A SNP molecular marker related to gossypium hirsutum yellow wilt resistance and application thereof

By screening SNP molecular markers and KASP primer sets associated with resistance to Verticillium wilt in upland cotton through genome-wide association analysis, the problem of insufficient in-depth analysis of the genetic basis of resistance to Verticillium wilt in upland cotton was solved, enabling early prediction and efficient breeding, and improving breeding efficiency and accuracy.

CN120700199BActive Publication Date: 2026-03-03SANYA NATIONAL INSTITUTE OF SOUTHERN BREEDING CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511212537.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-28
Publication Date
2026-03-03
Estimated Expiration
2045-08-28

AI Technical Summary

Technical Problem

Current technologies have not provided in-depth analysis of the genetic basis of Verticillium wilt resistance in upland cotton. Traditional breeding methods are inefficient and highly susceptible to environmental influences, making it difficult to meet the demands of modern agriculture for superior disease-resistant varieties. Verticillium wilt resistance is a complex quantitative trait controlled by multiple genes, and key genes and genetic loci have not been fully explored.

Method used

Genome-wide association analysis (GWAS) was used to screen for SNP molecular markers associated with resistance to Verticillium wilt in upland cotton, providing molecular marker 1, molecular marker 2, and molecular marker 3. Corresponding KASP primer sets were developed to identify the level of resistance to Verticillium wilt in upland cotton. Early prediction and material screening were achieved through PCR amplification and genotyping.

Benefits of technology

It enables early prediction and efficient screening of resistance to Verticillium wilt in upland cotton, improving breeding efficiency. It can be detected at various tissues and developmental stages, is not limited by environmental conditions, is suitable for rapid, large-scale and automated screening, and supports molecular marker-assisted selection breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120700199B_ABST
    Figure CN120700199B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of plant molecular biology, and particularly relates to a SNP molecular marker related to resistance of upland cotton to verticillium wilt and application thereof. The SNP molecular marker provided by the present application is significantly related to resistance of upland cotton to verticillium wilt, directly expressed in the form of DNA, and can be detected in various tissues and development stages of upland cotton, is not limited by environmental conditions, planting seasons and growth states of plants, is not influenced by factors such as whether genes are expressed, does not need to analyze fragment length, and is suitable for rapid, large-scale and automatic screening. The SNP molecular marker provided by the present application can be used for identifying resistance of upland cotton to verticillium wilt, realizing early prediction of the verticillium wilt resistance of upland cotton, and can also be used for genetic background analysis of upland cotton related to resistance to verticillium wilt, screening of disease-resistant materials, and molecular marker assisted selection breeding of the verticillium wilt resistance site of upland cotton, and has wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant molecular biology, and in particular to a SNP molecular marker associated with resistance to Verticillium wilt in upland cotton and its application. Background Technology

[0002] Upland cotton is the most widely planted and highest-yielding cotton variety in the world, occupying a core position in the global textile and agricultural economies. Its fiber quality and yield directly affect the development of related industries and farmers' economic benefits. However, Verticillium wilt, a soil-borne fungal disease caused by Verticillium dahliae, is characterized by its wide spread, severe damage, and difficulty in control, making it one of the major bottlenecks restricting the sustainable development of the upland cotton industry. Verticillium wilt causes yellowing, wilting, and shedding of leaves in upland cotton plants, and in severe cases, it can lead to the death of the entire plant, significantly reducing fiber yield and quality, causing huge economic losses to global cotton production every year.

[0003] Current research on upland cotton covers multiple aspects such as yield and fiber quality, but the genetic basis of Verticillium wilt resistance remains insufficiently analyzed. Traditional disease-resistant breeding methods rely on phenotypic identification, which suffers from drawbacks such as long cycles, low efficiency, and significant susceptibility to environmental influences, making it difficult to meet the urgent needs of modern agriculture for superior disease-resistant varieties. Furthermore, Verticillium wilt resistance is a complex quantitative trait controlled by multiple genes, with a complex genetic mechanism. Key genes and genetic loci have not yet been fully explored, which significantly limits the progress of molecular breeding for disease resistance in upland cotton.

