concentration 50U / mL; then CuSO4 solution was added to make the final concentration 2 mM, maintained for 3 hours, and the reaction temperature was controlled at 37°C to finally obtain functional mussel mucin.

[0050] Comparative Example 2 Oxidant modification method of mussel mucin Mefp-5 The eluate obtained in Example 3 was taken and placed in a dialysis bag with a cutoff of 1 KDa and dialyzed overnight at 4°C. The ratio of the dialyzed sample to the dialysate was 1:100, and the dialysate was replaced twice.

[0051] As described in Example 3 of CN103520766A, the dialyzed liquid was collected and placed in a reaction vessel. A 10% (mass percent) iodine solution was added, and the iodine solution was added to a 1 mg / mL Mefp-5 concentration of 2% of the total volume. After mixing, the mixture was maintained for 12 hours at a temperature of 4°C. After completion of the reaction, the reaction solution was placed in a 1 KDa dialysis bag and dialyzed overnight at 4°C using 20 mM sodium acetate buffer, pH 4.5. The iodine solution was removed by dialysis. Dialysis was repeated twice to obtain functional mussel mucin.

[0052] Results and Testing Protein adhesion assay 2 μL of the sample obtained in Example 4, Comparative Example 1, and Comparative Example 2 was placed on a 0.2 μm nitrocellulose membrane (NC membrane), and the sample position was marked. After the sample was absorbed by the NC membrane, the NC membrane with the sample was placed in a 500 mL beaker, added with 300 mL of pure water, and sonicated for 10 minutes. The NC membrane was removed and placed in a Petri dish. NBT staining solution was added and stained for 45 minutes in the dark. The NBT staining solution was prepared by dissolving 9 mg of NBT in 15 mL of glycine-potassium buffer, mixing thoroughly, and preparing it immediately before use. The glycine-potassium buffer was prepared by dissolving 75 g of glycine in 400 mL of water, adjusting the pH to 10 with solid KOH, and then adding water to 500 mL. After preparation, the membrane was stored at 4°C. After staining, the NC membrane was removed and rinsed twice with sodium borate solution, then stored in the sodium borate solution overnight, and then rinsed three times with pure water. The sodium borate solution was prepared by dissolving 2.5 g of sodium borate decahydrate in 40 mL of water and sonicating at 40°C. The sample marks were observed to have blue-purple spots. The sample results of Example 4, Comparative Example 1 and Comparative Example 2 were as follows: Figure 5 As shown, Figure 5Spots 1 and 5 represent the eluate samples of unmodified Mefp-5 from Example 3, indicating that unmodified Mefp-5 is non-colorigenic. Modified Mefp-5 (spots 2, 3, and 4) all exhibit significant color development, with the oxidant-enhancer co-modified Mefp-5 (spot 4) exhibiting the strongest color development and the iodine-modified Mefp-5 (spot 3) exhibiting the weakest. Among the negative controls, spots 6, 7, and 8 exhibit no color development, except for the tyrosinase control sample (spot 6), which exhibits weak color development. This suggests that the color development of tyrosinase-modified Mefp-5 is subject to slight background interference, while that of iodine-modified Mefp-5 and oxidant-enhancer co-modified Mefp-5 exhibits no background interference. Adhesion results demonstrate that the adhesion of oxidant-enhancer co-modified Mefp-5 is significantly stronger than that of tyrosinase-modified and iodine-modified Mefp-5.

[0053] Protein dopa content determination Use the NBT / potassium glycinate staining method (0.24 mM NBT, 2 M potassium glycinate, pH 10). Add 0, 2, 4, 8, 16, and 20 μL of DOPA standard (1 μg / mL) to six labeled wells of a 96-well plate, adjust the final volume of each well to 20 μL with ultrapure water, and add 180 μL of NBT / potassium glycinate solution. Repeat the steps of Example 4 and Comparative Example 1 in the NBT / potassium glycinate solution. Incubate at 25°C in the dark for 1 hour, and measure the absorbance at 530 nm using a microplate reader. Prepare a standard curve using a series of DOPA solutions, and calculate the DOPA content of the sample based on the measured absorbance of the sample solution.

