DsRNA nanofized preparation for preventing and treating areca yellowing disease, its preparation method and application

Abstract

The present application relates to the field of agricultural biotechnology, and specifically provides a dsRNA nano-formulation for preventing and treating areca yellowing disease, and a preparation method and application thereof. The areca yellowing disease is a devastating disease caused by areca cryptic virus 1 (APV1), and eight key target gene segments of the APV1 virus genome are screened in the present application, specific double-stranded RNA is designed, and a mixture of dsRNA transcribed from the eight target gene segments is wrapped and delivered by using a nano-carrier to prepare a nano-formulation which improves the environmental stability and RNA interference efficiency of the dsRNA. Experimental results show that the nano-formulation can effectively inhibit the expression of key genes of the APV1 virus, reduce the viral load, and improve the resistance of areca to the yellowing disease. The present application provides a precise, efficient and environmentally friendly biological prevention and control strategy, and has a broad agricultural application prospect.

Description

Technical Field

[0001] This invention relates to the field of RNA biopesticides for the prevention and control of areca nut yellowing disease, specifically to dsRNA nanonucleic acid pesticides for the prevention and control of areca nut yellowing disease, their preparation methods, and applications. Background Technology

[0002] areca nut ( Areca catechu Areca palm (L.) is a palm tree belonging to the palm family. In recent years, the outbreak and rapid spread of Yellow Leaf Disease (YLD) have led to leaf chlorosis, plant weakness, reduced fruit yield, and even the death of the entire plant, severely affecting the yield and quality of areca nuts. For a long time, areca palm yellowing was thought to be mainly caused by phytoplasma infection, but recent research has found a high correlation between areca palm yellowing and Areca palm velarivirus 1 (APV1) infection. APV1 has become one of the main pathogens of areca palm yellowing. This virus belongs to the family Longiviridae (L.). Closteroviridae Cryptoviruses belong to the genus ( Velarivirus The genome is a single-stranded positive-sense RNA genome that encodes multiple functional proteins, including key proteins such as CP and p25, which play important roles in viral replication, transmission, and host infection. Vector-borne transmission experiments confirmed that *Dendrolimus bisporus* (a type of mealybug)... Ferrisia virgata ) and citrus mealybug ( Pseudococcus cryptus These two mealybugs are the vectors for the APV1 virus. After feeding on infected areca nut plants, they can effectively transmit the virus to healthy plants, causing areca nut yellowing disease to spread rapidly in the field. Because of the rapid spread, long incubation period, and strong concealment of the APV1 virus, areca nut yellowing disease is difficult to diagnose and effectively control in the early stages of infection. Once the plants show obvious symptoms, it is usually irreversible. Currently, there are no effective control agents, hence areca nut yellowing disease is called the "cancer" of areca nut.

[0003] Since the outbreak of arecanut yellowing disease, the traditional control method is mainly chemical control. The population number of Dialeuroides spp. and D. citri, which are the virus transmission vectors, is controlled by applying thiamethoxam, cypermethrin, and sulfoxaflor, etc. to reduce the probability of virus transmission. However, long-term and large-scale use of chemical pesticides not only brings environmental pollution and pesticide residue risk, but also leads to the increasing of pest resistance and the obvious decline of control effect. Although breeding virus-resistant arecanut varieties is the most ideal solution in theory, it is difficult to breed new varieties with stable and broad-spectrum resistance due to the slow growth of arecanut, long breeding cycle, and genetic variation of APV1 virus. In addition, although the use of natural enemy insects to control the transmission vector pests can alleviate the spread of the disease to some extent, it is difficult to implement on a large scale in the field, and it has no direct inhibitory effect on virus infection. Agricultural management measures such as strict seedling quarantine, reasonable planting density, and timely removal of diseased plants also cannot completely block the continuous spread of the disease. Therefore, the existing methods are difficult to effectively control the rapid spread of APV1 virus and the continuous spread of arecanut yellowing disease. Since the virus has high transmission efficiency, strong concealment, and irreversible damage after the disease occurs, there is no reliable chemical or biological agent that can effectively treat or control arecanut yellowing disease. Therefore, it is urgent to develop precise and efficient molecular intervention strategies from the mechanisms of virus infection and transmission pathways to achieve active prevention and control of APV1 virus.

[0004] In recent years, RNA interference (RNAi)-based biological control technology has rapidly emerged as an environmentally friendly and safe control strategy for crops, which is of great significance to achieve the global sustainable development goals of the Food and Agriculture Organization (FAO). RNAi technology specifically interferes with the gene expression of pathogenic organisms through double-stranded RNA (dsRNA), reducing the pathogenic ability of pathogens from the source, and has shown great application potential in the prevention and control of many plant viral diseases. However, due to the poor stability and short duration of dsRNA molecules, which are easily degraded by nucleases in the environment, it has become a key problem restricting the widespread application and commercialization of RNA biological pesticides.

[0005] To address the key limiting factor of poor stability of dsRNA, nanomaterials as carriers for delivering dsRNA have become a hot research direction. Previous studies have shown that the use of clay nanosheets, chitosan nanoparticles, zinc oxide nanoparticles and carbon quantum dots and other nanomaterials for leaf delivery of dsRNA can significantly enhance the absorption efficiency of exogenous dsRNA by plants, thereby greatly improving the control effect of RNA interference on plant viruses and insect pests. In addition, nanomaterials are small in size and have the ability to break through the plant cell wall, cell membrane and even nuclear membrane barrier, and can enter the cell interior by means of plant active transport mechanism or cell phagocytosis, thereby enabling dsRNA to enter the cell and exert gene silencing effect. At the same time, the synergistic effect between nanocarriers and dsRNA molecules further enhances the environmental stability and RNAi response efficiency of dsRNA. For example, positively charged chitosan quaternary ammonium salt can promote the effective penetration of dsRNA into the plant cell membrane

[19] , and after forming a complex with dsRNA, the efficiency and stability of dsRNA entering the cell are further improved

[20] . Therefore, the rational application of nanotechnology, combined with dsRNA and nanocarriers and efficient delivery to plant cells, will provide a new idea and technical platform for the prevention and control of plant viral diseases.

