Use of hxt4 gene or hxt4 protein in improving tolerance of saccharomyces cerevisiae to hydroxycinnamic acid compounds

Abstract

The application provides application of HXT4 gene or HXT4 protein in improving tolerance of Saccharomyces cerevisiae to hydroxycinnamic acid compounds. The application can improve the tolerance concentration of Saccharomyces cerevisiae to p-coumaric acid, ferulic acid and other hydroxycinnamic acid compounds from 1 mg / mL to 10 mg / mL by transferring a recombinant plasmid containing HXT4 gene into Saccharomyces cerevisiae, that is, overexpression of HXT4 gene in Saccharomyces cerevisiae can significantly improve the tolerance of Saccharomyces cerevisiae to hydroxycinnamic acid compounds, so that more hydroxycinnamic acid compounds can be added in products containing Saccharomyces cerevisiae (such as medicines, health products, cosmetics or food and the like), and the quality of the products is improved.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of microbial technology. More specifically, it relates to the application of HXT4 gene or HXT4 protein in improving the tolerance of Saccharomyces cerevisiae to hydroxycinnamic acid compounds. BACKGROUND

[0002] P-coumaric acid, with the molecular formula C9H8O3, belongs to hydroxycinnamic acid compounds, which can be isolated from foods such as coffee, tea, fruits and vegetables, and is widely available. It is widely used in various fields such as pharmaceuticals, health products, cosmetics or food, etc. due to its excellent biological activities such as antioxidant, anti-inflammatory, antibacterial, etc. such as: ① in the field of pharmaceuticals for anti-platelet activation, immunosuppression and even anti-tumor, etc.; ② in the field of health products for antioxidant, protecting cells from oxidative stress, etc.; ③ in the field of cosmetics for antioxidant, moisturizing, soothing, brightening skin color, etc.; ④ in the field of food for the preparation of preservatives, flavor enhancers, pigments, nutritional fortifiers and other food additives.

[0003] Ferulic acid (3-methoxy-4-hydroxycinnamic acid), with the molecular formula C 10 H 10 O4, belongs to hydroxycinnamic acid compounds, which is widely present in plant cell walls and is widely available. It is widely used in various fields such as pharmaceuticals, health products, cosmetics or food, etc. due to its excellent biological activities such as antioxidant, anti-inflammatory, antibacterial, etc. such as: ① in the field of pharmaceuticals for anti-depression, anti-thrombosis, cardiovascular protection, anti-tumor and organ protection, etc.; ② in the field of health products for antioxidant, neutralizing free radicals, reducing cell damage, delaying aging process, etc.; ③ in the field of cosmetics for sunscreen, whitening, soothing, repair, etc.; ④ in the field of food for the preparation of preservatives, flavor enhancers, nutritional fortifiers and other food additives.

[0004] Saccharomyces cerevisiae is also widely used in the fields of pharmaceuticals, health products, cosmetics or food, etc. such as: ① in the field of pharmaceuticals for vaccine and biological drug production, gene function research and disease model construction, drug screening and safety evaluation, etc.; ② in the field of health products for regulating intestinal health, enhancing immunity, supplementing trace elements, etc.; ③ in the field of cosmetics for anti-aging, moisturizing, whitening, repair, etc.; ④ in the field of food for traditional fermentation, single-cell protein production, feed additive preparation, etc.

[0005] However, when more p-coumaric acid or ferulic acid and other hydroxycinnamic acid compounds are added in products containing Saccharomyces cerevisiae (such as pharmaceutical products, health products, cosmetics or food, etc.), the normal growth of Saccharomyces cerevisiae is obviously inhibited due to the weak tolerance of Saccharomyces cerevisiae to hydroxycinnamic acid compounds. Therefore, it is urgent to find a method to improve the tolerance of Saccharomyces cerevisiae to p-coumaric acid, ferulic acid and other hydroxycinnamic acid compounds, so as to achieve the goal of adding more p-coumaric acid, ferulic acid and other hydroxycinnamic acid compounds in products containing Saccharomyces cerevisiae, and thus significantly improve the quality of products. SUMMARY

[0006] The present application aims at the deficiencies of the prior art, and aims to provide the application of HXT4 gene or HXT4 protein in improving the tolerance of Saccharomyces cerevisiae to hydroxycinnamic acid compounds. By transferring the recombinant plasmid containing HXT4 gene into Saccharomyces cerevisiae, the tolerance concentration of Saccharomyces cerevisiae to p-coumaric acid, ferulic acid and other hydroxycinnamic acid compounds can be improved from 1 mg / mL to 10 mg / mL. That is, the overexpression of HXT4 gene in Saccharomyces cerevisiae can significantly improve the tolerance of Saccharomyces cerevisiae to hydroxycinnamic acid compounds, so as to achieve the goal of adding more hydroxycinnamic acid compounds in products containing Saccharomyces cerevisiae (such as pharmaceutical products, health products, cosmetics or food, etc.), and thus significantly improve the quality of products.

