Cucumber 1k liquid breeding chip and its special single nucleotide polymorphism variation site
By using liquid-phase chip technology that combines high-throughput sequencing and multiplex PCR, specific primers and probes were designed for multiplex PCR amplification, solving the problem of amplifying multiple superior gene traits in traditional breeding techniques. This enabled rapid, accurate, and high-throughput genotyping of cucumber varieties, improving detection efficiency.
Patent Information
- Application Number
- CN202511092420.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-05
- Publication Date
- 2026-01-02
- Estimated Expiration
- 2045-08-05
AI Technical Summary
Traditional breeding techniques struggle to accurately aggregate multiple superior genetic traits, especially when dealing with complex quantitative traits such as disease resistance, stress resistance, and quality. Furthermore, given the large number of cucumber varieties, rapid, accurate, and high-throughput whole-genome genotyping is required to construct DNA fingerprint information.
Using liquid-phase chip technology that combines high-throughput sequencing and multiplex PCR, specific primers and probes were designed, and tens of thousands of probe sequences were integrated for multiplex PCR amplification. Deep sequencing was used to obtain the genotypes of single nucleotide polymorphism variant sites in the whole cucumber genome. The high-quality reference genome of cucumber 9930 was used for precise targeted design and dynamic upgrading.
It enables rapid, accurate, and high-throughput genotyping of cucumber varieties, improves sample testing efficiency, solves problems existing in traditional technologies, and has broad application prospects.
Smart Images

Figure CN120700196B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of cucumber variety identification, and particularly relates to a cucumber whole genome 1K liquid breeding chip, a single nucleotide polymorphism (SNP) variation site specially used for the chip and an application thereof. BACKGROUND
[0002] Cucumber is an important vegetable crop in China, and the cucumber yield in China accounts for 81% of the global yield. Cucumber has rich flavor, refreshing aroma, rich vitamin C and dietary fiber, and good health care effect. Cucumber is a pillar industry for adjusting industrial structure, increasing farmers' income and promoting rural economic development in most areas of China. In recent years, with the increasing demand of people for a better life, higher requirements for disease resistance, high yield and high quality of cucumber varieties have been put forward, and there is an urgent need for cucumber varieties with excellent comprehensive traits and outstanding advantage traits in production, but it is difficult to achieve precise aggregation of multiple excellent gene traits by conventional breeding technology. With the rapid development of cucumber genomics and functional gene research, more than 100 cucumber germplasm resources have completed whole genome sequencing, and the functions of more than 50 genes have been analyzed. These breakthroughs reveal the rich genetic diversity and domestication history of cucumber, laying a theoretical foundation for precise breeding. However, the small number of molecular markers (usually only dozens to hundreds) used in traditional breeding cannot meet the demand of modern gene aggregation breeding for multiple trait improvement, especially in dealing with complex quantitative traits such as disease resistance, stress resistance and quality. In addition, there are a large number of domestic cucumber varieties, and more than 2000 varieties have been applied for registration, so how to construct the DNA fingerprint information of cucumber varieties to provide technical support for the seed regulatory department to identify the variety identity and derived varieties. Therefore, a technology for quickly, accurately and high-throughput obtaining cucumber whole genome genotyping is needed.
[0003] In view of this technical bottleneck, with the continuous development of high-throughput sequencing technology and the continuous reduction of sequencing cost, a liquid chip solution of targeted sequencing technology combined with high-throughput sequencing and multiplex PCR. By designing specific primer probes for the sites to be detected, several thousand probe sequences are integrated into a single tube for multiplex PCR amplification, and the amplification products of the mixed sample are subjected to deep sequencing, and finally the genotype information of each site of different samples is obtained according to the sequencing results. This new type of molecular breeding tool has three major innovative advantages: (1) high-density marker coverage, by designing specific probe primers, tens of thousands of key variation sites can be captured at one time. (2) Precise targeting design, based on the high-quality reference genome of cucumber 9930, the gene interval of agronomic traits such as fruit size and bitterness synthesis can be accurately located. (3) Dynamic upgrade capability, compared with solid-phase chips, liquid-phase chips can flexibly update probe combinations to realize synchronous tracking of newly excavated important genotypes. In practical application, this technology significantly improves the detection efficiency of sample genotypes, can solve the problems existing in the above-mentioned traditional genotype detection technology, and has very broad application prospect. SUMMARY
[0004] In view of the defects of the prior art, the purpose of the present application is to provide a cucumber whole genome 1K liquid breeding chip and its special single nucleotide polymorphism variation site and application. The liquid breeding chip can accurately obtain the genotype of the single nucleotide polymorphism variation site of the whole genome of cucumber.