[0006] Based on the above research basis, the present application provides a dsRNA nanofication preparation specifically targeting the gene sequence of Areca APV1 virus, in order to achieve precise, efficient and sustainable prevention and control of Areca yellowing disease. SUMMARY

[0007] One of the purposes of the present application is to provide a target gene segment for effectively preventing and controlling Areca yellowing disease;

[0008] The second purpose of the present application is to use the dsRNA prepared from the target gene segment for preventing and controlling Areca yellowing disease;

[0009] The third purpose of the present application is to complex the dsRNA for preventing and controlling Areca yellowing disease with a nanocarrier to obtain a nanonucleic acid composition.

[0010] The above purposes of the present application are achieved by the following technical solutions:

[0011] The first aspect of the present application provides a target gene segment for preventing and treating areca palm yellowing disease, which is selected from any one of HSP70, P21, P60, CP, CPm, P26, P18 or P25 genes of the areca palm velarivirus 1 (APV1) genome of areca palm yellowing virus, and the nucleotide sequences thereof are respectively shown as SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7 or SEQ ID NO. 8.

[0012] The second aspect of the present application provides a vector for RNA interference expression, in particular, a gene expression vector capable of transcribing a dsRNA targeting APV1 virus.

[0013] As a preferred embodiment of the present application, the RNA interference vector can be an L4440 double T7 promoter expression vector. The vector contains a bidirectional T7 promoter inside, and the target gene segment can be inserted between the T7 promoters through an endonuclease enzyme cutting site. Under the induction of IPTG, the T7 RNA polymerase can simultaneously drive bidirectional transcription, so that the inserted target gene segment forms a complementary double-stranded RNA (dsRNA), and then effectively activates the RNA interference (RNAi) mechanism to achieve specific inhibition of the areca palm yellowing disease virus.

[0014] The third aspect of the present application provides a dsRNA for preventing and treating areca palm yellowing disease.

[0015] As a preferred embodiment of the present application, when the target gene segment is the nucleotide sequence shown in SEQ ID NO. 1, the dsRNA consists of the nucleotide sequence shown in SEQ ID NO. 9 and the nucleotide sequence reverse complementary to the nucleotide sequence shown in SEQ ID NO. 9; when the target gene segment is the nucleotide sequence shown in SEQ ID NO. 2, the dsRNA consists of the nucleotide sequence shown in SEQ ID NO. 10 and the nucleotide sequence reverse complementary to the nucleotide sequence shown in SEQ ID NO. 10; when the target gene segment is the nucleotide sequence shown in SEQ ID NO. 3, the dsRNA consists of the nucleotide sequence shown in SEQ ID NO. 11 and the nucleotide sequence reverse complementary to the nucleotide sequence shown in SEQ ID NO. 11; when the target gene segment is the nucleotide sequence shown in SEQ ID NO. 4, the dsRNA consists of the nucleotide sequence shown in SEQ ID NO. 12 and the nucleotide sequence reverse complementary to the nucleotide sequence shown in SEQ ID NO. 12; when the target gene segment is the nucleotide sequence shown in SEQ ID NO. 5, the dsRNA consists of the nucleotide sequence shown in SEQ ID NO. 13 and the nucleotide sequence reverse complementary to the nucleotide sequence shown in SEQ ID NO. 13; when the target gene segment is the nucleotide sequence shown in SEQ ID NO. 6, the dsRNA consists of the nucleotide sequence shown in SEQ ID NO. 14 and the nucleotide sequence reverse complementary to the nucleotide sequence shown in SEQ ID NO. 14; when the target gene segment is the nucleotide sequence shown in SEQ ID NO. 7, the dsRNA consists of the nucleotide sequence shown in SEQ ID NO. 15 and the nucleotide sequence reverse complementary to the nucleotide sequence shown in SEQ ID NO. 15; when the target gene segment is the nucleotide sequence shown in SEQ ID NO. 8, the dsRNA consists of the nucleotide sequence shown in SEQ ID NO. 16 and the nucleotide sequence reverse complementary to the nucleotide sequence shown in SEQ ID NO. 16. The dsRNAs obtained by the skilled in the art are mixed to form a combination of efficient double-stranded RNA molecules to improve the effect of targeted interference on multiple key genes of APV1 virus.

[0016] The fourth aspect of the present application provides a dsRNA nano-preparation consisting of a dsRNA mixture and a nano-carrier.

[0017] The nano-carrier is selected from one of layered double hydroxide, chitosan quaternary ammonium salt or zinc oxide, preferably zinc oxide. As a preferred embodiment of the present application, the optimal compounding ratio of the dsRNA mixture and different types of nano-carriers is: the mass ratio of layered double hydroxide (LDH) nanosheet to dsRNA mixture is 1:7, the mass ratio of chitosan quaternary ammonium salt (CQAS) to dsRNA mixture is 2:1, and the mass ratio of zinc oxide (ZnO) to dsRNA mixture is 1:20. The above ratio can ensure the effective loading of nano-carriers to dsRNA, and at the same time improve its stability and bioavailability, so as to optimize the effect of preventing and treating areca yellowing disease.

[0018] The fifth aspect of the present application provides the application of the target gene segment, the dsRNA transcribed by the target gene segment, and the dsRNA nano-preparation in preventing and treating areca yellowing disease.

[0019] As a reference embodiment of the present application, a method for preventing and treating areca yellowing disease is specifically provided, which comprises:

[0020] (1) preparing the dsRNA corresponding to the target gene segment by using IPTG induction technology;

[0021] (2) complexing the dsRNA with a nano-carrier to improve its stability and absorption and utilization efficiency in tobacco plants;

[0022] (3) directly acting on the areca leaf by injection, spraying or root irrigation, so that the dsRNA nano-preparation penetrates into the plant tissue, thereby targeting the expression of key genes of APV1 virus, verifying that the dsRNA can effectively induce the resistance of areca plants to APV1 virus, and improving the resistance of areca to yellowing disease.

[0023] Detailed description of the overall technical scheme of the present application

[0024] In order to screen the target gene segment with the best interference effect, the present application designs reverse transcription primers according to the genomic sequence of the Areca yellowing virus APV1, reverses the RNA virus into cDNA, designs eight pairs of specific primers according to the obtained cDNA sequence, introduces Hind III and Sac I enzyme cutting sites, respectively, and amplifies the target fragments. Through Hind III and Sac After enzyme cutting, the target fragments obtained by amplification are cloned into the L4440 vector to construct the RNAi expression vector. After PCR amplification verification and DNA sequencing confirm the integrity and accuracy of the inserted sequence, the correct positive plasmid is transformed into the E. coli HT115 (DE3) for the induced expression of dsRNA.