[0004] Genome-wide association analysis (GWAS), as a highly efficient genetic research method, can rapidly screen genetic variations significantly associated with target traits across the entire genome. This method does not require the construction of specialized genetic populations; it can directly utilize the rich genetic diversity of natural populations to locate multiple loci influencing complex traits. It provides precise molecular markers and candidate gene information for elucidating the genetic basis of traits, thus laying the foundation for the application of modern breeding technologies such as marker-assisted breeding and gene editing. Given the severe damage of Verticillium wilt to the cotton industry and the limitations of existing research, using genome-wide association analysis to identify SNP molecular markers associated with Verticillium wilt resistance in upland cotton will help to deeply elucidate the genetic mechanisms of upland cotton Verticillium wilt resistance, provide reliable molecular markers for the screening and identification of disease-resistant upland cotton materials, and provide strong technical support for conducting marker-assisted selection breeding for Verticillium wilt resistance. This has significant theoretical and practical value for accelerating the breeding of new upland cotton varieties with high resistance to Verticillium wilt and ensuring the stable development of the cotton industry. Summary of the Invention

[0005] The purpose of this invention is to provide a SNP molecular marker associated with resistance to Verticillium wilt in upland cotton and its application, thereby addressing the problems existing in the prior art. The SNP molecular marker provided by this invention is associated with the incidence of Verticillium wilt in upland cotton and can be used to identify the disease's occurrence, enabling early prediction of resistance potential.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides an SNP molecular marker associated with resistance to Verticillium wilt in upland cotton, wherein the molecular marker includes one or more of molecular marker 1, molecular marker 2 and molecular marker 3;

[0008] The nucleotide sequence of the molecular marker 1 is shown in SEQ ID NO.1, and there is a C / T base mutation at the 25th base of the nucleotide sequence;

[0009] The nucleotide sequence of the molecular marker 2 is shown in SEQ ID NO.2, and there is an A / G base mutation at the 23rd base of the nucleotide sequence;

[0010] The nucleotide sequence of the molecular marker 3 is shown in SEQ ID NO.3, and there is a T / C base mutation at the 24th base of the nucleotide sequence.

[0011] The present invention provides a set of KASP primers for amplifying the above-mentioned SNP molecular markers, wherein the set of KASP primers includes one or more sets of KASP primers for amplifying molecular marker 1, KASP primers for amplifying molecular marker 2, and KASP primers for amplifying molecular marker 3.

[0012] The KASP primer set used to amplify molecular marker 1 includes an allele-specific primer X with a nucleotide sequence such as SEQ ID NO.4, an allele-specific primer Y with a nucleotide sequence such as SEQ ID NO.5, and a common primer R with a nucleotide sequence such as SEQ ID NO.6;

[0013] The KASP primer set used to amplify molecular marker 2 includes allele-specific primer X with nucleotide sequence such as SEQ ID NO.7, allele-specific primer Y with nucleotide sequence such as SEQ ID NO.8, and common primer R with nucleotide sequence such as SEQ ID NO.9;

[0014] The KASP primer set used to amplify molecular marker 3 includes allele-specific primer X with nucleotide sequence such as SEQ ID NO. 10, allele-specific primer Y with nucleotide sequence such as SEQ ID NO. 11, and common primer R with nucleotide sequence such as SEQ ID NO. 12.

[0015] This invention provides the application of the above-mentioned KASP primer set in the preparation of products for identifying the resistance level of upland cotton to Verticillium wilt.

[0016] Preferably, the product includes reagents, reagent kits, or chips.

[0017] This invention provides a product for identifying the level of resistance to Verticillium wilt in upland cotton, the product comprising the aforementioned KASP primer set.

[0018] Preferably, the product includes reagents, reagent kits, or chips.

