Alfalfa salt-alkaline and low temperature compound stress resistance gene msnced5, and coding protein and application thereof

Abstract

The application relates to the technical field of plant genetic engineering, and particularly discloses a Medicago sativa L. salt-alkaline and low-temperature compound stress resistance gene MsNCED5 and application of an encoding protein thereof in improving the salt-alkaline and low-temperature compound stress resistance of plants. The nucleotide sequence of the gene disclosed by the application is shown as SEQ ID NO. 1, has a full length of 1833 bp, and encodes 610 amino acids. The application successfully creates an MsNCED5-OE transgenic strain by constructing an MsNCED5 overexpression vector and transforming the Medicago sativa L., and the MsNCED5 gene expression amount of the transgenic strain is significantly higher than that of a wild type. Under salt-alkaline and low-temperature compound stress, the transgenic plant has stronger stress tolerance than the wild type, which indicates that the overexpression of the MsNCED5 gene improves the salt-alkaline and low-temperature compound stress resistance of the plant. The MsNCED5 gene in the application provides an important theoretical basis for studying the stress resistance molecular mechanism of alfalfa and breeding.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and specifically discloses an alfalfa gene MsNCED5 that resists salt and low temperature combined stress, its encoded protein, and its applications. Background Technology

[0002] alfalfa ( Medicago sativa Alfalfa (L.) is a perennial leguminous forage grass, considered one of the world's most important forages due to its high quality, palatability, and wide adaptability. Global soil salinization is expanding annually, and extreme weather events such as low temperatures occur frequently. Alfalfa exhibits a certain tolerance to abiotic stresses such as drought and low temperatures. Planting alfalfa in mid-to-high latitude saline-alkali lands can not only develop and utilize saline-alkali lands and mitigate soil salinization, but also alleviate competition for land with food crops. However, alfalfa grown in mid-to-high latitude saline-alkali lands is often subjected to combined stresses of salt and low temperatures, limiting its growth and development. Therefore, identifying key genes in plant responses to combined salt and low temperature stresses is of significant strategic importance for creating new salt-tolerant and cold-resistant forage varieties, increasing forage production capacity in saline-alkali lands, and achieving sustainable development of the forage industry.

[0003] Plants respond to multiple concurrent abiotic stresses through various mechanisms, and studies have shown that the effects of simultaneous or sequential stress on plant phenotypes and molecular mechanisms are more complex. Under heat stress, plants open stomata for transpiration, while under drought stress, they close stomata. However, under combined drought and heat stress, stomata remain closed, indicating that drought-driven stomatal regulation plays a major role. Arabidopsis seedlings were placed under multiple combined stresses including heat, salt, strong light, cadmium, acid, and herbicides. Combined stresses containing two or more stress types severely inhibited Arabidopsis growth. Differential gene expression patterns under six stress combinations revealed distinct gene expression characteristics, indicating that different types of combined stress specifically affect plant metabolism and growth, and that plants need to regulate different genes to respond to multiple abiotic stresses. Therefore, plants may employ various regulatory mechanisms when facing combined stresses. However, current research on combined salt and low temperature stresses remains limited, and the mechanisms by which plants respond to these combined stresses are still poorly understood.

[0004] The growth and development of plants are regulated by both endogenous signal pathways and environmental factors. Among numerous plant hormones, abscisic acid (ABA) as a key stress-responsive signal molecule plays a core role in coordinating plant growth and development with environmental adaptation. 9-cis-epoxycarotenoid dioxygenase (NCED) is the rate-limiting enzyme for ABA biosynthesis, and its activity directly determines the accumulation level of ABA in plants. ABA regulates various physiological processes in plants through a complex signal transduction network. In response to abiotic stress, ABA can induce rapid stomatal closure to reduce water loss, promote the accumulation of osmotic adjustment substances (such as proline, soluble sugar, etc.) to maintain cell osmotic balance, and activate the antioxidant enzyme system to scavenge reactive oxygen species (ROS). These synergistic mechanisms enable plants to effectively resist various environmental pressures such as salt-alkali stress and low temperature stress. Therefore, studying NCED genes has important theoretical and practical significance for analyzing plant stress resistance mechanisms and cultivating stress-resistant crop varieties. SUMMARY

[0005] The purpose of the present application is to provide a salt-alkali and low temperature compound stress resistance gene MsNCED5 of Medicago sativa and its encoding protein, and to clarify its application in improving plant stress resistance.