[0025] In the present experiment, the L4440 expression vector is used, which contains a bidirectional T7 promoter inside. Under the induction of IPTG (final concentration about 0.4 mM), the T7 RNA polymerase can drive bidirectional transcription, so that the inserted fragments form complementary double-stranded RNA (dsRNA). Since the E. coli HT115 (DE3) strain has tetracycline resistance and lacks RNase III endonuclease activity, the strain can stably express dsRNA of a larger fragment, improving the yield and integrity of dsRNA.

[0026] The correct monoclonal strain is selected for sequencing verification, inoculated into LB liquid medium, and subjected to large-scale bacterial culture under the condition of IPTG induction. The total RNA is extracted by the Trizol method, and the expression of dsRNA is detected by agarose gel electrophoresis. The results show that the target dsRNA can be obtained, the band is clear, the length is consistent with the expectation, and it is consistent with the eight dsRNAs designed to target APV1 virus. Further RNase enzyme treatment for 4 h, agarose gel electrophoresis analysis shows that the total RNA is completely degraded, while the dsRNA still maintains the intact structure, indicating that the expressed dsRNA has high stability and is not easily affected by RNase degradation.

[0027] The indoor control effect determination results show that among the six kinds of mixed ratios tested, when the mass ratio of mixed dsRNA and zinc oxide (ZnO) reaches 1:20 or above, the best control effect is shown, and the control efficiency is significantly improved. In contrast, when the mass ratio of mixed dsRNA and zinc oxide (ZnO) is less than 1:20, the control effect is reduced. Overall, the mixed dsRNA and zinc oxide (ZnO) can effectively enhance the inhibition of areca yellowing disease, which is better than the use of mixed dsRNA alone, and the mass ratio of 1:20 has the best control effect and lower dsRNA consumption, which has higher application value.

[0028] The beneficial effects of the present application are:

[0029] (1) High targeting accuracy and significant virus inhibition effect

[0030] By screening 8 key genes (HSP70, P21, P60, CP, CPm, P26, P18, P25) of arecanut yellowing virus (APV1) as RNAi targets, the virus CP protein expression in plants treated with mixed target dsRNA (total dsRNA) is reduced by more than 60%, which is significantly better than single target dsRNA (reduction of 30%-50%).

[0031] (2) Significant improvement in environmental stability and delivery efficiency

[0032] The dsRNA is loaded by using nano-carriers (LDH / CQAS / ZnO), which breaks through the bottleneck of easy degradation of natural dsRNA: ZnO nanoparticles (mass ratio 1:20) can achieve 100% complete loading of dsRNA, and the effective period is up to 21 days.

[0033] (3) Leading in prevention efficiency and persistence

[0034] Field tests show that after 21 days of spraying ZnO-dsRNA nano-pesticide, the virus load of arecanut plants is reduced by >50%, and the yellowing spots are reduced by 60%; Persistence comparison: the virus inhibition effect of ZnO-dsRNA still maintains more than 85% after 21 days, while traditional chemical pesticides (such as thiamethoxam) need to be applied every 7 days. BRIEF DESCRIPTION OF DRAWINGS

[0035] Figure 1 For L4440 Carrier-related information.

[0036] Figure 2 For L4440 Single enzyme digestion of recombinant plasmid with target fragment, wherein M: DL2000; 1-16: L4440 and single enzyme digestion of recombinant plasmid with target APV1 fragment.

[0037] Figure 3 Loading effect of LDH on dsRNA, wherein M: DL2000; 1: dsRNA; 2: LDH; 3-10: dsRNA and LDH are loaded at a mass ratio of 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8.

[0038] Figure 4The loading effect of CQAS on dsRNA, wherein M: DL2000; 1: dsRNA; 2: CQAS; 3~8: dsRNA and CQAS are loaded in a mass ratio of 1:1, 2:1, 3:1, 4:1, 5:1, and 6:1, respectively.

[0039] Figure 5 The loading effect of ZnO on dsRNA, wherein M: DL2000; 1: dsRNA; 2: ZnO; 3~8: dsRNA and ZnO are loaded in a mass ratio of 1:1, 1:5, 1:10, 1:15, 1:20, and 1:25, respectively.

[0040] Figure 6 The detection of dsRNA residual amount after co-incubation for 24 hours, wherein M: DL2000; 1: dsRNA-CQAS; 2: dsRNA; 3: dsRNA-CQAS; 4: dsRNA; 5: dsRNA-CQAS; 6: dsRNA.

[0041] Figure 7 The virus CP protein content in the leaf treated with dsRNA spraying and then infected, wherein, Figure 7 A in the above table is the anti-CP leaf virus CP expression amount, Figure 7 B in the above table is the leaf protein extraction internal reference; 1 in the blank control group is before dsRNA treatment; 2 in the blank control group is after dsRNA treatment for 7 days; 1 in the treatment groups S1, S2, and S3 is before dsRNA treatment; 2 in the treatment groups S1, S2, and S3 is after dsRNA treatment for 7 days.

[0042] Figure 8 The virus CP protein content in the leaf treated with different dsRNA fragments and then infected, wherein, Figure 8 A in the above table is the anti-CP leaf virus CP expression amount, Figure 8 B in the above table is the leaf protein extraction internal reference; 1: CK; 2: dsHsp70; 3: dsP21; 4: dsP25; 5: dsP26; 6: dsP18; 7: dsP60; 8: dsCP; 9: dsCPm; 10: dsRNA mixture.

[0043] Figure 9 The virus CP protein content in the leaf treated with different drugs and then infected, wherein, Figure 9 A in the above table is the anti-CP leaf virus CP expression amount, Figure 9 B in the above table is the leaf protein extraction internal reference; 1: LDH; 2: CQAS; 3: ZnO; 4: dsRNA; 5: LDH-dsRNA; 6: CQAS-dsRNA; 7: ZnO-dsRNA.