[0005] In order to achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows:
[0006] Scheme one:
[0007] A probe combination for detecting a combination of single nucleotide polymorphism variation sites (SNP sites) of the whole genome of cucumber, each single nucleotide polymorphism variation site corresponding to a probe, the combination of single nucleotide polymorphism variation sites comprising 1121 single nucleotide polymorphism variation sites, the positions and base types of the 1121 single nucleotide polymorphism variation sites in the cucumber genome being shown in Table 1 of the specification of the present application, the positions of the 1121 single nucleotide polymorphism variation sites in the genome being determined based on the cucumber 9930 reference genome V2 version, in Table 1, the left-hand digit represents the chromosome number where the single nucleotide polymorphism variation site is located, the middle numerical value represents the physical position of the chromosome where the single nucleotide polymorphism variation site is located, and the right-hand letter represents the two base types of the single nucleotide polymorphism variation site.
[0008] In the probe combination of Scheme 1 of the present invention, as a preferred embodiment, the corresponding positions of the nucleotide sequences of each probe in the probe combination in the genome are shown in Table 3 of the present invention specification. The corresponding positions are determined based on the cucumber 9930 reference genome version V2. In Table 3, the numbers to the left of "-" represent the chromosome number where the single nucleotide polymorphism variation site is located, and the data to the right of "-" represent the start position to the end position on the chromosome where the probe is located.
[0009] Option 2:
[0010] A cucumber whole genome 1K liquid phase breeding chip, comprising the probe combination described in Scheme 1 of the present invention for detecting combinations of single nucleotide polymorphism variation sites in cucumber.
[0011] The liquid-phase breeding chip targeting scheme one is used to detect single nucleotide polymorphism variation sites in cucumber to obtain base information of the polymorphic sites.
[0012] Liquid-phase breeding chips can also contain other commonly used reagents or equipment.
[0013] Option 3:
[0014] The use of the probe combination of Scheme 1 described above for detecting single nucleotide polymorphism variant sites in cucumber includes any one of the following uses (1) to (8):
[0015] (1) A kit for preparing a cucumber variety identification kit;
[0016] (2) A kit for preparing a test kit to identify the authenticity of cucumber varieties;
[0017] (3) A kit for preparing and analyzing the genetic relationships of cucumber varieties;
[0018] (4) Used for identifying cucumber varieties;
[0019] (5) Used to identify the authenticity of cucumber varieties;
[0020] (6) Used to analyze the genetic relationships of cucumber varieties;
[0021] (7) Used to identify whether the cucumber variety to be tested contains any of the 56 superior cucumber genes shown in Table 2, or which of the 56 superior cucumber genes shown in Table 2 it contains;
[0022] (8) Used to construct a fingerprint database of cucumber varieties to be tested.
[0023] Option 4:
[0024] The uses of the cucumber whole genome 1K liquid phase breeding chip in Scheme 2 above include any one of the following uses (A) to (E);
[0025] (A) for identifying cucumber varieties;
[0026] (B) for identifying authenticity of cucumber varieties;
[0027] (C) for analyzing genetic relationship of cucumber varieties;
[0028] (D) for identifying whether a to-be-tested cucumber variety contains 56 excellent cucumber genes shown in Table 2 of the specification or contains which of the 56 excellent cucumber genes shown in Table 2;
[0029] (E) for constructing a fingerprint database of to-be-tested cucumber varieties.
[0030] Scheme five:
[0031] A method for constructing a fingerprint database of a test cucumber variety, comprising the following steps:
[0032] S1-1: obtaining genomic DNA of the test cucumber variety;
[0033] S1-2: obtaining a DNA library by fragmentation, end repair, adapter ligation and purification of the genomic DNA obtained in step S1-1;
[0034] S1-3: combining the DNA library with the probe of the above-mentioned scheme one to form a hybridization system and performing hybridization capture, and obtaining a sequencing library by purification;
[0035] S1-4: sequencing and data analysis of the sequencing library to obtain genotyping information of 1121 single nucleotide polymorphism variation sites shown in Table 1 of the specification, and constructing a fingerprint database of the test cucumber variety according to the genotyping information of the 1121 single nucleotide polymorphism variation sites.