[0006] The present application is realized by the following technical solutions:

[0007] The present application discloses a salt-alkali and low temperature compound stress resistance gene MsNCED5 of Medicago sativa. The nucleotide sequence of the Medicago sativa gene MsNCED5 is shown in SEQ ID NO. 1, the sequence length is 1833 bp, and it encodes 610 amino acids (the amino acid sequence is shown in SEQ ID NO. 2). The gene encodes 9-cis-epoxycarotenoid dioxygenase (NCED), which is a key rate-limiting enzyme in the abscisic acid (ABA) biosynthesis pathway of plants.

[0008] The present application provides a plant overexpression vector pEarleyGate100-MsNCED5, which comprises the MsNCED5 gene.

[0009] The present application discloses the verification and application of the salt-alkali and low temperature compound stress resistance gene MsNCED5 of Medicago sativa in the salt-alkali and low temperature compound stress resistance of Medicago sativa.

[0010] Compared with the prior art, the present application has the following beneficial technical effects:

[0011] The application discloses a Medicago sativa L. salt-alkaline and low-temperature compound stress resistance gene MsNCED5 for the first time, and obtains a protein amino acid sequence coded by the gene, and proves that the MsNCED5 gene influences the resistance of Medicago sativa L. to compound stress by using molecular biology and genetic engineering technology. The application successfully introduces the overexpression vector of the MsNCED5 gene into Medicago sativa L. by using an agrobacterium-mediated genetic transformation method, and obtains transgenic Medicago sativa L. MsNCED5-OE with a significantly improved MsNCED5 expression level. Under the condition of salt-alkaline and low-temperature compound stress, the Medicago sativa L. MsNCED5-OE has stronger compound stress resistance compared with the wild type, significantly improves the plant height, fresh weight and dry weight, significantly improves physiological damage, and significantly improves peroxidase (POD) and catalase (CAT) activities. Meanwhile, the transgenic plant has better cell membrane integrity under stress, which is represented by a significantly reduced electrolyte leakage rate (EL) and malondialdehyde (MDA) content, and significantly improved NCED enzyme activity and endogenous ABA content. The application proves that the MsNCED5 gene can enhance the resistance of Medicago sativa L. to salt-alkaline and low-temperature compound stress by regulating ABA synthesis by using molecular biology, genetic engineering and physiology and other multidisciplinary technical means, and provides important theoretical basis and technical support for genetic improvement of forage resistance. BRIEF DESCRIPTION OF DRAWINGS

[0012] Figure 1 MsNCED5 protein domain.

[0013] Figure 2 MsNCED5 and other species homologous protein system evolution relationship.

[0014] Figure 3 Plant expression vector pEarleyGate100-MsNCED5 construction schematic diagram.

[0015] Figure 4 MsNCED5 - PCR detection diagram of OE Medicago sativa L.

[0016] Note: wherein, "+" is a positive control, "-" is a negative control, 0 is a blank control, OE1-OE4 are target bands obtained by PCR, are consistent with the positive, and are transgenic plants.

[0017] Figure 5 qRT-PCR analysis of the relative expression amount of MsNCED5 - OE Medicago sativa L.

[0018] Note: significant difference is represented as: , and the error line is the standard error (n=3) of each group.

[0019] Figure 6 MsNCED5 - The phenotype of OE alfalfa and wild type alfalfa WT after 7 days of combined salt and low temperature stress treatment;

[0020] Note: The scale is 10 cm.