[0044] Figure 10 The viral CP protein content in the leaves treated with LDH-dsRNA and then infected, wherein, Figure 10 A in the above table is the viral CP expression in anti-CP leaves, Figure 10 B in the above table is the internal reference of leaf protein extraction; 1: CK-7d; 2: CK-14d; 3: CK-21d; 4: LDH-7d; 5: LDH-14d; 6: LDH-21d.

[0045] Figure 11 The viral CP protein content in the leaves treated with CQAS-dsRNA and then infected, wherein, Figure 11 A in the above table is the viral CP expression in anti-CP leaves, Figure 11 B in the above table is the internal reference of leaf protein extraction; 1: CK-7d; 2: CK-14d; 3: CK-21d; 4: CQAS-7d; 5: CQAS-14d; 6: CQAS-21d.

[0046] Figure 12 The viral CP protein content in the leaves treated with ZnO-dsRNA and then infected, wherein, Figure 12 A in the above table is the viral CP expression in anti-CP leaves, Figure 12 B in the above table is the internal reference of leaf protein extraction; 1: CK-7d; 2: CK-14d; 3: CK-21d; 4: ZnO-7d; 5: ZnO-14d; 6: ZnO-21d.

[0047] Figure 13 The statistical results of the control effects of different nano-pesticides on Areca catechu.

[0048] Figure 14 The viral content detection results of Areca catechu plants at different time points (1d, 7d, 14d, 21d) of the ZnO-dsRNA treatment group and the water treatment control group, wherein, Figure 14 A in the above table is the water treatment control group, Figure 14 B, C, and D in the above table are three groups of repeats of the ZnO-dsRNA treatment group, respectively sampled at 1d, 7d, 14d, and 21d; Figure 14 A, B, C, and D in the above table are the anti-CP viral CP expression in the upper graph and the internal reference of leaf protein extraction in the lower graph.

[0049] Figure 15 The partial field test effects of ZnO-dsRNA nano-formulation in Lingshui Areca catechu planting area. DETAILED DESCRIPTION

[0050] The following further describes the screening of target gene segments for preventing and treating Areca catechu yellowing disease, the preparation of dsRNA, and the research of the combination of dsRNA and nano-carriers according to specific examples.

[0051] Example 1 Screening of target gene segments in the process of preventing and treating enantio yellowing disease of Areca catechu, method for preparing dsRNA, research on the formation of stable composition by complexing dsRNA with nanocarriers, and experiments for preventing and treating enantio yellowing disease of Areca catechu

[0052] Materials and methods

[0053] 1.1 Plant material

[0054] Healthy tobacco (Nicotiana tabacum L.) plants infected with APV1 virus were selected for greenhouse cultivation, and fully expanded young functional leaves were collected as explants. The surface of the material was sterilized using a gradient disinfection method: first, the leaf surface was rinsed with flowing deionized water for 15 min to remove attached impurities, then subjected to three-stage sterilization treatment: (1) 75% (v / v) ethanol solution surface sterilization for 30 s; (2) sterile deionized water rinsing once; (3) 2.5% (w / v) sodium hypochlorite solution immersion sterilization for 8-10 min; (4) after three times of sterile deionized water rinsing, placed on sterile filter paper to absorb the surface residual liquid. In the clean bench, using sterile surgical instruments to remove the leaf edge 3 mm and main vein tissue, cutting the mesophyll tissue into 0.4 cm x 0.6 cm rectangular explants. The cutting process maintained the polarity of the tissue, ensuring that the adaxial surface was in contact with the medium. The treated explants were inoculated on Murashige and Skoog (MS) basic solid medium (pH 5.8±0.1, containing 30 g / L sucrose and 7 g / L agar), and the culture conditions were set as: light intensity 50 μmol·m⁻²·s⁻¹, photoperiod 16 h light / 8 h dark, constant temperature 25±1℃. When the adventitious buds developed to 2.5±0.5 cm, the stems with 2-3 true leaves were cut under sterile conditions and transferred to 1 / 2 MS rooting medium. After 3 weeks of induction to form complete root system, healthy tissue culture seedlings with root length ≥3 cm and 3rd order lateral roots were selected for 7-day transition culture (gradually reducing medium humidity). At the time of transplanting, the seedlings were acclimated using the gradient uncovering method, and finally planted in a mixture of vermiculite and nutrient soil (1:1, v / v) to maintain 85% relative humidity for subsequent cultivation. Two weeks later, RNA was extracted from tobacco leaves, and RT-PCR was used to detect whether the tobacco plants carried viruses, and Western Blot was used to detect the expression of viral proteins to further verify the infection.

[0055] The leaves of Areca catechu with yellowing symptoms were collected in the field, and the mealybugs parasitizing thereon were collected and numbered. First, total RNA was extracted from the leaves and mealybug individuals, respectively, and RT-PCR was used to detect virus-specific genes to determine whether the leaves and mealybugs were infected. After screening the infected mealybugs, they were transferred to the leaves of healthy Areca catechu seedlings, and an appropriate amount of mealybugs was inoculated on each seedling. The leaves were wrapped with tin paper to prevent the mealybugs from escaping and to maintain air permeability. After inoculation, the symptoms of the Areca catechu seedlings were observed regularly, and whether the leaves showed yellowing, deformity and other abnormal phenomena at 7 days and 14 days was recorded. Two weeks later, RNA was extracted from the inoculated leaves, and RT-PCR was used to detect whether the virus was transmitted to the Areca catechu seedlings, and Western Blot was used to detect the expression of viral proteins to further verify the infection.

[0056] (2) Strains and plasmids

[0057] APV1 virus vector: The vector used in this experiment is L4440 double T7 promoter expression vector, which is used for cloning of target gene fragments and in vitro synthesis of dsRNA.

[0058] Strains: The Escherichia coli (E. coli) strains used in this experiment, HT115 (DE3) and DH5α, were purchased from Shanghai Weidi Biotechnology Co., Ltd. and were used for related experimental research. Escherichia coli ) HT115 (DE3) and DH5α strains were purchased from Shanghai Weidi Biotechnology Co., Ltd. and were used for related experimental research.

[0059] (3) Preparation of related solutions

[0060] LB (Luria-Bertani) medium: yeast extract 5 g / L, tryptone 10 g / L, NaCl 10 g / L

[0061] Layered double hydroxide (LDH) solution: 0.0001 g of LDH nanomaterial was weighed and dissolved in 1 mL of DEPC-treated water. A pipette gun was used to mix and dissolve the solution to prepare a 0.01% working solution.