[0007] The first object of the present application is to provide the application of HXT4 gene or HXT4 protein in improving the tolerance of Saccharomyces cerevisiae to hydroxycinnamic acid compounds.

[0008] The second object of the present application is to provide a method for improving the tolerance of Saccharomyces cerevisiae to hydroxycinnamic acid compounds.

[0009] The third object of the present application is to provide a recombinant Saccharomyces cerevisiae constructed by the above method.

[0010] The fourth object of the present application is to provide the application of the above-mentioned recombinant Saccharomyces cerevisiae in preparing products containing hydroxycinnamic acid compounds.

[0011] The fifth object of the present application is to provide the application of HXT4 gene or HXT4 protein in constructing a recombinant Saccharomyces cerevisiae with high tolerance to hydroxycinnamic acid compounds.

[0012] The above objects of the present application are achieved by the following technical solutions:

[0013] This invention discovers that by transferring a recombinant plasmid containing the HXT4 gene into *Saccharomyces cerevisiae*, the tolerance concentration of *Saccharomyces cerevisiae* to hydroxycinnamic acid compounds such as coumaric acid and ferulic acid can be increased from 1 mg / mL to 10 mg / mL. In other words, overexpression of the HXT4 gene in *Saccharomyces cerevisiae* can significantly enhance the tolerance of *Saccharomyces cerevisiae* to hydroxycinnamic acid compounds, achieving the goal of adding more hydroxycinnamic acid compounds to products containing *Saccharomyces cerevisiae* (such as pharmaceuticals, health products, cosmetics, or food), thereby significantly improving product quality. Therefore, this invention provides the application of the HXT4 gene or HXT4 protein in enhancing the tolerance of *Saccharomyces cerevisiae* to hydroxycinnamic acid compounds, wherein the nucleotide sequence of the HXT4 gene is shown in SEQ ID NO:3, the amino acid sequence of the HXT4 protein is shown in SEQ ID NO:4, and the hydroxycinnamic acid compounds are coumaric acid and / or ferulic acid.

[0014] Preferably, the brewing yeast is *Saccharomyces cerevisiae* (Saccharomyces cerevisiae). Saccharomyces cerevisiae The LKF-01 strain was deposited on March 26, 2025, at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), with accession number GDMCC No: 66058, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0015] Based on this, the present invention also provides a method for improving the tolerance of Saccharomyces cerevisiae to hydroxycinnamic acid compounds, specifically: constructing recombinant Saccharomyces cerevisiae and then inducing expression; wherein the hydroxycinnamic acid compounds are p-coumaric acid and / or ferulic acid;

[0016] Among them, recombinant brewer's yeast is constructed using one or more of the following biological materials:

[0017] (1) HXT4 gene; The nucleotide sequence of the HXT4 gene is shown in SEQ ID NO:3;

[0018] (2) An expression box containing (1);

[0019] (3) Recombinant expression vectors containing (1) and / or (2).

[0020] Preferably, the brewing yeast is *Saccharomyces cerevisiae* (Saccharomyces cerevisiae). Saccharomyces cerevisiae The LKF-01 strain was deposited at the Guangdong Provincial Center for Microbial Culture Collection on March 26, 2025, with accession number GDMCC No: 66058.

[0021] Preferably, a recombinant plasmid containing the HXT4 gene is first constructed, and then the recombinant plasmid is transformed into Saccharomyces cerevisiae for induced expression.

[0022] More preferably, the brewing yeast is *Saccharomyces cerevisiae* (Saccharomyces cerevisiae). Saccharomyces cerevisiaeThe LKF-01 strain was deposited at the Guangdong Provincial Center for Microbial Culture Collection on March 26, 2025, with accession number GDMCC No: 66058.