[0019] This invention provides the application of the above-mentioned SNP molecular markers, the above-mentioned KASP primer sets, or the above-mentioned products in identifying the level of resistance to Verticillium wilt in upland cotton.

[0020] This invention provides a method for identifying the level of resistance to Verticillium wilt in upland cotton, comprising:

[0021] Using the genome of the upland cotton sample to be tested as a template, the template was amplified by PCR using the above-mentioned KASP primer set, and genotyping was performed based on the amplification results.

[0022] Preferably, if the genotyping result of molecular marker 1 is CC, the upland cotton to be tested is determined to be an upland cotton variety with high resistance to Verticillium wilt; if the genotyping result is TT, the upland cotton to be tested is determined to be an upland cotton variety with low resistance to Verticillium wilt.

[0023] If the genotyping result of molecular marker 2 is AA, the upland cotton to be tested is determined to be an upland cotton variety with high resistance to Verticillium wilt; if the genotyping result is GG, the upland cotton to be tested is determined to be an upland cotton variety with low resistance to Verticillium wilt.

[0024] If the genotyping result of molecular marker 3 is TT, the upland cotton to be tested is determined to be an upland cotton variety with high resistance to Verticillium wilt; if the genotyping result is CC, the upland cotton to be tested is determined to be an upland cotton variety with low resistance to Verticillium wilt.

[0025] This invention provides the application of the above-described SNP molecular markers, the above-described KASP primer sets, or the above-described products in any of the following:

[0026] (1) Screening or predicting upland cotton varieties with high resistance to Verticillium wilt;

[0027] (2) Improve upland cotton germplasm resources;

[0028] (3) Upland cotton breeding.

[0029] The present invention discloses the following technical effects:

[0030] The SNP molecular markers provided by this invention, which are significantly associated with Verticillium wilt resistance in upland cotton, are directly expressed in DNA form and can be detected in all tissues and developmental stages of upland cotton. They are not limited by environmental conditions, planting season, or plant growth status, nor are they affected by factors such as gene expression. They do not require fragment length analysis, making them suitable for rapid, large-scale, and automated screening. Furthermore, the SNP molecular markers provided by this invention can be used to identify the incidence of Verticillium wilt in cotton materials under test; materials with lower incidence rates have higher economic value.

[0031] The SNP molecular markers provided by this invention can be used to identify the level of resistance to Verticillium wilt in upland cotton, enabling early prediction of the resistance of upland cotton to Verticillium wilt. They can also be used for genetic background analysis related to resistance to Verticillium wilt in upland cotton and screening of disease-resistant materials, as well as marker-assisted selection breeding of resistance loci in upland cotton, and have broad application prospects.

[0032] The SNP molecular markers provided by this invention can be applied to the fine mapping, cloning, and genome-wide selection of upland cotton Verticillium wilt resistance-related genes, thereby improving the efficiency and accuracy of molecular breeding for upland cotton resistant to Verticillium wilt and accelerating the breeding process of new upland cotton varieties with high resistance to Verticillium wilt. Attached Figure Description

[0033] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0034] Figure 1 Manhattan plots (A and C) and QQ plots (B and D) were obtained from genome-wide association analysis of the incidence trait of Verticillium wilt in upland cotton.

[0035] Figure 2 This is an LD block analysis diagram targeting the incidence of cotton Verticillium wilt on chromosome A10;

[0036] Figure 3 This is a haplotype analysis diagram of the incidence rate of Verticillium wilt in cotton on chromosome A10; where A represents the haplotype classification results of the VWA10 interval (A10:102184052-102549983); B represents the incidence rate survey results of two haplotypes of Verticillium wilt in cotton in 2018; C represents the incidence rate survey results of two haplotypes of Verticillium wilt in cotton in 2019; **** represents P<0.0001;

[0037] Figure 4 This is the genotyping diagram of molecular marker 1 in Example 4;

[0038] Figure 5 This is the genotyping diagram of molecular marker 2 in Example 4;

[0039] Figure 6 This is the genotyping diagram of molecular marker 3 in Example 4. Detailed Implementation

[0040] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0041] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0042] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0043] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0044] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0045] Example 1

[0046] 1. Cotton experimental materials and survey of cotton Verticillium wilt incidence rate

[0047] The natural cotton germplasm used was provided by the Cotton Research Institute of the Chinese Academy of Agricultural Sciences, including 383 core upland cotton germplasm accessions, as shown in Tables 1-4.