[0036] Scheme six:
[0037] A method for identifying a to-be-tested cucumber variety, comprising the following steps:
[0038] S2-1: obtaining genomic DNA of the to-be-tested cucumber variety and a standard cucumber variety, respectively;
[0039] S2-2: obtaining a DNA library of each variety by fragmentation, end repair, adapter ligation and purification of the genomic DNA of each variety obtained in step S2-1;
[0040] S2-3: combining the DNA library of each variety with the probe of the above-mentioned scheme one to form a hybridization system and performing hybridization capture, and obtaining a sequencing library of each variety by purification;
[0041] S2-4: sequencing and data analysis of the sequencing library of each variety to obtain the genotyping information of 1121 single nucleotide polymorphism variation sites in each variety shown in Table 1 in the specification of the present application;
[0042] S2-5: comparing the genotyping results of 1121 single nucleotide polymorphism variation sites of the to-be-tested cucumber variety with the genotyping results of 1121 single nucleotide polymorphism variation sites of the standard cucumber variety, respectively, and counting the similarity LS of the single nucleotide polymorphism variation sites of the two cucumber varieties, wherein:
[0043] The calculation formula of LS is: LS=(1-D / T)×100%, wherein D is the number of different single nucleotide polymorphism variation sites between the two compared varieties, and T is the total number of single nucleotide polymorphism variation sites compared;
[0044] Then the following judgment is made:
[0045] If the site similarity of the to-be-tested cucumber variety and a certain standard cucumber variety is ≥97.0%, the to-be-tested cucumber variety and the standard cucumber variety are the same variety or suspected to be the same variety; the fewer the number of different sites, the higher the variety similarity;
[0046] If the site similarity of the to-be-tested cucumber variety and a certain standard cucumber variety is between 95.0% and 97.0% and does not include 97%, the to-be-tested cucumber variety and the standard cucumber variety are approximate varieties;
[0047] If the site similarity of the to-be-tested cucumber variety and a certain standard cucumber variety is <95.0%, the to-be-tested cucumber variety and the standard cucumber variety are different varieties.
[0048] The standard cucumber variety in the present application refers to a known cucumber variety, such as the 96 cucumber varieties recorded in Table 4 in the present application.
[0049] In the construction method of the fingerprint database of the test cucumber variety of the above-mentioned scheme five or the identification method of the to-be-tested cucumber variety of the above-mentioned scheme six, as an implementable manner, in step S1-2 or S2-2, the fragmentation and end repair are completed by a system containing fragmentation and end repair enzymes, and the system is: 300 ng DNA, 2.6 μL of fragmentation and end repair enzymes, 4 μL of end repair reaction buffer, and the system is supplemented to 20 μL with ultrapure water.
[0050] In the method for constructing the fingerprint database of the test cucumber variety in the above-mentioned scheme five or the method for identifying the to-be-tested cucumber variety in the above-mentioned scheme six, as an implementable manner, in step S1-2 or S2-2, the reaction system of the adapter connection is 10 ng of the DNA after end repair, 2 μL of DNA ligase, 8 μL of buffer, 4 μL of Illumina trueseq universal adapter sequence, and the rest is supplemented with ultrapure water to 20 μL.
[0051] In the method for constructing the fingerprint database of the test cucumber variety in the above-mentioned scheme five or the method for identifying the to-be-tested cucumber variety in the above-mentioned scheme six, as an implementable manner, in step S1-3 or S2-3, the hybridization system is 2.5 μg of the DNA library obtained after concentration in step S2-2, 4 μL of probe working solution with a concentration of 50 ng / μL, and the rest is supplemented with ultrapure water to 16 μL.
[0052] The beneficial effects of the present application are as follows:
[0053] (1) The SNP site combination provided by the present application has the advantages of high polymorphism, good repeatability, uniform distribution on the chromosome, stable and reliable marker, and convenience for statistics, and can accurately reflect the genetic relationship of the test cucumber variety.
[0054] (2) The SNP site combination involved in the liquid breeding chip of the present application covers a more extensive cucumber variety, is representative, and has rich diversity information.
[0055] (3) The 1K liquid breeding chip provided by the present application can be applied to the authenticity identification, genetic relationship identification, hybrid breeding and fingerprint construction of cucumber varieties, and is conducive to accelerating the process of cucumber research and breeding.