[0062] Chitosan quaternary ammonium salt (CQAS) solution: 0.02 g of chitosan quaternary ammonium salt was weighed and dissolved in 100 mL of water. The solution was stirred to dissolve completely and was ready for use. 100 μL of 0.02% chitosan quaternary ammonium salt solution was taken and mixed with 20 μL of 0.25 mol / L Na2SO4 solution.

[0063] Zinc oxide (ZnO) solution: 1 mg of ZnO nanoparticles (NP) with a particle size of 100 nm was weighed and placed in an appropriate amount of absolute ethanol for thorough washing to remove impurities and contaminants on the surface of the particles.

[0064] 1.2 Screening of target gene segments and construction of vectors

[0065] To screen the target gene segment with the best interference effect, reverse transcription primers were designed according to the gene sequence information of Areca yellowing virus APV1, and the RNA virus was reverse transcribed into cDNA. According to the obtained cDNA sequence, eight pairs of specific primers were designed, and restriction enzyme sites were introduced at both ends Hind III and Sac I, respectively, and the target fragments were amplified by PCR. After 1% agarose gel electrophoresis detection of the PCR amplification products, the target fragments were recovered by cutting the gel. Subsequently, the target fragments and L4440 double T7 promoter vector were digested with enzymes, and the recovered target fragments were ligated into the vector. Finally, the correctness of the recombinant plasmid was verified by PCR amplification and sequencing analysis, and the verified positive plasmid was transformed into Escherichia coli (E. coli) E. coli ) DH5α strain for subsequent experiments.

[0066] Table 1 Primer information of different segments of APV1

[0067] Primer Primer sequence (5' to 3') Sequence number dsP21-F GGAGGAATTAGTAGATTGGA SEQ ID.NO.17 dsP21-R GATAAGGAAGTCGCACATA SEQ ID.NO.18 dsP60-F AAGGAGCGTCAGATAAATA SEQ ID.NO.19 dsP60-R TTAGCAGGAGGATATGGA SEQ ID.NO.20 dsCP-F ATTTCTGAGCAATGGACG SEQ ID.NO.21 dsCP-R TCTTTATACGACGGAGTGA SEQ ID.NO.22 dsCPm-F CATTGAACAACCGTTATCT SEQ ID.NO.23 dsCPm-R GTGTATTTCAGACCCATCTC SEQ ID.NO.24 dsP26-F TAACCTACTTAATTTAACGACCGA SEQ ID.NO.25 dsP26-R CTTTCCAAACGCCGAACA SEQ ID.NO.26 dsP18-F AGCAAACCTGAAATCATAC SEQ ID.NO.27 dsP18-R TCATTATCCTTGGCTGGA SEQ ID.NO.28 dsP25-F TAGTAGACACCTCCCATCTG SEQ ID.NO.29 dsP25-R CCAACATCGTCGTCATTT SEQ ID.NO.30 HSP70-F ggtcgacggtatcgataagcttTGGGAGAAGGTAACGGAAAT SEQ ID.NO.31 HSP70-R gatatcatcgatgaattcgagctcGACCTCTGGAGCGGAAAA SEQ ID.NO.32

[0068] The correct positive clones verified by sequencing were selected, inoculated and cultured, and the plasmid was extracted. The plasmid was digested with double enzymes, and after 2 h of enzyme reaction, 1% agarose gel electrophoresis detection was performed. The target fragments were recovered, and the recovered products were stored at -20°C for subsequent experiments. Hind III and Sac I. After 2 h of enzyme reaction, 1% agarose gel electrophoresis detection was performed. The target fragments were recovered, and the recovered products were stored at -20°C for subsequent experiments.

[0069] Table 2 Double enzyme digestion system

[0070] SacI 1µL HindIII 1µL Green Buffer 10µL Plasmid 25µL ddH2O 13µL Total 50µL

[0071] After the L4440 interference vector was treated with double enzyme digestion, the connection reaction was carried out according to the C115 ligation enzyme reagent instruction. Hind III and Sac I. The connection reaction system is shown in Table 3.

[0072] Table 3 Connection reaction system

[0073] L4440 vector 1µL APV1 recovered fragment 1µL C115 ligase 5µL ddH2O 3µL Total 10µL

[0074] The PCR instrument was used for reaction at 50°C for 20 min.

[0075] 1.3 Transformation of Escherichia coli (E. coli) E. coli ) DH5a competent cells

[0076] a. 100 µL of competent cells were added with 7 µL of target plasmid, and incubated on ice for 25 min.

[0077] b. Placed in a 42°C water bath for heat shock for 45 s

[0078] c. Immediately return to ice for 2 min, keep still

[0079] d. Add 700 μL of sterile LB medium without antibiotics into the EP tube, and place it in a 37°C, 200 rpm shaker for 60 min.

[0080] e. Centrifuge at 5000 rpm for 1 min, discard most of the supernatant, keep about 50 μL, then resuspend the bacterial cells by gently blowing and spread them on LB plates containing the corresponding Amp antibiotic.

[0081] f. Place the spread plates in a clean bench, after the bacterial solution is fully absorbed, invert the plates and put them in a 37°C incubator for culture.

[0082] g. After single colonies appear on the plates, pick a single colony and inoculate it into 1 mL of LB medium containing Amp antibiotic, after 4 h of culture at 37°C, take the bacterial solution for PCR detection.

[0083] h. Extract the plasmid and perform enzyme digestion identification, screen and identify the correct recombinant vector, and save it for future use.

[0084] 1.4 Transformation of E. coli (DE3) competent cells E. coli ) HT115 (DE3)

[0085] a. Take the HT115 (DE3) competent cells from -80°C, add 50 μL of competent cells to 3 μL of target plasmid, and incubate on ice for 25 min.

[0086] b. Place it in a 42°C water bath for 45 s.

[0087] c. Immediately return to ice for 2 min, keep still.

[0088] d. Add 700 μL of sterile LB medium without antibiotics into the EP tube, and place it in a 37°C, 200 rpm shaker for 60 min.

[0089] e. Centrifuge at 5000 rpm for 1 min, discard most of the supernatant, keep about 50 μL, then resuspend the bacterial cells by gently blowing and spread them on LB plates containing the corresponding Amp antibiotic.