[0021] Figure 7 MsNCED5 - The plant height of OE alfalfa and wild type alfalfa WT after 7 days of combined salt and low temperature stress treatment;

[0022] Note: Different lowercase letters represent significant differences (P < 0.05), and the error bar is the standard error of each group (n = 3). P

[0023] MsNCED5 Figure 8 The fresh weight of the aboveground part of OE alfalfa and wild type alfalfa WT after 7 days of combined salt and low temperature stress treatment; - Note: Different lowercase letters represent significant differences (P < 0.05), and the error bar is the standard error of each group (n = 3).

[0024] P MsNCED5

[0025] The dry weight of the aboveground part of OE alfalfa and wild type alfalfa WT after 7 days of combined salt and low temperature stress treatment; Figure 9 - Note: Different lowercase letters represent significant differences (P < 0.05), and the error bar is the standard error of each group (n = 3).

[0026] P MsNCED5 The NCED enzyme activity of OE alfalfa and wild type alfalfa WT after 7 days of combined salt and low temperature stress treatment;

[0027] Figure 10 Note: Different lowercase letters represent significant differences (P < 0.05), and the error bar is the standard error of each group (n = 3). -

[0028] MsNCED5 P The ABA content of OE alfalfa and wild type alfalfa WT after 7 days of combined salt and low temperature stress treatment;

[0029] Note: Different lowercase letters represent significant differences (P < 0.05), and the error bar is the standard error of each group (n = 3). Figure 11 - MsNCED5

[0030] P Note: Different lowercase letters represent significant differences (P < 0.05), and the error bar is the standard error of each group (n = 3).​​​

[0031] Figure 12 MsNCED5 - POD enzyme activity of OE alfalfa and wild type alfalfa WT after 7 days of combined stress treatment of saline-alkali and low temperature;

[0032] Note: different lowercase letters represent significant difference (P<0.05), error bar is the standard error of each group (n=3). P <0.05), error bar is the standard error of each group (n=3).

[0033] Figure 13 MsNCED5 - CAT enzyme activity of OE alfalfa and wild type alfalfa WT after 7 days of combined stress treatment of saline-alkali and low temperature;

[0034] Note: different lowercase letters represent significant difference (P<0.05), error bar is the standard error of each group (n=3). P <0.05), error bar is the standard error of each group (n=3).

[0035] Figure 14 MsNCED5 - EL value of OE alfalfa and wild type alfalfa WT after 7 days of combined stress treatment of saline-alkali and low temperature;

[0036] Note: different lowercase letters represent significant difference (P<0.05), error bar is the standard error of each group (n=3). P <0.05), error bar is the standard error of each group (n=3).

[0037] Figure 15 MsNCED5 - MDA content of OE alfalfa and wild type alfalfa WT after 7 days of combined stress treatment of saline-alkali and low temperature;

[0038] Note: different lowercase letters represent significant difference (P<0.05), error bar is the standard error of each group (n=3). P <0.05), error bar is the standard error of each group (n=3). DETAILED DESCRIPTION

[0039] The application discloses a new saline-alkali and low temperature resistant combined stress gene MsNCED5, which is obtained from alfalfa, and specific related experiments are as follows:

[0040] 1. Cloning of alfalfa MsNCED5 gene

[0041] The nucleotide sequence of Medicago truncatula, a close relative of Medicago sativa, was searched from the NCBI database (http: / / www.ncbi.nlm.nih.gov / ) and saved. The MsNCED5 gene induced by stress expression in Medicago sativa was obtained through transcriptome sequencing under the combined stress of saline-alkali and low temperature. The nucleotide sequence of the MsNCED5 gene was determined through BLAST comparison and phylogenetic tree analysis. See Figure 1 , and domain analysis showed that MsNCED5 contains an RPE65 domain. The sequence was used to design a cloning primer, which is:

[0042] MsNCED5-F: ATCATCACTATGGCAACATC (SEQ ID NO. 3)

[0043] MsNCED5-R: TCTACTCACAGACCACGAAC (SEQ ID NO. 4)

[0044] The specific process is as follows:

[0045] Extraction of RNA: good Medicago sativa seeds were selected for planting, and the leaves were taken out at the age of 4 weeks and placed in liquid nitrogen for a moment, and then stored at -80°C for standby. The total RNA of Medicago sativa was extracted using an RNA extraction kit (TIANGEN).