[0056] (4) The present application provides, for the first time, a method for constructing a DNA fingerprint database for identifying the authenticity of cucumber varieties based on high-throughput sequencing, which can be used for early identification of cucumber varieties at the seed or seedling stage, ensuring the authenticity of the varieties, protecting the rights and interests of producers and breeders, and providing technical support for cucumber germplasm resources and new variety protection.
[0057] (5) The method for identifying the cucumber variety provided by the present application can identify unknown cucumber varieties and identify the authenticity of known varieties.
[0058] (6) The method provided by the present application has the advantages of high throughput, accuracy, low cost, simple operation, saving of manpower and material resources, and has a very broad application prospect. BRIEF DESCRIPTION OF DRAWINGS
[0059] Figure 1 Figure 1 is a distribution diagram of the SNP sites of the 1K liquid breeding chip of the present application on the cucumber genome.
[0060] Figure 2 Genotype missing rate of 1K liquid breeding chip of the application in 96 representative cucumber varieties.
[0061] Figure 3 Genotype MAF value of 1K liquid breeding chip of the application in 96 representative cucumber varieties.
[0062] Figure 4 Analysis result of 1K liquid breeding chip of the application on the carrying of excellent genes of 96 cucumber varieties.
[0063] Figure 5 Distribution diagram of background recovery rate of 128 single plants in BC2F1 population by 1K liquid breeding chip of the application. DETAILED DESCRIPTION
[0064] The following examples and drawings are provided for better understanding of the present application, which are detailed explanations and descriptions of certain aspects or certain features of the present application, and do not constitute limitations of the present application.
[0065] Unless otherwise specified, the technical and scientific terms described in the present application are the usual meanings in the art.
[0066] Improvements or technical application extensions made to the embodiments of the present application without departing from the spirit or scope of the present application are within the protection scope of the present application.
[0067] The experimental methods in the following examples are all routine methods unless otherwise specified. For the liquid chip application method not described in detail in the specification, refer to (Targeted Sequencing Genotype Detection (GBTS) Technology and Its Application, 2020).
[0068] The test materials used in the following examples are all purchased from routine biochemical reagent stores unless otherwise specified. The quantitative tests in the following examples all set three repeated experiments, and the results are averaged.
[0069] Example 1, Acquisition of 1K Liquid Breeding Chip SNP Sites of Cucumber Whole Genome
[0070] The present application is based on 182 cucumber resequencing data disclosed in the vegetable whole genome SNP variation big data platform VegSNPDB (www.vegsnpdb.cn), and high-quality SNP sites which can represent the whole genome genetic information and are suitable for targeted sequencing are screened. Specifically, the SNP screening criteria are as follows: the minimum allele frequency MAF is greater than 0.15, the genotype heterozygosity is less than 0.1, the genotype deletion rate is less than 0.1, and there is no other, SSR and Indel variation in the 50bp wings of the SNP. In addition, 13 cucumber mitochondrial SNP variations and 56 key SNP variations linked to important agronomic traits screened by the team are combined. Finally, the inventors of the present application screen 1121 SNP sites uniformly distributed on the whole genome of cucumber for cucumber 1K liquid breeding chip, which has a high polymorphism information content (PIC value). The positions of the 1121 SNP sites on the chromosomes and the variation bases are shown in Table 1, and the distribution of the 1121 SNP sites on the 7 chromosomes of cucumber is shown in Figure 1. Figure 1 The base types and physical positions of the above-mentioned SNP sites on the chromosomes are determined based on the cucumber 9930 reference genome (Long_genome_v2.fa.gz).
[0071] The SNP sites involved in the cucumber 1K breeding liquid chip are uniformly distributed on the chromosomes, with an average interval physical distance of 170.6kb, a maximum interval distance of 610.1kb, and 36.4% of the variation sites located in the gene exon region.
[0072] Table 1. Positions of 1121 SNP variations on chromosomes and base information
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079] Note: In the SNP site information, the data on the left side of the "_" is the chromosome where the SNP is located, the middle numerical value is the physical position of the SNP on the chromosome, and the numerical value on the right side of the "_" is the two genotypes of the SNP variation.
[0080] The important functional genes and variation information of cucumber involved in the cucumber 1K liquid breeding chip of the present application are shown in Table 2.