[0023] The recombinant Saccharomyces cerevisiae constructed by the above method increases the tolerance concentration of hydroxycinnamic acid compounds such as p-coumaric acid and ferulic acid from 1 mg / mL to 10 mg / mL. This enables the addition of more hydroxycinnamic acid compounds to products containing Saccharomyces cerevisiae (such as pharmaceuticals, health products, cosmetics, or food), thereby significantly improving product quality. Therefore, the recombinant Saccharomyces cerevisiae constructed by the above method, its application in the preparation of products containing hydroxycinnamic acid compounds, and the application of the HXT4 gene or HXT4 protein in constructing recombinant Saccharomyces cerevisiae with high tolerance to hydroxycinnamic acid compounds should all be within the scope of protection of this invention. The nucleotide sequence of the HXT4 gene is shown in SEQ ID NO:3, and the amino acid sequence of the HXT4 protein is shown in SEQ ID NO:4. The hydroxycinnamic acid compounds are p-coumaric acid and / or ferulic acid.

[0024] Preferably, the product is one of a pharmaceutical, health product, cosmetic, or food.

[0025] The present invention has the following beneficial effects:

[0026] This invention, by transferring a recombinant plasmid containing the HXT4 gene into Saccharomyces cerevisiae, can increase the tolerance concentration of Saccharomyces cerevisiae to hydroxycinnamic acid compounds such as p-coumaric acid and ferulic acid from 1 mg / mL to 10 mg / mL. In other words, overexpression of the HXT4 gene in Saccharomyces cerevisiae can significantly improve the tolerance of Saccharomyces cerevisiae to hydroxycinnamic acid compounds, thereby achieving the goal of adding more hydroxycinnamic acid compounds to products containing Saccharomyces cerevisiae (such as pharmaceuticals, health products, cosmetics, or food), and thus significantly improving the quality of the products. Attached Figure Description

[0027] Figure 1 The image shown is an agarose gel electrophoresis result from Example 1. In this image, M represents the marker band, and I represents the PCR product band.

[0028] Figure 2 This is an agarose gel electrophoresis image from Example 2. In the image, M represents the marker band, and I represents the PCR product band.

[0029] Figure 3 This is a fluorescence microscope image of Example 2. Detailed Implementation

[0030] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0031] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0032] The Escherichia coli DH5α strain was purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0033] Example 1: Construction of recombinant brewer's yeast

[0034] (1) The HXT4 gene was amplified by PCR using specific primers with genomic DNA of Saccharomyces cerevisiae LKF-01 strain (deposited at Guangdong Provincial Microbial Culture Collection Center on March 26, 2025, accession number GDMCC No: 66058) as a template.

[0035] The PCR-specific primers for the HXT4 gene are:

[0036] HXT4-F: agcatagcaatctaatctaacccgggatgtctgaagaagctgcctatcaa (SEQ ID NO: 1);

[0037] HXT4-R: tcctcgcccttgctcaccatgatatccttttttccgaacatcttcttgtaaa (SEQ ID NO: 2).

[0038] The nucleotide sequence of the HXT4 gene is shown in SEQ ID NO:3, and the amino acid sequence it encodes is shown in SEQ ID NO:4.

[0039] SEQ ID NO:3:

[0040]

[0041] SEQ ID NO:4:

[0042] .

[0043] (2) Referring to the patent application with publication number CN119979362A, the recombinant plasmid S.cry-TEF1-MET14-EGFP-KanMX was constructed and double-digested with SmaI and EcoRV. The digested products were subjected to agarose gel electrophoresis, and fragments larger than 6000 bp were recovered by gel extraction. The recovered fragments were recombined with the HXT4 gene and transformed into Escherichia coli DH5α strain by heat shock. The resulting plasmid was then plated on LB plates containing 100 μg / mL ampicillin (Amp) and cultured at 37 ℃ for 24 h. Single clones were picked and used as templates. PCR verification was performed using HXT4-F and HXT4-R as PCR verification primers. The PCR products were then subjected to agarose gel electrophoresis, and the results are as follows: Figure 1 As shown in the figure, the PCR product band is around 2000 bp, indicating that the plasmid S.cry-TEF1-HXT4-EGFP-KanMX was successfully constructed.

[0044] (3) Using plasmid S.cry-TEF1-HXT4-EGFP-KanMX as a template, rDNA was amplified using PCR-specific primers. up -TEF1-HXT4-EGFP-KanMX-rDNA down sequence.

[0045] Among them, rDNA up -TEF1-HXT4-EGFP-KanMX-rDNA down The PCR-specific primers for the sequence are:

[0046] rDNA up -F: ccggaacctctaatcattcgc (SEQ ID NO:5);

[0047] DNA down -R: aacgaacgagaccttaacctactaaa (SEQ ID NO: 6).

[0048] (4) rDNA up -TEF1-HXT4-EGFP-KanMX-rDNA down The sequence was electroporated into the Saccharomyces cerevisiae LKF-01 strain to construct recombinant Saccharomyces cerevisiae.