[0048] Table 1 Core germplasm of upland cotton

[0049]

[0050] Table 2 Core germplasm of upland cotton

[0051]

[0052] Table 3 Core germplasm of upland cotton

[0053]

[0054] Table 4 Core germplasm of upland cotton

[0055]

[0056] All 383 accessions were planted in Kuitun, Xinjiang in 2018 and 2019, respectively, using a randomized block design and designated KT18 and KT19, with two replicates for each material. Field management, including irrigation, pesticide spraying, and pruning of cotton fruiting branches, was conducted according to the standard management practices for cotton growth stages at each ecological site.

[0057] Incidence survey of Verticillium wilt on cotton leaves. The incidence survey of Verticillium wilt in cotton was conducted in accordance with the Technical Specification for Identification of Resistance to Verticillium wilt in Cotton (NY / T 2952—2016). The incidence rate of Verticillium wilt in cotton was surveyed in August each year when the disease was at its most severe.

[0058] The main symptoms of Verticillium wilt in cotton in the field are leaf blight and yellow spot. The leaves develop palmate yellow streaks, the leaf tissue turns yellow and only the veins remain green, and watermelon rind-like mottling appears. Sometimes leaf blight also occurs, leading to leaf withering, shedding, and death of the cotton plant.

[0059] Statistical analysis of survey results: Calculate the incidence rate of each variety based on the survey results.

[0060] Incidence rate refers to the percentage of diseased cotton seedlings out of the total number of cotton seedlings. The incidence rate is expressed as a percentage (%) and is calculated using the following formula:

[0061] R i= n i / n t ×100;

[0062] In the formula: R i —Incidence rate; n i —Number of diseased plants; n t —Total number of plants.

[0063] The calculation result is accurate to two decimal places.

[0064] 2. Whole genome resequencing and SNP detection

[0065] Total genomic DNA was extracted from young leaves of each germplasm using the CTAB method. The DNA was then sent to a biotechnology company for sequencing, and a 150-bp paired-end sequencing library was constructed according to the manufacturer's instructions. Sequencing was performed using the Illumina HiSeq platform. After filtering out low-quality paired-end reads, high-quality sequencing data (clean data) was obtained, with an average genome coverage depth of 14.6×.

[0066] Using BWA software and the MEM algorithm (default parameters), high-quality sequencing data were aligned with the reference genome of *G. hirsutum* TM-1 (reference genome version: *Gossypium hirsutum (AD1) 'TM-1' genome CRI_v1 (CRI TM-1V1.0; Yang et al. *Nature Communications*, 2019)). Based on the BAM files generated during the alignment process, single nucleotide polymorphisms (SNPs) were identified at the population level using SAMtools software. A total of 1,076,652 high-quality SNPs were retained, with a deletion rate ≤20% in the population and a minimum allele frequency (MAF) ≥0.05, for subsequent analysis. Annotation information for the SNPs was obtained using ANNOVAR software.

[0067] 3. Genome-wide association analysis of resistance to Verticillium wilt in upland cotton

[0068] Genome-wide association analysis was performed on 2018 and 2019 incidence phenotypic data of 383 upland cotton accessions and genotypic data of 1,076,652 high-quality SNPs (MAF>0.05, deletion rate≤0.2), using -log 10 (P)≈5.0 was used as the Bonferronni correction threshold; loci greater than 5.0 were considered significant. Significantly associated SNP loci were screened across the entire genome. Results showed that three SNP loci on chromosome A10, within the interval A10:102184052-102549983, were significantly associated with the cotton disease incidence phenotype in Kuitun, Xinjiang in both 2018 and 2019 (Table 5). The Manhattan plot obtained from the genome-wide association analysis is shown below. Figure 1 As shown.