[0081] Table 2 Important functional genes and variation information in cucumber 1K liquid breeding chip
[0082]
[0083]
[0084] Example 2, Preparation of probes for cucumber 1K liquid breeding chip
[0085] The cucumber 1K liquid breeding chip includes 1121 probe combinations, each probe hybridizes with a SNP site region to form a double strand. According to the principle of base complementary pairing, the oligonucleotide probe complementary to the target sequence is designed, wherein the probe combination design principle is as follows:
[0086] (1) The length of the probe is 190 bp on average, the SNP is in the middle position of the probe, and the two wing sequences are 90-100 bp;
[0087] (2) The region where the probe is located is relatively conservative (50 bp of both wings have no other variations), avoiding regions such as repeat sequences and structural variations;
[0088] (3) The GC content of the probe is 40%-60%, among which the region at 50% has stronger capture ability, avoiding high GC and high AT regions.
[0089] The unknown information of 1121 probes in the cucumber 1K liquid breeding chip is shown in Table 3.
[0090] The probe sequence in Table 3 is synthesized by single-stranded nucleotides, with a length of 109 bp to 220 bp, an average of 190 bp, a 5' end modified with a biotin group, and a biotin covalently coupled polystyrene microsphere.
[0091] Table 3 Probe position information of cucumber 1K liquid breeding chip
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098] Note: In the SNP site information, the data on the left side of "-" is the chromosome where the SNP is located, and the numerical value on the right side of "-" is the starting and ending position of the probe on the chromosome.
[0099] Example 3, genotype detection efficiency evaluation of cucumber 1K liquid breeding chip
[0100] A cucumber whole genome 1K liquid breeding chip involves SNP sites listed in Table 1 in the above-mentioned Example 1, and the liquid breeding chip includes the probe combination in Example 2. Among them, 1121 SNP sites correspond to 1121 probes, and each probe is hybridized with a SNP site to form a double strand.
[0101] To evaluate the genotype capture efficiency of 1121 SNP sites, 96 cucumber hybrid varieties collected from China were subjected to SNP genotyping using the cucumber 1K liquid breeding chip of the application.
[0102] The basic information of the 96 test cucumber varieties in this example is shown in Table 4. The 96 test cucumber varieties are all excellent varieties commonly used in production or some foreign introduced varieties.
[0103] Table 4. Information of 96 cucumber varieties
[0104]
[0105]
[0106] The detection experiment method of the cucumber 1K liquid breeding chip includes the following specific steps: obtaining genomic DNA, library construction, hybrid capture, sequencing and data analysis, etc.
[0107] 1. Obtaining genomic DNA of the test cucumber varieties
[0108] The genomic DNA of the 96 test cucumber varieties was extracted from the leaves using SDS and magnetic bead method, and the genomic DNA of the test cucumber varieties was obtained.
[0109] The quality and concentration of the genomic DNA of the test cucumber varieties must meet the PCR requirements, and the standard is that 1% agarose electrophoresis shows that the DNA band is single and has no obvious dispersion; the A260 / A230 ratio detected by ultraviolet spectrophotometer Nanodrop2000 (Thermo) is greater than 2.0, and the A260 / A280 ratio is about 1.8; the concentration of the genomic DNA of the test cucumber varieties is >50 ng / μL.
[0110] 2. Library construction
[0111] Take 300 ng of DNA that passes the quality inspection, add 2.6 μL of fragmentation and end repair enzyme, 4 μL of end repair reaction buffer, and make up the system to 20 μL with ultrapure water. Then treat at 37℃ for 30 min and at 72℃ for 30 min. After the DNA is fragmented and repaired by the end repair enzyme, A will be added to the 3' end.
[0112] Using the repaired DNA of 10 ng, DNA ligase 2 μL, buffer 8 μL, Illuminatrueseq universal adapter sequence (AATGATACGGCGACCACCGAGATCTACAC, sequence 1) 4 μL, and ultrapure water to make up to 20 μL, 22 ℃ for 60 min. The A-added DNA fragments are connected with the adapter, and the Index and the adapter sequence of the sequencer are connected to the ends of the DNA fragments containing the adapter to form a complete library structure. The library is purified and the fragments are selected by adding purified magnetic beads and mixing by vortexing. The purified and selected fragments are mixed in equal amounts to form a mixed library.