[0049] Example 2: Screening of recombinant brewer's yeast

[0050] (1) The recombinant Saccharomyces cerevisiae obtained in Example 1 was inoculated on YPD plates containing 400 μg / mL G418 and 1 mol / L sorbitol. After culturing at 30 °C for 24 h, the transformants were picked and inoculated into 1 mL of yeast extract peptone glucose medium (YPD liquid medium). The medium was then shaken at 30 °C and 180 rpm for 24 h to obtain the culture solution.

[0051] (2) Take 5 mL of the culture medium obtained in (1) to extract the genomic DNA of the bacterium, and use the genomic DNA as a template to perform PCR amplification with the verification primers scry-check-F: tcgatgacctcccattgata (SEQ ID NO:7); scry-check-R: gctgaacttgtggccgttta (SEQ ID NO:8). Then perform agarose gel electrophoresis on the PCR amplification products. The agarose gel electrophoresis diagram is shown below. Figure 2 As shown in the figure, the PCR amplification product band is around 2000 bp, and sequencing confirmed that it contains the nucleotide sequence shown in SEQ ID NO:3, indicating that the rDNA... up-TEF1-HXT4-EGFP-KanMX-rDNA down The sequence has been successfully transferred into the Saccharomyces cerevisiae LKF-01 strain, meaning that the recombinant Saccharomyces cerevisiae has been successfully constructed.

[0052] (3) Observe the culture medium obtained in (1) using a fluorescence microscope (with a 20x objective lens and an emission filter wavelength of 512-558 nm and an excitation wavelength of 465-495 nm). The fluorescence microscope image is shown below. Figure 3 As shown. Due to rDNA up -TEF1-HXT4-EGFP-KanMX-rDNA down The EGFP and HXT4 genes in the sequence are expressed as a fusion, and EGFP is a green fluorescent protein. Therefore, the green fluorescence in the fluorescence microscope image proves that the HXT4 gene has been successfully expressed in recombinant Saccharomyces cerevisiae.

[0053] Example 3: Testing the tolerance of recombinant brewer's yeast to p-coumaric acid

[0054] (1) Add p-coumaric acid (0.2 g) to ethanol (2 mL) to obtain p-coumaric acid ethanol solution.

[0055] (2) Add 0.1, 0.5 and 1 mL of p-coumaric acid ethanol solution to the petri dish respectively, then add 10 mL of melted YPD plate, and wait for it to cool and solidify to obtain YPD plates containing 1, 5 and 10 mg / mL p-coumaric acid.

[0056] (3) The recombinant Saccharomyces cerevisiae obtained in Example 1 was inoculated into YPD medium and cultured in a shaker at 30 ℃ and 180 rpm for 24 h to obtain recombinant Saccharomyces cerevisiae culture.

[0057] (4) The Saccharomyces cerevisiae LKF-01 strain was inoculated into YPD medium and cultured in a shaker at 30 ℃ and 180 rpm for 24 h to obtain Saccharomyces cerevisiae liquid.

[0058] (5) Recombinant Saccharomyces cerevisiae broth (5 μL) and Saccharomyces cerevisiae broth (5 μL) were inoculated onto YPD plates containing 1, 5, and 10 mg / mL p-coumaric acid, respectively, and cultured at 30 °C for 24 h.

[0059] After cultivation, observation of colony formation on the plates revealed that the recombinant *Saccharomyces cerevisiae* could grow normally on YPD plates containing 1, 5, and 10 mg / mL p-coumaric acid; while the *Saccharomyces cerevisiae* LKF-01 strain could only grow on YPD plates containing 1 mg / mL p-coumaric acid, and could not grow on YPD plates containing 5 and 10 mg / mL p-coumaric acid. This indicates that the recombinant *Saccharomyces cerevisiae* has a tolerance to p-coumaric acid concentration up to 10 mg / mL, a significant improvement compared to *Saccharomyces cerevisiae*, meaning its tolerance to p-coumaric acid is significantly enhanced. This allows for the addition of more p-coumaric acid and other hydroxycinnamic acid compounds to products containing *Saccharomyces cerevisiae* (such as pharmaceuticals, health products, cosmetics, or food), thereby significantly improving product quality.

[0060] Example 4: Testing the tolerance of recombinant Saccharomyces cerevisiae to ferulic acid

[0061] (1) Add ferulic acid (0.2 g) to ethanol (2 mL) to obtain ferulic acid ethanol solution.

[0062] (2) Add 0.1, 0.5 and 1 mL of ferulic acid ethanol solution to the petri dish respectively, then add 10 mL of melted YPD plate, and wait for it to cool and solidify to obtain YPD plates containing 1, 5 and 10 mg / mL ferulic acid.