[0069] Table 5. SNP markers significantly associated with the incidence of Verticillium wilt in upland cotton.

[0070]

[0071] Note: HAP1 base refers to upland cotton plants carrying this base at the SNP site being classified as HAP1, and HAP2 base is classified similarly; HAP1 quantity refers to the number of upland cotton plants carrying the HAP1 base at the SNP site, and HAP2 quantity is classified similarly; HAP1 phenotype refers to upland cotton plants carrying the HAP1 base at the SNP site exhibiting a low incidence of Verticillium wilt, and HAP2 phenotype refers to upland cotton plants carrying the HAP2 base at the SNP site exhibiting a high incidence of Verticillium wilt; the reason why the sum of the HAP1 quantity and the HAP2 quantity in the table is less than 383 is that upland cotton plants with a heterozygous genotype were excluded.

[0072] 4. Analysis of Chained Unbalanced Blocks (LD blocks)

[0073] Using Tassel 5.0, linkage disequilibrium analysis was performed on the candidate interval VWA10 (A10:102184052-102549983) containing the SNP sites. The analysis revealed that the SNPs within the interval formed a strongly linkage disequilibrium block (LD block), with an LD coefficient (R0). 2 Higher (>0.8) Figure 2 Molecular phylogenetic analysis and haplotype analysis were performed on the SNPs within the interval. Based on the typing results, the experimental materials were classified into two haplotypes: HAP1 and HAP2. Figure 3 (A) In the KT18 environment, the mean incidence of Verticillium wilt in materials carrying HAP1 was 31.30%, while the mean incidence of Verticillium wilt in materials carrying HAP2 was 46.41%, showing a significant difference. In the KT19 environment, the mean incidence of Verticillium wilt in materials carrying HAP1 was 27.87%, while the mean incidence of Verticillium wilt in materials carrying HAP2 was 43.19%. A significance test (two-tailed t-test) was used to compare the incidence of Verticillium wilt among different haplotypes. The results showed that the incidence of Verticillium wilt in upland cotton with haplotype HAP1 was significantly lower than that in upland cotton with haplotype HAP2 (P<0.001). Figure 3 (B and C in the middle).

[0074] Example 2: Development of Molecular Markers and Primer Pairs

[0075] Based on the SNP site information and haplotype sequence in Table 5, related molecular markers were designed and developed. The nucleotide sequences of the molecular markers are shown below, and the nucleotide sequences of the primer pairs used to amplify the molecular markers are shown in Table 6 below.

[0076] Sequence of molecular marker:

[0077] The nucleotide sequence of molecular marker 1 is shown in SEQ ID NO.1, specifically:

[0078] CGCTTATGAACTCCTCCTGTAAAGTKTTAAAGCAGCACTGAACTCTGGGAT; K is C or T.

[0079] The nucleotide sequence of molecular marker 2 is shown in SEQ ID NO.2, specifically as follows:

[0080] TCCAATCAACGAGGGTACAAATKCTTGGATCAGAATGGGAGGATTTATGTCTCTTGA; K is A or G.

[0081] The nucleotide sequence of molecular marker 3 is shown in SEQ ID NO.3, specifically:

[0082] GCATCTAGTCGCATAAACCAGTAKCGGCTATTGAGCCTCAGCCTGACCTGCACTTCTACC; K is T or C.

[0083] Table 6 Information on primer pairs used for amplifying molecular markers

[0084]

[0085] Note: The bolded part is the FAM tag sequence, and the underlined part is the HEX tag sequence.