[0090] f. Place the spread plates in a clean bench, after the bacterial solution is fully absorbed, invert the plates and put them in a 37°C incubator for culture.

[0091] g. After single colonies appeared on the plate, single colonies were picked and inoculated into 1 mL LB medium containing Amp antibiotic, and incubated at 37°C for 4 h. Then, the bacterial solution was used for PCR detection.

[0092] h. The correct bacterial solution was stored for subsequent experiments.

[0093] 1.5 dsRNA induction expression

[0094] Pre-culture: 5ul antibiotic (amp) was added to 5ml LB medium, and the transformed E. coli solution was inoculated into LB liquid medium and incubated at 37°C for 200 rpm overnight.

[0095] Main culture: The overnight culture was diluted 1:100 into new LB liquid medium containing antibiotic, and incubated at 37°C for 220 rpm for about 3h until the OD600 reached 0.4 to 0.6, which was a suitable density range for IPTG induction in HT115.

[0096] IPTG was added to a final concentration of 0.4 mM for induction, and the bacterial solution was collected after 7 hours of shaking culture at 25°C.

[0097] 1.6 Trizol method for extracting total RNA

[0098] The suspended cells were collected into a centrifuge tube, centrifuged at 8,000 g and 4°C for 2 min, and the supernatant was discarded. 1 mL of RNAex was added, and the pipette was blown thoroughly until the lysate was clear without obvious precipitate. After standing at room temperature for 5 min, 1 / 5 volume of chloroform was added, and after mixing, it was left to stand at room temperature for 5 min. After centrifugation at 12,000 g and 4°C for 15 min, the liquid was divided into three layers: supernatant (containing RNA), middle protein layer, and lower organic phase. The supernatant was carefully pipetted into a new centrifuge tube, and 1 / 2 volume of isopropanol was added to the supernatant, mixed well, and left to stand at room temperature for 10 min. After centrifugation at 12,000 g and 4°C for 10 min, the supernatant was discarded to avoid touching the RNA precipitate. An equal volume of pre-cooled (-20°C) 80% ethanol was added, centrifuged at 7,500 g and 4°C for 5 min, and the supernatant was discarded. The centrifuge tube cap was opened, and the RNA precipitate was dried at room temperature for about 5 min. An appropriate amount of RNase-free water was added to dissolve the RNA, and it was stored at -80°C for later use.

[0099] 1.7 Double enzyme digestion verification

[0100] The dsRNA was purified by DNasaI first, incubated at 37℃ for 30 min, and then purified by S1 Nuclease. After incubation at 23℃ for 15 min, the reaction was terminated by adding 0.5 μL EDTA, and then detected by agarose gel electrophoresis.

[0101] Table 4 DNasaI enzyme digestion system

[0102] dsRNA 8µL DNasaI 1µL 10 x DNasa Reaction Buffer 1µL Total 10µL

[0103] Table 5 S1 Nuclease enzyme digestion system

[0104] DNasaI product 7µL S1 Nuclease 1µL 10X S1 Buffer 1µL Total 10µL

[0105] 1.8 Screening of optimal loading ratio of dsRNA and nanodrugs

[0106] Using APV1 as the target virus, dsRNA-LDH, dsRNA-CQAS and dsRNA-ZnO complexes with different mass ratios were prepared. In the in vitro experiment, the migration characteristics of dsRNA were analyzed by agarose gel electrophoresis to evaluate the combination of dsRNA with nanomaterials. If dsRNA is successfully loaded onto the nanocarrier, the free migration band will no longer appear in the gel electrophoresis, indicating that dsRNA has been stably combined on the surface of nanomaterials.

[0107] 1.9 Screening of nanopesticides

[0108] Three nanomaterials were selected to load the same mass of dsRNA, and the virus-infected tobacco plants (infected by APV1 infectious clone) were treated by injection, spraying and root irrigation. Based on Real-time PCR and Western Blot molecular techniques, the expression of APV1 CP gene treated by different methods of nanodrugs was detected. The total dsRNA loaded by nanomaterials was obtained, and LDH / dsRNA, CQAS / dsRNA and ZnO / dsRNA were obtained. The same method was used for treatment. The system leaves were taken after 7d, 14d and 21d of APV1 inoculation treatment, and the stability of the drugs was determined.

[0109] 2. Experimental results

[0110] 2.1 Screening of APV1 virus high-efficiency target genes and construction of prokaryotic expression vector

[0111] In this experiment, L4440 expression vector was used, which contains bidirectional T7 promoter inside Figure 1), the target gene fragment can be inserted between the two T7 promoters through specific enzyme cutting sites. Under IPTG induction conditions, the T7 promoter drives bidirectional transcription, allowing the inserted sequence to form complementary dsRNA molecules. The E. coli HT115 (DE3) strain is naturally resistant to tetracycline and lacks RNase III activity, so it can stably express larger fragments of dsRNA in the bacterial body.

[0112] A prokaryotic expression vector containing dsRNA with a common structure was constructed using the L4440 vector and homologous recombination method.

[0113] Using Hind III and Sac I, the target gene fragment obtained by cloning was cut and ligated to the L4440 vector to construct the RNAi expression vector. After PCR amplification and DNA sequencing verification, it was confirmed that the inserted sequence was completely consistent with the target gene fragment ( Figure 2 ). Then, the verified positive plasmid was transformed into E. coli HT115 (DE3) for induced expression of dsRNA.

[0114] 2.2 IPTG-induced expression of dsRNA extraction

[0115] The plasmid of the L4440-APV1 target fragment recombinant vector was extracted and transformed into HT115 competent cells, and single colonies were selected for PCR testing and agarose gel electrophoresis detection. After the 10 mL HT115 bacterial solution containing the recombinant plasmid was cultured to increase the cell density, it was expanded to 500 mL until the OD600 reached 0.4. Then 40 μl of IPTG was added to make the final concentration 0.4 mmol / L, and the dsRNA was extracted after 7 hours of induction. The control group used E. coli HT115 (DE3) strain containing empty vector L4440, and was cultured according to the same method.