[0046] Obtaining cDNA: using the extracted RNA as a template, a high-efficiency reverse transcription kit (TOYOBO) was used to obtain cDNA, and the cDNA was used as a template for PCR amplification of the MsNCED5 full-length sequence and sequencing. The CDS full-length of the MsNCED5 gene is 1833 bp, encoding 610 amino acids. The amino acid sequence was analyzed by Blast in NCBI, and it was found that the amino acid homology was 98% compared with MtNCED ( Medicago truncatula L. ), and the MsNCED5 gene of Medicago sativa was closely related to the homologous genes in Medicago truncatula, soybean, red clover and other plants, and was far from the evolution of rice and other plants. See Figure 2 .

[0047] PCR reaction: KOD-Plus DNA polymerase was used for PCR reaction.

[0048] PCR reaction system:

[0049]

[0050] PCR reaction program:

[0051]

[0052] After PCR, 1% agarose gel electrophoresis was performed to detect the results. The gel strip containing the target band was cut and placed in a 1.5 mL Eppendorf tube. The QIAquick Gel Extraction Kit (QIAGEN) was used for purification and recovery.

[0053] The MsNCED5 gene was connected with pEASY as a cloning vector, and the reaction conditions were 25°C for 15 min, and the connection system was as follows:

[0054]

[0055] 2. Construction of pGWC-MsNCED5 plant intermediate vector

[0056] The pEASY-MsNCED5 recombinant cloning vector plasmid was used as a template, and MsNCED5-pGWC-F and MsNCED5-pGWC-R were used as primers to PCR amplify the MsNCED5 gene containing the pGWC vector homologous sequence, and the relevant primer sequences were as follows:

[0057] MsNCED5-pGWC-F: GTACAAAAAAGCAGGCTTTGACTTTATGGCAACATCAACGGCTT (SEQ ID NO. 5)

[0058] MsNCED5-pGWC-R: CTTTGTCGTCATCGTCTTTGTAGTCCTCTTGTTTCTTCAAATCATTTG (SEQ ID NO. 6)

[0059] The pGWC plasmid was extracted, Ahd I The pGWC plasmid was single-cut, and the vector fragment was recovered and purified after enzyme digestion. The target fragment and the enzyme-digested vector were connected.

[0060] The connection system was as follows:

[0061]

[0062] 3. Construction of pEarleyGate100-MsNCED5 vector

[0063] The pEarleyGate100 plasmid was extracted, and the MsNCED5 fragment was connected from the pGWC vector to the pEarleyGate100 vector using Gateway LR Clonase II Enzyme Mix (11791020, Thermo Fisher) at 25°C for 1 h.

[0064] The reaction system was as follows:

[0065]

[0066] The recombinant vector was named pEarleyGate100-MsNCED5, and the schematic diagram of the vector was shown in Figure 1. Figure 3 The vector was transformed into Agrobacterium strain GV3101 by freeze-thaw method.

[0067] 4. Alfalfa genetic transformation process

[0068] (1) Cultivation of alfalfa

[0069] The disinfected alfalfa seeds were evenly sowed in pots filled with vermiculite, and placed in a culture room (24±1℃, 70-80% humidity, 16 h light / 8 h dark). The pots were regularly watered. After the seeds germinated, 1 × Hoagland nutrient solution was used for irrigation and cultivation. The 4-5 week old leaves were used as infection materials.

[0070] (2) Agrobacterium treatment

[0071] The Agrobacterium carrying pEarleyGate100-MsNCED5 was streaked on YEB solid medium containing kanamycin and rifampicin, and cultured for 36-48 h. Single colonies were inoculated into YEB liquid medium, and shaken to an OD 600 =0.6-0.8. When the absorbance at 600 nm was 0.2-0.4, it was used for subsequent infection.