[0086] Example 3

[0087] A method for identifying Verticillium wilt resistance in upland cotton, comprising the following steps:

[0088] DNA was extracted from upland cotton plants using the CTAB method (Zheng et al., 2021). DNA quality and concentration were determined using a NanoDrop 2000 spectrophotometer, and the DNA concentration used for KASP genotyping was controlled at 50–60 ng / μl.

[0089] Allele sequences of SNPs within the locus region and their upstream and downstream extension sequences (29 bp upstream and 30 bp downstream) were extracted. KASP primers were designed using Perl scripts (Steele et al., 2018) and synthesized by Sangon Biotech (Shanghai) Co., Ltd. (Table 6).

[0090] KASP reactions were performed using the primer pairs listed in Table 6. Genotyping was performed on an Applied Biosystems® QuantStudio™ 6 instrument (384-well plate). The primer mixture was prepared first, as shown in Table 7.

[0091] Table 7 Primer Mixture

[0092]

[0093] The PCR reaction system (5 μL reaction system) contains: 2.5 μL HiGeno 2×Probe Mix A, 0.07 μL KASP primers, 10-250 ng DNA sample and the remainder sterile water.

[0094] The PCR procedure was as follows: (1) pre-denaturation at 95℃ for 10 minutes; (2) denaturation at 95℃ for 20 seconds, followed by annealing and extension at 61℃–55℃ for 40 seconds (10 cycles, decreasing by 0.6℃ per cycle); (3) denaturation at 95℃ for 20 seconds, followed by annealing and extension at 55℃ for 40 seconds (33 cycles); (4) reading the results at 25℃. Genotypic data were obtained using the built-in QuantStudio™ real-time fluorescence quantitative software, and the genotyping results of the samples were determined based on the fluorescence signals: red-labeled samples (HEX fluorescent label) and blue-labeled samples (FAM fluorescent label) represented two homozygous genotypes, respectively, while green-labeled samples represented heterozygous genotypes.

[0095] After the reaction, the fluorescence signal was read using a fluorescence detection platform. Then, the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) was used to analyze and convert the fluorescence signal, presenting it in a graph. Based on different colors, the genotype results were output. The graph is divided into X and Y axes, with each data point representing an independent DNA sample. Samples with the same genotype are clustered together. Those closer to the X and Y axes are homozygous genotypes (represented by blue and red dots), while those closer to the diagonal are heterozygous genotypes (represented by green dots).

[0096] When the primers used for molecular marker 1 identified the genotype CC, the genotype near the Y-axis (red dot HEX) indicated a high resistance to Verticillium wilt in upland cotton varieties; when the genotype was TT, the genotype near the X-axis (blue dot FAM) indicated a low resistance to Verticillium wilt in upland cotton varieties. When the primers used for molecular marker 2 identified the genotype AA, the genotype near the X-axis (blue dot FAM) indicated a high resistance to Verticillium wilt in upland cotton varieties; when the genotype was GG, the genotype near the Y-axis (red dot HEX) indicated a low resistance to Verticillium wilt in upland cotton varieties. When the primers used for molecular marker 3 identified the genotype TT, the genotype near the X-axis (blue dot FAM) indicated a high resistance to Verticillium wilt in upland cotton varieties; when the genotype was CC, the genotype near the Y-axis (red dot HEX) indicated a low resistance to Verticillium wilt in upland cotton varieties.

[0097] Example 4

[0098] In this embodiment, haplotypes with extreme resistance to Verticillium wilt were screened from 383 resequencing natural cotton germplasm accessions (383 upland cotton accessions in Example 1) and planted in Kuitun, Xinjiang in 2020. Field management, including irrigation, pesticide spraying, and pruning of cotton fruiting branches, was carried out according to the routine management standards for cotton growth stages at each ecological site. The genotypes of the three molecular markers in the test samples were identified using the method in Example 3, and the results are shown in Table 8. The genotyping diagram of molecular marker 1 is shown below. Figure 4 As shown, the genotyping diagram of molecular marker 2 is as follows: Figure 5 As shown, the genotyping diagram of molecular marker 3 is as follows: Figure 6 As shown.