[0116] 2.3 Optimal ratio of nanomedicine

[0117] Using APV1 as the target virus, the dsRNA transcribed from the above 8 target gene segments: dsHSP70, dsP21, dsP60, dsCP, dsCPm, dsP26, dsP18 and dsP25 were mixed in a mass ratio of 1:1:1:1:1:1:1:1 to obtain a dsRNA mixture. Different mass ratios of dsRNA mixture (hereinafter referred to as dsRNA) and nanocarriers were set, namely dsRNA-LDH, dsRNA-CQAS and dsRNA-ZNO.

[0118] To determine the optimal loading ratio of dsRNA in LDH nanosheets, dsRNA-LDH complexes with mass ratios of 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, and 1:10 were prepared, respectively, and subjected to agarose gel electrophoresis analysis. The results showed that when the mass ratio of mixed dsRNA to LDH was 1:7, only a fluorescent signal was observed in the loading well, indicating that the dsRNA had completely bound to the LDH nanosheets and no longer migrated freely. Figure 3 ).

[0119] Systematic loading tests were conducted on different mass ratios of dsRNA to CQAS to evaluate their binding capacity and loading limit. The experimental setup included mass ratios of 1:1, 2:1, 3:1, 4:1, 5:1, and 6:1, respectively. The experimental results showed that when the mass ratio of dsRNA to CQAS was 2:1, only a luminescent band appeared in the loading well, indicating that the dsRNA was completely retarded in the loading well and there was no leakage of dsRNA. Figure 4 ).

[0120] To determine the optimal loading ratio of dsRNA in ZnO nanoparticles, dsRNA-ZnO complexes with mass ratios of 1:1, 1:5, 1:10, 1:15, 1:20, and 1:25 were prepared, respectively, and subjected to agarose gel electrophoresis analysis. Figure 5 ). The results showed that when the mass ratio of dsRNA to ZnO was 1:20, only a fluorescent band was observed in the loading well, indicating that the dsRNA had been completely loaded and fixed on the ZnO nanoparticles. This result verified the high loading capacity of ZnO for dsRNA at this ratio.

[0121] 2.4 Protection effect of nanomaterials on dsRNA

[0122] The protection effect of nanomaterials on dsRNA under natural conditions was evaluated. The nanodrugs were placed in a 28°C environment, simulating a light / dark cycle (12 h / 12 h), and incubated for 24 h. During the experiment, the complexes were treated with Na2HPO4 / citric acid buffer at pH 3 to release the dsRNA, and dsRNA without nanomaterial binding was used as a control. The stability of dsRNA under the protection of LDH, CQAS, and ZnO was tested through three groups of experiments. The electrophoresis results showed that the brightness of the dsRNA band wrapped in nanomaterials was significantly enhanced Figure 6 ), indicating that nanomaterials can significantly improve the stability of dsRNA and reduce its degradation in the environment.

[0123] 2.5 Analysis of APV1 virus load and gene silencing effect in tobacco plants after dsRNA treatment

[0124] The protein of the Areca palm tissue was extracted, and the APV1 virus load was detected by Western Blot. Figure 7 The experimental results (Fig. 4) show that after the dsRNA is inoculated by spraying, the virus load in the tobacco plants is significantly reduced. By detecting the protein expression level of the key gene of the virus by Western Blot, it is found that the expression amount of the APV1 virus key gene in the dsRNA treatment group is reduced compared with the untreated plants, indicating that the designed dsRNA can effectively inhibit the replication of the APV1 virus and reduce the disease degree of the plants.

[0125] 2.6 Virus load in tobacco plants and gene silencing efficiency detection after dsRNA is incubated with nanomaterials

[0126] (1) Analysis of the persistence period of the dsRNA loaded by the nanocarrier

[0127] Firstly, the inventors of the present application studied the inhibitory effect of dsHsp70, dsP21, dsP25, dsP26, dsP18, dsP60, dsCP, dsCPm and mixed dsRNA on the APV1 virus (Fig. 1), Figure 8 It is found that different target fragment treatments can reduce the virus CP protein content in the tobacco leaves inoculated with the virus to different degrees. By Western Blot detection, it is found that the relative expression level of the APV1 virus CP gene and CP protein in the tobacco plants treated by the mixed dsRNA is the lowest. In order to further study the persistence period of the mixed dsRNA (containing dsHsp70, dsP21, dsP25, dsP26, dsP18, dsP60, dsCP, dsCPm) loaded by ZnO, LDH and CQAS nanocarriers in the tobacco plants, the relative expression level of the APV1 virus CP gene and CP protein in the tobacco plants treated by LDH-dsCP, CQAS-dsCP and ZnO-dsCP was detected by Western Blot. The results show that (Fig. 2), Figure 9 Compared with ZnO, LDH, CQAS or dsRNA alone, the relative expression amount of the APV1 virus CP gene and CP protein in the tobacco plants treated by LDH-dsRNA, CQAS-dsRNA and ZnO-dsRNA is significantly reduced, indicating that the nanocomposite material can effectively deliver the dsRNA and enhance the RNA interference effect, thereby producing a good inhibitory effect on the APV1 virus.

[0128] (2) Virus CP protein content in the leaves inoculated after different nanometer-dsRNA treatments

[0129] According to the maximum loading ratio of NPs to dsRNA, it is ensured that the dsRNA can be completely absorbed, and at the same time, the quality of the three nanomaterials (LDH, CQAS, ZnO) is as consistent as possible, so as to improve the efficiency of dsRNA into cells. The treatments of ZnO / dsRNA Figure 12 , LDH / dsRNA Figure 11 and CQAS / dsRNA Figure 10 were carried out on tobacco plants. During the spraying process, the top of the plant was covered to reduce the direct exposure of dsRNA. On the 7th day, 14th day and 21st day after inoculation of APV1 virus, the new untreated leaves of the plants were taken, the total protein was extracted, and the expression of the key protein of APV1 virus was detected by qRT-PCR and Western Blot, so as to evaluate the persistence of dsRNA delivered by different nanocarriers in tobacco plants.

[0130] In summary, the ZnO nanocarrier is superior to LDH and CQAS in terms of stability in delivering dsRNA and effect in preventing and treating APV1 virus. The experimental results show that the three nanomaterials can effectively reduce the viral load of tobacco plants, but the ZnO / dsRNA combination shows higher virus inhibition rate and better persistence at different mass ratios. When the mass ratio of ZnO to dsRNA is 1:20, the prevention and treatment effect is the best, and it can reduce the amount of dsRNA while maintaining high antiviral efficiency. Therefore, the ZnO / dsRNA complex has better application prospects in the RNAi prevention and treatment of areca yellowing disease.