[0072] (3) Leaf infection

[0073] The leaves were disinfected with 15% sodium hypochlorite solution for 7 minutes, and then washed with sterile water for 5 times, 1 minute each time. An appropriate amount of SH3a liquid medium was added to the conical flask to completely immerse the leaves. The leaves were ultrasonicated for 3-5 minutes to form uniform small wounds on the surface of the leaves. Agrobacterium solution was added to ensure sufficient contact between the bacteria solution and the leaves. Vacuum was applied for 10 minutes to promote infection, and then the leaves were shaken at 28℃ and 200 rpm for 15 minutes to further promote gene transformation. After shaking, the leaves were placed on SH3a solid medium and cultured in the dark for 24-48 h.

[0074] (4) Selection culture

[0075] The leaves were transferred from SH3a medium to selection medium containing cephalosporin and hygromycin, and cultured in dark for 7 to 8 weeks, and the leaves were transferred to new selection medium every 2 weeks to promote callus formation. After callus grew on the leaves, the callus was transferred to MSBK medium for light culture for 2 to 3 weeks to induce green bud differentiation.

[0076] (5) Rooting and transplanting

[0077] The green bud was transferred to SH9a bud culture medium for 1 month, and the medium was replaced every week. After rooting, it was moved to 1 / 2 SH9a rooting medium. After the seedlings grew well, the medium was washed away, and it was transplanted to a mixed medium of nutrient soil: vermiculite (1:1) covered with plastic wrap (punctured for ventilation), and acclimated in a 25°C incubator, and gradually adapted to the natural environment.

[0078] 5. Molecular biology detection of MsNCED5-OE alfalfa

[0079] PCR identification was performed using the DNA of MsNCED5-OE alfalfa as a template, and the specific sequences were as follows:

[0080] MsNCED5-in F: TACAAATGCCATCATTGCGATA (SEQ ID NO. 7)

[0081] MsNCED5-in R: GTAATTGGAAGAGATTGGGTTAC (SEQ ID NO. 8)

[0082] The PCR reaction program was as follows:

[0083]

[0084] See Figure 4 , OE1, OE2, OE3 and OE4 are the PCR identification results of 4 strains of MsNCED5 gene transformed alfalfa, lane "0" is water, blank control; lane "+" is pEarleyGate100-MsNCED5 vector, positive control; lane M is DL2000 DNA Marker. Plants successfully transformed with MsNCED5 gene can amplify a 748 bp band, and 4 strains of overexpressed MsNCED5 gene alfalfa were obtained.

[0085] qRT-PCR identification of MsNCED5-OE alfalfa

[0086] RNA was extracted from wild-type and PCR-positive MsNCED5-OE alfalfa using an RNA extraction kit, and reverse transcribed into cDNA using a reverse transcription kit. The expression level of MsNCED5 in MsNCED5-OE alfalfa was detected using quantitative real-time PCR. See also... Figure 5 Compared with the wild type, the transcription level of the MsNCED5 gene was significantly increased in all four overexpression lines.

[0087] 6. Functional validation of MsNCED5-OE alfalfa in response to combined salt-alkali and low-temperature stress

[0088] After four weeks of growth, the transgenic plants were placed in a low-temperature incubator for combined salt-alkali and low-temperature stress treatment, with a light intensity of 250 μmol / m². -2 s -1 The stress conditions are: -1℃ and irrigation with a saline-alkali solution (NaHCO3, Na2CO3, NaCl, Na2SO4 as Na...). + The molar ratio of Na is 2:1:2:1. + A combined stress treatment was applied (with a concentration of 200 mM, 100 mL applied every 2 days for 3 applications). Samples were collected on day 7 for subsequent experiments. See [link to relevant documentation]. Figure 6 To measure the height of the above-ground parts of the plant before and after stress, see [reference needed]. Figure 7 To measure the fresh weight of the aboveground parts of the plant before and after stress, see [reference needed]. Figure 8 The above-ground parts of the plant were placed in an oven at 105°C for 6 hours until constant weight was achieved. The dry weight of the above-ground parts of the plant was then measured. See [link to relevant documentation]. Figure 9 To further verify the ability of MsNCED5-OE alfalfa to resist compound stress, the activity of NCED enzyme, ABA content, POD enzyme activity, CAT enzyme activity, EL and MDA content were measured.