[0113] 3. Hybridization capture
[0114] The mixed library is concentrated to a dry powder state, and then added to a hybridization system for hybridization capture. The concentrated library 2.5 μg, 4 μL of probe working solution with a concentration of 50 ng / μL, ultrapure water to make up the system to 16 μL, 95 ℃ for 10 min, 65 ℃ for 2-4 h. After hybridization, 16 μL of hybridization capture liquid is transferred to the prepared magnetic beads. The enriched product is purified to complete the preparation of the sequencing library.
[0115] 4. Sequencing and data analysis
[0116] The purified product is mixed in equal amounts to obtain a sequencing library, and a Huada T7 sequencer is used for high-throughput sequencing. According to the barcode of different samples, the original sequencing bases are data split, low-quality sequencing data is filtered, and the SNP variation information is mined. According to the obtained SNP information, the corresponding SNP genotype is obtained, and thus the fingerprint of the test variety is constructed.
[0117] 5. Efficiency evaluation
[0118] After testing 96 test cucumber samples, the genotype data detection rate of the cucumber 1K liquid breeding chip is 99.2% on average ( Figure 2 ).
[0119] By statistically analyzing the minimum allele frequency (MAF) of 1121 SNPs, the MAF values of 89.6% of the SNP sites are greater than 0.05, and the average MAF value is 0.33 ( Figure 3 ), indicating that the cucumber 1K liquid breeding chip developed by the application has high polymorphism in the 96 test cucumber varieties.
[0120] Example 4, evaluation of the number of 96 cucumber varieties carrying excellent alleles
[0121] The cucumber 1K liquid breeding chip developed by the application can be used for identifying whether the tested varieties contain 56 known excellent genes of cucumber or which of the 56 known excellent genes of cucumber are contained.
[0122] According to the SNP information of the 96 tested cucumber varieties obtained according to embodiment 3 and the linkage variation of the excellent genes listed in table 2 and the correspondence relationship of the SNPs in embodiment 1, the number of excellent genes carried by the 96 cucumber varieties can be quickly obtained (see table 3). Figure 4 ), which provides data support for precision gene breeding.
[0123] Embodiment 5, method for detecting whether the tested cucumber variety belongs to one of the 96 tested cucumber varieties
[0124] 1, obtaining of the genomic DNA of the tested cucumber variety
[0125] The leaves of the tested cucumber variety “Jingyanbaixingling” were taken from the test base of the Institute of Vegetables, Beijing Academy of Agriculture and Forestry Sciences.
[0126] According to the method of step 1 in embodiment 3, the “leaves of the tested cucumber variety” is replaced by “leaves of the tested cucumber variety”, and the other steps are unchanged, to obtain the genomic DNA of the tested cucumber variety.
[0127] 2, preparation of the sequencing library
[0128] According to the method of step 2 in embodiment 3, the “genomic DNA of the tested cucumber variety” is replaced by “genomic DNA of the tested cucumber variety”, and the other steps are unchanged, to obtain the sequencing library of the tested cucumber variety.
[0129] 3, hybrid capture
[0130] According to the method of step 3 in embodiment 3.
[0131] 4, sequencing
[0132] Take the sequencing library of the tested cucumber variety and sequence it.
[0133] Compare the sequencing results of the 1121 SNP amplification products of the tested cucumber variety in the cucumber 1K liquid breeding chip with the 1121 SNP sites of the 96 tested cucumber varieties (shown in table 4), and calculate the site similarity LS between the two cucumber varieties, wherein:
[0134] The calculation formula of LS is: LS=(1-D / T)×100%, wherein D is the number of difference sites between the two samples compared, and T is the total number of comparison sites.
[0135] Then the following judgment is made:
[0136] If the site similarity of the to-be-tested cucumber variety and a certain standard cucumber variety (test cucumber variety) is greater than or equal to 97.0%, the to-be-tested cucumber variety and the standard cucumber variety are suspected to be the same variety; the fewer the number of difference sites, the higher the site similarity;
[0137] If the site similarity of the to-be-tested cucumber variety and a certain standard cucumber variety (test cucumber variety) is between 95.0% and 97.0% and does not include 97%, the to-be-tested cucumber variety and the standard cucumber variety are approximate varieties.
[0138] If the site similarity of the to-be-tested cucumber variety and a certain standard cucumber variety is less than 95.0%, the to-be-tested cucumber variety and the standard cucumber variety are different varieties.