[0131] 2.7 Virus load and gene silencing efficiency detection in areca leaf after ZnO-dsRNA treatment and inoculation

[0132] In the previous experiment, we determined through tobacco plant screening that the ZnO-dsRNA nanodrug had the most significant inhibitory effect on the target virus. On this basis, the nanodrug was applied to the areca plants after inoculation, and three groups of repeats were set up, with the water treatment group as the control. Virus content detection and plant phenotype observation were carried out on the 7th day, 14th day and 21st day after treatment. As shown in Figure 13 , ZnO-dsRNA treatment significantly reduced the virus content in areca plants, and this trend became more obvious as the treatment time prolonged. Further from Figure 14 , it can be seen that the areca virus content of the control group treated with water increased Figure 14 (A). The number of yellowing spots of the ZnO-dsRNA treatment group was significantly reduced, and the plant phenotype was obviously improved, indicating that it has good prevention and treatment potential in practical application Figure 14 (B, Figure 14 C, Figure 14 D).

[0133] 2.8 Field application of ZnO-dsRNA nanonucleic acid pesticide on virus-carrying Areca plants and verification of virus inhibition effect

[0134] To further verify the prevention and control effect of the ZnO-dsRNA nanonucleic acid pesticide composition on Areca yellowing disease (APV1 virus) under field conditions, a field application experiment on virus-carrying Areca plants was designed and carried out to detect the inhibition capacity of the ZnO-dsRNA nanonucleic acid pesticide composition on the accumulation of APV1 virus. First, 60 Areca plants suspected to be infected with yellowing disease were randomly collected from typical Areca planting areas in Lingshui, Baoting and Wanning in Hainan Province, and leaf samples were collected for RT-PCR and Western Blot combined detection. The expression level of the APV1 virus CP gene was detected by RT-PCR, and the accumulation of the virus CP protein was detected by Western Blot. 14 plants in each planting area that were positive in both tests were selected, and a total of 42 plants were used as test plants to ensure that the initial value of the virus load was consistent. Two treatment groups were set up: (1) ZnO-dsRNA treatment group; (2) water blank control group. The mass ratio of ZnO to dsRNA was 1:20, and the concentration of dsRNA in the working solution was 50 μg / mL. Treatment was mainly by spraying and supplemented by root irrigation, and the treatment was performed every 3 days for 3 times.

[0135] On the first day of treatment (before application) and on the 21st day of treatment, leaf samples of Areca plants in each treatment group were collected, total protein was extracted, and Western Blot detection was performed to compare the expression changes of APV1 virus at different time points. The results showed that compared with the water control group, the relative expression of APV1-CP gene in the ZnO-dsRNA treatment group decreased by more than 50% on the 21st day. The Western Blot detection results also showed that the CP protein band in the ZnO-dsRNA treatment group was significantly weakened, further confirming that the nanonucleic acid pesticide can effectively inhibit the accumulation of APV1 virus under field conditions. Figure 15 In addition, through visual observation, the yellowing symptoms of the Areca plants in the treatment group were significantly alleviated, the leaf color returned to normal, and the plant growth was better than that in the control group. No phytotoxicity or growth inhibition was observed.

[0136] In summary, the ZnO-dsRNA nanonucleic acid pesticide constructed by the present application can significantly reduce the accumulation of APV1 virus and delay the development of the disease in the field application on virus-carrying Areca plants, and exhibits good therapeutic effect. It provides a safe and feasible field application strategy for the precise prevention and control of Areca yellowing disease.

Claims

1. A dsRNA nanoformulation for controlling yellowing disease of Areca catechu, characterized in that, consists of a dsHSP70, a dsP21, a dsP60, a dsCP, a dsCPm, a dsP26, a dsP18 and a dsP25 with a mass ratio of 1:1:1:1:1:1:1:1, the dsHSP70 consists of a nucleotide sequence as shown in SEQ ID NO. 9 and a nucleotide sequence reverse complementary to the nucleotide sequence as shown in SEQ ID NO. 9, the dsP21 consists of a nucleotide sequence as shown in SEQ ID NO. 10 and a nucleotide sequence reverse complementary to the nucleotide sequence as shown in SEQ ID NO. 10, the dsP60 consists of a nucleotide sequence as shown in SEQ ID NO. 11 and a nucleotide sequence reverse complementary to the nucleotide sequence as shown in SEQ ID NO. 11, the dsCP consists of a nucleotide sequence as shown in SEQ ID NO. 12 and a nucleotide sequence reverse complementary to the nucleotide sequence as shown in SEQ ID NO. 12, the dsCPm consists of a nucleotide sequence as shown in SEQ ID NO. 13 and a nucleotide sequence reverse complementary to the nucleotide sequence as shown in SEQ ID NO. 13, the dsP26 consists of a nucleotide sequence as shown in SEQ ID NO. 14 and a nucleotide sequence reverse complementary to the nucleotide sequence as shown in SEQ ID NO. 14, the dsP18 consists of a nucleotide sequence as shown in SEQ ID NO. 15 and a nucleotide sequence reverse complementary to the nucleotide sequence as shown in SEQ ID NO. 15, the dsP25 consists of a nucleotide sequence as shown in SEQ ID NO. 16 and a nucleotide sequence reverse complementary to the nucleotide sequence as shown in SEQ ID NO. 16; the nanocarrier is one of a layered double hydroxide, a chitosan quaternary ammonium salt or zinc oxide; when the nanocarrier is a layered double hydroxide, the mass ratio of the dsRNA mixture to the nanocarrier is 1:7; when the nanocarrier is a chitosan quaternary ammonium salt, the mass ratio of the dsRNA mixture to the nanocarrier is 2:1; when the nanocarrier is zinc oxide, the mass ratio of the dsRNA mixture to the nanocarrier is 1:

20.

2. The use of the dsRNA nanoformulation of claim 1 in the prevention and treatment of the yellowing disease of Areca catechu caused by APV1 virus in Areca catechu or Nicotiana tabacum plants. The use includes the application of the dsRNA nanoformulation by spraying, injection or root irrigation.

3. Use according to claim 2, characterized in that, The use includes the application of the dsRNA nanoformulation by spraying, injection or root irrigation.

Images