[0089] NCED enzyme activity assay: Weigh 1.0 g of alfalfa leaves frozen in liquid nitrogen, homogenize under ice bath conditions, prepare NCED enzyme stock solution and corresponding diluent, and determine NCED enzyme activity using a Plant NCED ELISA Kit (Plant NCED ELISA KIT HB-P91115T). See [link to relevant documentation]. Figure 10 .

[0090] ABA content determination method: 1.0 g of the alfalfa leaves after frozen by liquid nitrogen was weighed, and 20 mL of pre-cooled 80% methanol solution was added for grinding. After centrifugation at 12000 rpm for 15 min at 4°C, the supernatant was evaporated at 35°C, and washed with 10% methanol-0.4% acetic acid for 3 times. The solution was passed through a Sep-Pak C18 solid phase extraction column. The column was eluted with 15 mL of 100% methanol-0.4% acetic acid solution, and evaporated at 35°C under vacuum. The residue was dissolved in 1.5 mL of 50% methanol solution, and the sample was filtered through a 0.45 μm microporous filter before being loaded. The mobile phase A was 0.4% (v / v) acetic acid, and the mobile phase B was 100% methanol. The mobile phase gradient elution program was as follows: mobile phase B 0-4 min: 45%; 4-5 min: 45-50%; 5-17 min: 50-60%; 17-18 min: 60%; 18-19 min: 60%-45%. The column temperature was 35°C, the flow rate was 1 mL / min, and the ABA content of alfalfa was detected at 260 nm. See Figure 11 .

[0091] POD enzyme activity determination method: 0.2 g of the alfalfa leaves after frozen by liquid nitrogen was weighed, and 2 mL of PBS 6.0 buffer was added for grinding. After vortex mixing, centrifugation was performed at 10000 rpm for 10 min at 4°C. 1 mL of the supernatant was taken as the enzyme solution and placed on ice. 3 mL of the reaction solution was taken and placed in a cuvette, 160 μL of the enzyme solution was added and mixed, and the absorbance value was measured at 240 nm. The number was recorded every 30 s for 6 times. See Figure 12 .

[0092] CAT enzyme activity determination method: 0.2 g of the alfalfa leaves after frozen by liquid nitrogen was weighed, and 2 mL of PBS 7.8 buffer was added for grinding. After vortex mixing, centrifugation was performed at 10000 rpm for 10 min at 4°C. 1 mL of the supernatant was taken as the enzyme solution and placed on ice. 3 mL of the reaction solution was taken and placed in a cuvette, 80 μL of the enzyme solution was added and mixed, and the absorbance value was measured at 240 nm. The number was recorded every 30 s for 6 times. 100 μL of the supernatant was taken and placed in a boiling water bath for 10 min to inactivate the enzyme solution, and the absorbance value was measured at the same time. 3 mL of the reaction solution plus 80 μL of PBS 7.8 was taken as the control and zeroed. See Figure 13 .

[0093] EL determination method: take the same size of alfalfa leaves, wash with deionized water, filter paper to dry the surface water, cut the leaves into appropriate length of strip, quickly take three parts of fresh sample, 0.1 g each, respectively placed in 10 mL test tube, cover with glass plug at room temperature for 12 h. The conductivity of the extract was determined by conductivity meter R1. The sample was placed in boiling water bath for 30 min, cooled to room temperature, and then measured again. The relative conductivity is calculated as (R1 / R2) x 100%, see Figure 14 .

[0094] MDA content determination method: 0.1 g of frozen alfalfa leaves was added to pre-cooled TCA, centrifuged at 10000 rpm for 10 min, the supernatant was added to 2 mL TBA, shaken well, boiled in water bath for 10 min, then centrifuged at 4500 rpm for 10 min, the supernatant was measured at 532 nm, and the absorbance of the mixture was adjusted by subtracting the absorbance at 600 nm, see Figure 15 .