[0063] (3) The recombinant Saccharomyces cerevisiae obtained in Example 1 was inoculated into YPD medium and cultured in a shaker at 30 ℃ and 180 rpm for 24 h to obtain recombinant Saccharomyces cerevisiae culture.

[0064] (4) The Saccharomyces cerevisiae LKF-01 strain was inoculated into YPD medium and cultured in a shaker at 30 ℃ and 180 rpm for 24 h to obtain Saccharomyces cerevisiae liquid.

[0065] (5) Recombinant Saccharomyces cerevisiae culture (5 μL) and Saccharomyces cerevisiae culture (5 μL) were inoculated onto YPD plates containing 1, 5, and 10 mg / mL ferulic acid, respectively, and cultured at 30 °C for 24 h.

[0066] After cultivation, observation of colony formation on the plates revealed that the recombinant *Saccharomyces cerevisiae* could grow normally on YPD plates containing 1, 5, and 10 mg / mL ferulic acid; while the *Saccharomyces cerevisiae* LKF-01 strain could only grow on YPD plates containing 1 mg / mL ferulic acid, and could not grow on YPD plates containing 5 and 10 mg / mL ferulic acid. This indicates that the recombinant *Saccharomyces cerevisiae* has a tolerance to ferulic acid concentration up to 10 mg / mL, a significant improvement compared to *Saccharomyces cerevisiae*, meaning its tolerance to ferulic acid is significantly enhanced. This achieves the goal of adding more ferulic acid and other hydroxycinnamic acid compounds to products containing *Saccharomyces cerevisiae* (such as pharmaceuticals, health products, cosmetics, or food), thereby significantly improving product quality.

[0067] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The application of overexpression of the HXT4 gene or HXT4 protein in enhancing the tolerance of Saccharomyces cerevisiae to hydroxycinnamic acid compounds, characterized in that, The nucleotide sequence of the HXT4 gene is shown in SEQ ID NO:3, and the amino acid sequence of the HXT4 protein is shown in SEQ ID NO:4; the hydroxycinnamic acid compound is p-coumaric acid and / or ferulic acid; the brewer's yeast is brewer's yeast (Saccharomyces cerevisiae). Saccharomyces cerevisiae The LKF-01 strain was deposited at the Guangdong Provincial Center for Microbial Culture Collection on March 26, 2025, with accession number GDMCC No: 66058.

2. A method for improving the tolerance of brewer's yeast to hydroxycinnamic acid compounds, characterized in that, Recombinant Saccharomyces cerevisiae was constructed to overexpress the HXT4 gene; the hydroxycinnamic acid compound was p-coumaric acid and / or ferulic acid; the Saccharomyces cerevisiae was Saccharomyces cerevisiae (…). Saccharomyces cerevisiae The LKF-01 strain was deposited at the Guangdong Provincial Center for Microbial Culture Collection on March 26, 2025, with accession number GDMCC No: 66058; Among them, recombinant brewer's yeast is constructed using one or more of the following biological materials: (1) HXT4 gene; The nucleotide sequence of the HXT4 gene is shown in SEQ ID NO:3; (2) An expression box containing (1); (3) Recombinant expression vectors containing (1) and / or (2).

3. The method according to claim 2, characterized in that, First, construct a recombinant plasmid containing the HXT4 gene, then transform the recombinant plasmid into Saccharomyces cerevisiae to overexpress the HXT4 gene.

4. The recombinant brewer's yeast constructed by any one of claims 2 to 3.

5. The application of the recombinant brewer's yeast according to claim 4 in the preparation of products containing hydroxycinnamic acid compounds, characterized in that, The hydroxycinnamic acid compound is p-coumaric acid and / or ferulic acid; the product is one of the following: health products, cosmetics, or food.

6. The application of overexpression of the HXT4 gene or HXT4 protein in constructing recombinant Saccharomyces cerevisiae with high tolerance to hydroxycinnamic acid compounds, characterized in that, The nucleotide sequence of the HXT4 gene is shown in SEQ ID NO:3, and the amino acid sequence of the HXT4 protein is shown in SEQ ID NO:4; the hydroxycinnamic acid compound is p-coumaric acid and / or ferulic acid; the brewer's yeast is brewer's yeast (Saccharomyces cerevisiae). Saccharomyces cerevisiae The LKF-01 strain was deposited at the Guangdong Provincial Center for Microbial Culture Collection on March 26, 2025, with accession number GDMCC No: 66058.

Images