[0139] The results show that the genetic similarity of the to-be-tested cucumber variety and the 96 test cucumber varieties is 94% at 1121 SNP sites, so the to-be-tested cucumber variety does not belong to any of the 96 test cucumber varieties, that is, the to-be-tested cucumber variety "Jingyanbaixingling" is not the same as any of the 96 test cucumber varieties.
[0140] Example 6, constructing a DNA fingerprint database of 96 cucumber varieties
[0141] The cucumber 1K liquid breeding chip developed by the application can be used to construct a DNA fingerprint database of 96 cucumber varieties, and establish a unique DNA fingerprint molecular identity card for each variety resource.
[0142] According to the 1121 nucleotide variation information in Example 1 and the 96 test cucumber varieties in Example 3, the method of Example 3 can quickly construct a DNA fingerprint database of 96 cucumber varieties, and provide data support for whether the newly collected variety resources are introduced into the DNA fingerprint database in the future.
[0143] Example 7, screening single plants with rapid background recovery in backcross breeding
[0144] The cucumber 1K liquid breeding chip developed by the application can be used to identify and quickly determine the genome percentage of the donor and the receptor in each single plant of the backcross breeding offspring, and provide data support for screening backcross offspring with high background recovery rate.
[0145] According to the 1121 nucleotide variation information in Example 1, the genotypes of 128 single plants of the BC2F1 population constructed by the donor parent HZ257 and the recurrent parent HT109 are identified at the seedling stage, 592 SNP variations existing between the donor parent and the recurrent parent are screened, the proportion of the recurrent parent genotype in the 128 single plants is calculated, and the recurrent parent genotype accounts for 95% as the selection standard for recovering the recurrent parent background, and finally 2 single plants are selected Figure 5), and its field phenotype has no significant difference with the recurrent parent, which significantly improves the identification efficiency and saves the field planting cost.
Claims
1. A probe array for detecting combinations of single nucleotide polymorphism (SNP) variant sites in cucumber, wherein each SNP corresponds to one probe, the SNP combination consisting of 1,121 SNPs, the locations and base types of the 1,121 SNPs in the cucumber genome being shown in Table 1 of the specification, wherein... The numbers on the left indicate the chromosome number where the single nucleotide polymorphism (SNP) variant site is located, the numbers in the middle indicate the physical location of the SNP variant site on the chromosome, and the letters on the right indicate the two base types of the SNP variant site. The corresponding positions of the nucleotide sequences of each probe in the probe combo in the genome are shown in Table 3 of the specification. The numbers to the left of "-" represent the chromosome number where the single nucleotide polymorphism variation site is located, and the data to the right of "-" represent the start position to the end position on the chromosome where the probe is located. The positions of the nucleotide sequences of each probe in the genome for the 1,121 single nucleotide polymorphism variant sites and probe combinations were determined based on the cucumber 9930 reference genome version V2.
2. A cucumber liquid-phase breeding chip, characterized in that, This includes the probe combination for detecting combinations of single nucleotide polymorphism variant sites in cucumber as described in claim 1.
3. The use of a probe assembly, characterized in that, The probe combination is the probe combination for detecting single nucleotide polymorphism variant sites in cucumber as described in claim 1, and the use includes any one of the following (1) to (8): (1) A kit for preparing a cucumber variety identification kit; (2) A kit for preparing a test kit to identify the authenticity of cucumber varieties; (3) A kit for preparing and analyzing the genetic relationships of cucumber varieties; (4) Used for identifying cucumber varieties; (5) Used to identify the authenticity of cucumber varieties; (6) Used to analyze the genetic relationships of cucumber varieties; (7) Used to identify whether the cucumber variety to be tested contains single nucleotide polymorphism (SNP) variation sites of the fifty-six superior cucumber genes or which of the fifty-six superior cucumber genes contain SNP variation sites. The location, gene ID, associated traits and base variation types of the SNP variation sites of the fifty-six superior cucumber genes on the chromosome are shown in Table 2 of the specification. (8) Used to construct a fingerprint database of cucumber varieties to be tested.
4. The application of a cucumber liquid-phase breeding chip, characterized in that, The liquid phase breeding chip is the cucumber liquid phase breeding chip according to claim 2, and the use includes any one of the following (A) to (E); (A) Used for identifying cucumber varieties; (B) Used to identify the authenticity of cucumber varieties; (C) Used to analyze the genetic relationships of cucumber varieties; (D) Used to identify whether the cucumber variety to be tested contains single nucleotide polymorphism (SNP) variation sites of the fifty-six superior cucumber genes or which of the fifty-six superior cucumber genes contain SNP variation sites. The location, gene ID, associated traits, and base variation type of the SNP variation sites of the fifty-six superior cucumber genes on the chromosome are shown in Table 2 of the specification. (E) Used to construct a fingerprint database of the cucumber varieties to be tested.