[0054] Standard curve Figure 6 As shown, the sample results of Example 4, Comparative Example 1 and Comparative Example 2 are as follows Figure 7 As shown, the DOPA content of Mefp-5 increased significantly after modification. The DOPA content after tyrosinase modification was 0.768±0.046μg / mL, the DOPA content after iodine modification was 0.272±0.034μg / mL, and the DOPA content after co-modification with an oxidant and an enhancer was 2.157±0.139μg / mL. The DOPA content of unmodified Mefp-5 was 0.039±0.010μg / mL. The DOPA content of Mefp-5 after tyrosinase modification increased by 19.8 times compared with that of unmodified Mefp-5, the DOPA content after iodine modification increased by 7 times, and the DOPA content after co-modification with an oxidant and an enhancer increased by 55.7 times. In other words, the DOPA content of Mefp-5 after tyrosinase modification and iodine modification was much lower than that after co-modification with an oxidant and an enhancer.

[0055] SEQ ID NO: 1 AGCAGCGAGG AATACAAAGG CGGTTACTAT CCGGGCAACA CTTATCATTA CCACTCCGGTGGCTCCTACC ATGGTTCTGG CTACCACGGT GGCTATAAGG GTAAGTACTA TGGTAAAGCG AAAAAGTACTACTACAAATA CAAGAACAGC GGCAAGTACA AATATCTGAA AAAGGCGCGC AAATATCACC GCAAAGGCTATAAGAAATAC TACGGCGGTG GTTCTAGC.

[0056] The above description is only a preferred specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any technician familiar with the technical field, within the technical scope disclosed by the present invention, who makes equivalent replacements or changes based on the technical solution and inventive concept of the present invention, should be covered by the scope of protection of the present invention.

Claims

1. A method for modifying the structure of recombinant mussel mucin, characterized in that: The steps include: S1. After optimizing the mussel mucin gene sequence, clone it into an expression vector to construct a recombinant plasmid; S2. Transforming the recombinant plasmid into competent cells and culturing them to obtain engineered bacteria; S3. The engineered bacteria were cultured and fermented, the cells were collected by centrifugation, the cells were broken by adding a lytic solution, the eluate was collected and purified, and dialyzed to obtain a dialysate containing non-viscous recombinant mussel mucin; S4. Adding a chemical oxidant and an enhancer to the dialysate containing the non-viscous recombinant mussel mucin to react, thereby obtaining a recombinant mussel mucin with high viscosity.

2. A method for modifying the structure of recombinant mussel mucin according to claim 1, characterized in that: In step S1, the optimized mussel mucin gene sequence is shown in SEQ ID NO: 1: SEQ ID NO: 1 AGCAGCGAGG AATACAAAGG CGGTTACTAT CCGGGCAACA CTTATCATTA CCACTCCGGTGGCTCCTACC ATGGTTCTGG CTACCACGGT GGCTATAAGG GTAAGTACTA TGGTAAAGCG AAAAAGTACTACTACAAATA CAAGAACAGC GGCAAGTACA AATATCTGAA AAAGGCGCGC AAATATCACC GCAAAGGCTATAAGAAATAC TACGGCGGTG GTTCTAGC.

3. A method for modifying the structure of recombinant mussel mucin according to claim 1, characterized in that: In step S3, the composition of the lysis solution is: 20-30 mM Tris-HCl, 400-600 mM NaCl, 0.05-0.15 mM EDTA, pH 7-8.

4. A method for modifying the structure of recombinant mussel mucin according to claim 1, characterized in that: In step S3, the conditions for disrupting the bacteria are: 3-5° C., pressure 100-1500 bar, disruption 2-4 times, 5000-15000 rpm, 5-15 min centrifugation to collect the supernatant.

5. A method for modifying the structure of recombinant mussel mucin according to claim 1, characterized in that: In step S4, the chemical oxidant is selected from any one or more of permanganate, chlorate, perchlorate, inorganic peroxide, nitrate, Br2, I2, and S8.

6. A method for modifying the structure of recombinant mussel mucin according to claim 1, characterized in that: In step S4, the enhancer includes a denaturant and a catalyst, the denaturant is selected from any one of urea, guanidine hydrochloride, and guanidine isothiocyanate; the catalyst is selected from any one of manganese dioxide, copper oxide, vanadate, titanium dioxide, and zinc oxide.

7. The method for modifying the structure of recombinant mussel mucin according to claim 1, wherein: The mussel mucin is any one of Mefp-1, Mefp-3, Mefp-5 and Mefp-6.

Images