[0099] Table 8. Sample testing results in 2020

[0100] Note: **** represents P<0.0001, indicating a highly significant difference.

[0101] As shown in Table 8, the three SNP markers obtained by the present invention are all closely linked to traits.

[0102] Example 5

[0103] In this embodiment, haplotypes with extreme resistance to Verticillium wilt were screened from 383 resequencing natural cotton germplasm accessions (383 upland cotton accessions in Example 1) and planted in Kuitun, Xinjiang in 2021. Field management, including irrigation, pesticide spraying, and pruning of cotton fruiting branches, was carried out according to the routine management standards for cotton growth stages at each ecological site. The genotypes of the three molecular markers in the test samples were identified using the method in Example 3, and the results are shown in Table 9.

[0104] Table 9. Sample testing results in 2021

[0105]

[0106] As shown in Table 9, the three SNP markers obtained by the present invention are all closely linked to traits.

[0107] Based on the results of the above embodiments, it can be seen that the molecular markers and primer pairs provided by the present invention can effectively distinguish between upland cotton germplasm with high and low resistance to Verticillium wilt and those with low resistance to Verticillium wilt; moreover, the molecular markers and primer pairs can also be used for molecular marker-assisted breeding of upland cotton and to improve upland cotton germplasm resources, which can greatly improve breeding efficiency.

[0108] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A SNP molecular marker associated with Gossypium hirsutum Verticillium wilt resistance, characterized in that, The molecular marker is one or more of a molecular marker 1, a molecular marker 2 and a molecular marker 3; The nucleotide sequence of the molecular marker 1 is shown in SEQ ID NO. 1, and a C / T base mutation exists at the 25th base of the nucleotide sequence; The nucleotide sequence of the molecular marker 2 is shown in SEQ ID NO. 2, and an A / G base mutation exists at the 23rd base of the nucleotide sequence; The nucleotide sequence of the molecular marker 3 is shown in SEQ ID NO. 3, and a T / C base mutation exists at the 24th base of the nucleotide sequence.

2. A KASP primer set for amplifying the SNP molecular marker of claim 1, characterized in that, The KASP primer set comprises one or more of a KASP primer set for amplifying the molecular marker 1, a KASP primer set for amplifying the molecular marker 2 and a KASP primer set for amplifying the molecular marker 3; The KASP primer set for amplifying the molecular marker 1 comprises an allele-specific primer X with the nucleotide sequence shown in SEQ ID NO. 4, an allele-specific primer Y with the nucleotide sequence shown in SEQ ID NO. 5 and a common primer R with the nucleotide sequence shown in SEQ ID NO. 6; The KASP primer set for amplifying the molecular marker 2 comprises an allele-specific primer X with the nucleotide sequence shown in SEQ ID NO. 7, an allele-specific primer Y with the nucleotide sequence shown in SEQ ID NO. 8 and a common primer R with the nucleotide sequence shown in SEQ ID NO. 9; The KASP primer set for amplifying the molecular marker 3 comprises an allele-specific primer X with the nucleotide sequence shown in SEQ ID NO. 10, an allele-specific primer Y with the nucleotide sequence shown in SEQ ID NO. 11 and a common primer R with the nucleotide sequence shown in SEQ ID NO.

12.

3. Use of the KASP primer set of claim 2 in the preparation of a product for identifying the level of resistance to Verticillium wilt in upland cotton, characterized in that, If the genotyping result of the molecular marker 1 is CC, it is determined that the to-be-tested upland cotton is an upland cotton variety with high resistance to Verticillium wilt, and if the genotyping result is TT, it is determined that the to-be-tested upland cotton is an upland cotton variety with low resistance to Verticillium wilt; If the genotyping result of the molecular marker 2 is AA, it is determined that the to-be-tested upland cotton is an upland cotton variety with high resistance to Verticillium wilt, and if the genotyping result is GG, it is determined that the to-be-tested upland cotton is an upland cotton variety with low resistance to Verticillium wilt; If the genotyping result of the molecular marker 3 is TT, it is determined that the to-be-tested upland cotton is an upland cotton variety with high resistance to Verticillium wilt, and if the genotyping result is CC, it is determined that the to-be-tested upland cotton is an upland cotton variety with low resistance to Verticillium wilt.