5. A method for constructing a fingerprint database of tested cucumber varieties, characterized in that, Includes the following steps: S1-1: Obtain genomic DNA from the tested cucumber variety; S1-2: The genomic DNA obtained in step S1-1 is fragmented, end-repaired, adapter-ligated, and purified to obtain a DNA library; S1-3: The DNA library is combined with the probes described in claim 1 for detecting combinations of single nucleotide polymorphism variant sites in cucumber to form a hybridization system and hybridization capture is performed. The resulting sequencing library is then purified. S1-4: Sequencing and data analysis of the sequencing library to obtain the genotyping information of the 1,121 single nucleotide polymorphism (SNP) variant sites as described in claim 1, and constructing a fingerprint database of the tested cucumber varieties based on the genotyping information of the 1,121 SNP variant sites.
6. A method for identifying a cucumber variety to be tested, characterized in that, Includes the following steps: S2-1: Obtain genomic DNA from the cucumber variety to be tested and the standard cucumber variety, respectively; S2-2: The genomic DNA of each variety obtained in step S2-1 is broken, end-repaired, adapter-ligated, and purified to obtain the DNA library of the corresponding variety; S2-3: The DNA libraries of each variety are combined with the probes described in claim 1 for detecting combinations of single nucleotide polymorphism variant sites in cucumber to form a hybridization system and perform hybridization capture. The sequencing libraries of each variety are then purified. S2-4: Sequencing and data analysis of the sequencing libraries of each variety to obtain the genotyping information of 1,121 single nucleotide polymorphism variant sites in each variety as described in Table 1 of the specification. S2-5: Compare the genotyping results of 1,121 single nucleotide polymorphism (SNP) variants in the tested cucumber variety with the genotyping results of 1,121 SNP variants in the standard cucumber variety, and calculate the SNP similarity LS between the two cucumber varieties. The formula for calculating LS is: LS = (1-D / T)×100%, where D is the number of differentially expressed SNP variants between the two varieties, and T is the total number of SNP variants compared. Then, the following judgments are made: If the similarity of the single nucleotide polymorphism variant sites between the cucumber variety to be tested and a certain standard cucumber variety is greater than or equal to 97.0%, then the cucumber variety to be tested and the standard cucumber variety are the same variety. If the similarity of the single nucleotide polymorphism variation sites between the tested cucumber variety and a certain standard cucumber variety is between 95.0% and 97.0% but does not include 97%, then the tested cucumber variety and the standard cucumber variety are similar varieties. If the similarity of the single nucleotide polymorphism variant sites between the cucumber variety to be tested and a certain standard cucumber variety is less than 95.0%, then the cucumber variety to be tested and the standard cucumber variety are different varieties.
7. The method for identifying the cucumber variety to be tested according to claim 6, characterized in that, In step S2-2, the fragmentation and end repair are performed using a system containing fragmentation and end repair enzymes. The system consists of: 300 ng DNA, 2.6 μL fragmentation and end repair enzymes, 4 μL end repair reaction buffer, and ultrapure water to bring the total volume to 20 μL.
8. The method for identifying the cucumber variety to be tested according to claim 6, characterized in that, In step S2-2, the reaction system for adapter ligation consists of 10 ng of end-repaired DNA, 2 μL of DNA ligase, 8 μL of buffer, 4 μL of Illumina TrueSeq universal adapter sequence, and ultrapure water to a final volume of 20 μL.
9. The method for identifying the cucumber variety to be tested according to claim 6, characterized in that, In step S2-3, the hybridization system consists of 2.5 μg of concentrated DNA library obtained in step S2-2, 4 μL of probe working solution with a concentration of 50 ng / μL, and ultrapure water to make up the system to 16 μL.
Citation Information
Patent Citations
Melon SNP site marker combination, SNP site marker detection probe combination, liquid phase chip and application
CN117210596A
Cucumber whole genome SNP site combination, liquid phase chip and application of cucumber whole genome SNP site combination and liquid phase chip
CN119662883A