[0095] See Figure 6 , under normal growth conditions, there is no difference between WT and MsNCED5-OE alfalfa. However, after salt and low temperature combined stress, WT leaf withered, top curved, MsNCED5-OE leaf withered slightly, top straight.

[0096] See Figure 7 , under normal growth conditions, there is no difference between WT and MsNCED5-OE alfalfa. However, after salt and low temperature combined stress, WT leaf withered, top curved, MsNCED5-OE leaf withered slightly, top straight.

[0097] Fresh weight and dry weight are important indicators of plant biomass accumulation, there is no significant difference between WT and MsNCED5-OE alfalfa before stress, after combined stress, the fresh weight and dry weight of MsNCED5-OE alfalfa are significantly higher than that of WT, see Figure 8 and Figure 9 .

[0098] See Figure 10 , before stress, the NCED enzyme activity of MsNCED5-OE alfalfa is significantly higher than that of WT, after combined stress, the NCED enzyme activity of WT and MsNCED5-OE alfalfa increases, and the NCED enzyme activity of MsNCED5-OE alfalfa increases significantly higher than that of WT.

[0099] See Figure 11After the combined stress, the endogenous ABA content of WT and MsNCED5-OE alfalfa increased, and the ABA content of MsNCED5-OE alfalfa was significantly higher than that of WT.

[0100] POD and CAT can remove excess ROS in plant cells, reduce plant oxidative damage. After the combined stress, the POD and CAT enzyme activities of WT and MsNCED5-OE alfalfa increased, but the enzyme activity of MsNCED5-OE alfalfa was significantly higher than that of wild type, see Figure 12 and Figure 13 .

[0101] EL and MDA are important indicators of stress damage, MsNCED5-OE alfalfa significantly reduces EL and MDA under combined stress, and there is no significant difference between WT and MsNCED5-OE alfalfa before stress, see Figure 14 and Figure 15 .

[0102] In summary, the application discloses a MsNCED5 gene of alfalfa and a cloning method and application thereof. The gene is 1833 bp in full length and encodes a protein composed of 610 amino acids. Based on the gene sequence information, the application creates MsNCED5 overexpression alfalfa (MsNCED5-OE). Through systematic molecular biology detection and functional verification experiments, it is found that the MsNCED5 gene can significantly enhance the tolerance of alfalfa to combined stress of salt and low temperature, and it is confirmed that the gene plays an important role in the response of alfalfa to combined stress of salt and low temperature. The application not only provides an important candidate gene resource for plant stress resistance molecular breeding, but also provides a new theoretical basis for analyzing plant stress resistance molecular mechanism, and has important application value for cultivating new varieties of stress-resistant crops.

[0103] Nucleotide and amino acid list

[0104] SEQ ID NO. 1

[0105] >MsNCED5

[0106]

[0107] SEQ ID NO. 2

[0108]

Claims

1. A Medicago sativa salt-alkaline and low temperature combined stress resistance gene MsNCED5, characterized in that, The nucleotide sequence of the gene is shown as SEQ ID NO.

1.

2. The protein encoded by the Medicago sativa salt-alkaline and low temperature composite stress gene MsNCED5 according to claim 1, characterized in that, The amino acid sequence of the protein is shown as SEQ ID NO.

2.

3. The expression vector containing the salt-alkali and low temperature compound stress gene MsNCED5 of Medicago sativa L. of claim 1, characterized in that, The expression vector is a plant expression vector pEarleyGate100-MsNCED5.

4. The application of the alfalfa salt-alkaline and low temperature compound stress resistance gene MsNCED5 in improving the salt-alkaline and low temperature compound stress resistance of alfalfa.

5. The use according to claim 4, wherein the compound is ###0002### Constructing a plant expression vector containing the alfalfa salt-alkaline and low temperature compound stress resistance gene MsNCED5, transforming the expression vector into alfalfa by Agrobacterium-mediated method, and screening to obtain a transgenic plant overexpressing MsNCED5.

6. The application of the protein in improving the salt-alkaline and low temperature compound stress resistance of alfalfa.

Images