4. Use according to claim 3, characterized in that, The product comprises reagents, kits or chips.

5. A product for identifying the level of resistance to Verticillium wilt in Gossypium hirsutum, characterized by, The product comprises the KASP primer set of claim 2.

6. The product of claim 5, wherein, The product comprises reagents, kits or chips.

7. Use of the KASP primer set of claim 2 or the product of claim 5 or 6 for identifying the level of resistance to Verticillium wilt in upland cotton, characterized in that, If the genotyping result of the molecular marker 1 is CC, it is determined that the to-be-tested upland cotton is an upland cotton variety with high resistance to Verticillium wilt, and if the genotyping result is TT, it is determined that the to-be-tested upland cotton is an upland cotton variety with low resistance to Verticillium wilt; If the genotyping result of the molecular marker 2 is AA, it is determined that the to-be-tested upland cotton is an upland cotton variety with high resistance to Verticillium wilt, and if the genotyping result is GG, it is determined that the to-be-tested upland cotton is an upland cotton variety with low resistance to Verticillium wilt; If the genotyping result of the molecular marker 3 is TT, the tested upland cotton is determined as a high Verticillium wilt resistance upland cotton variety, and if the genotyping result is CC, the tested upland cotton is determined as a low Verticillium wilt resistance upland cotton variety.

8. A method for identifying the resistance of Gossypium hirsutum to Verticillium wilt, characterized by, The application further provides a product containing the KASP primer set of claim 2 or the product of claim 5 or 6. The KASP primer set of claim 2 or the product of claim 5 or 6 is used for screening or predicting a high Verticillium wilt resistance upland cotton variety. If the genotyping result of the molecular marker 1 is CC, the tested upland cotton is determined as a high Verticillium wilt resistance upland cotton variety, and if the genotyping result is TT, the tested upland cotton is determined as a low Verticillium wilt resistance upland cotton variety. If the genotyping result of the molecular marker 2 is AA, the tested upland cotton is determined as a high Verticillium wilt resistance upland cotton variety, and if the genotyping result is GG, the tested upland cotton is determined as a low Verticillium wilt resistance upland cotton variety. If the genotyping result of the molecular marker 3 is TT, the tested upland cotton is determined as a high Verticillium wilt resistance upland cotton variety, and if the genotyping result is CC, the tested upland cotton is determined as a low Verticillium wilt resistance upland cotton variety. The KASP primer set of claim 2 or the product of claim 5 or 6 is used for screening or predicting a high Verticillium wilt resistance upland cotton variety. If the genotyping result of the molecular marker 1 is CC, the tested upland cotton is determined as a high Verticillium wilt resistance upland cotton variety, and if the genotyping result is TT, the tested upland cotton is determined as a low Verticillium wilt resistance upland cotton variety. If the genotyping result of the molecular marker 2 is AA, the tested upland cotton is determined as a high Verticillium wilt resistance upland cotton variety, and if the genotyping result is GG, the tested upland cotton is determined as a low Verticillium wilt resistance upland cotton variety. If the genotyping result of the molecular marker 3 is TT, the tested upland cotton is determined as a high Verticillium wilt resistance upland cotton variety, and if the genotyping result is CC, the tested upland cotton is determined as a low Verticillium wilt resistance upland cotton variety.

Citation Information

Patent Citations

  • SNP molecular marker related to upland cotton fusarium wilt resistance and applicationof SNP molecular marker

    CN111961746A

  • SNP (Single Nucleotide Polymorphism) molecular marker combination related to verticillium wilt resistance of upland cotton and application of SNP molecular marker combination

    CN117144050A