Methods of producing nanoarrays and microarrays

Abstract

The invention relates to a method for producing nano-arrays and micro-arrays. The method described herein provides a method of generating an array of spatially separated proteins. The method relies on covalently attaching each of a plurality of proteins to a structured nucleic acid particle (SNAP) and attaching the SNAP to a solid support.

Description

This application is a divisional application of an application filed on April 4, 2019, with application number 201980037998.3 and invention name “Methods for Producing Nanoarrays and Microarrays”. Cross-references

[0001] This application claims the benefit of U.S. Provisional Patent Application No. 62 / 652,849, filed April 4, 2018, which is incorporated herein by reference in its entirety. Background Art

[0002] Microarrays and nanoarrays can be used to assess biological and chemical entities. It can be beneficial to design nanoarrays and microarrays to suit a specific assessment. Summary of the Invention

[0003] The present disclosure provides methods and systems for separating biological and chemical entities.

[0004] One aspect of the present invention provides a composition comprising a structured nucleic acid particle (SNAP) covalently attached to a protein. In some cases, the SNAP is attached to a solid support. In some cases, the SNAP is covalently attached to a solid support. In some cases, the SNAP is non-covalently attached to a solid support.

[0005] One aspect of the present invention provides a composition comprising a SNAP covalently attached to a biomolecule. In some cases, the SNAP is attached to a solid support. In some cases, the SNAP is covalently attached to the solid support. In some cases, the SNAP is non-covalently attached to the solid support.

[0006] One aspect of the present invention provides a composition comprising a solid support attached to a plurality of structured nucleic acid particles (SNAPs), wherein each of the plurality of SNAPs is attached to a biomolecule. In some cases, the plurality of SNAPs are arranged in an array.

[0007] One aspect of the present invention provides a method for attaching a single protein to an attachment site on a solid support, wherein the attachment site is larger than the protein; the method comprising covalently attaching the protein to a SNAP; wherein the diameter of the SNAP is at least as large as the diameter of the attachment site; and attaching the SNAP to the attachment site. In some cases, each of the plurality of proteins is attached to an attachment site on the solid support; such that each attachment site is attached to a single protein.

[0008] One aspect of the invention provides a biomolecule array comprising a plurality of biomolecules attached to a solid support; wherein each biomolecule of the plurality of biomolecules is covalently attached to a linker, and the linker is attached to the solid support; and wherein each linker is attached to only one biomolecule of the plurality of biomolecules, and each linker has a diameter of at least 50 nm.

[0009] One aspect of the present invention provides a method for producing an array of spatially separated proteins from a plurality of proteins, the method comprising covalently attaching each protein in the plurality of proteins to a terminus of a nucleic acid molecule comprising a SNAP, and attaching the SNAP to a solid support, thereby producing an array of spatially separated proteins.

[0010] One aspect of the invention provides a composition comprising a protein, a SNAP, and a solid support; wherein the protein is covalently bound to the SNAP, and wherein the protein does not contact the solid support.

[0011] One aspect of the present invention provides a method for producing an array of spatially separated biological or chemical entities, the method comprising: obtaining a solid support having attachment sites; obtaining a sample comprising a plurality of biological or chemical entities; obtaining seeds, each seed having a functional group; covalently attaching each of the plurality of biological or chemical entities to a single seed via the functional group; growing each attached seed into a SNAP having a desired size; and attaching the SNAP to the attachment sites of the array, thereby producing an array of spatially separated biological or chemical entities.

[0012] In some cases, the solid support is glass, silica, plastic, silicon, gold, metal, chromium, titanium, titanium oxide, tin, or tin oxide. In some cases, the solid support is optically opaque. In some cases, the solid support is optically transparent. In some cases, the solid support is modified to have a positive charge. In some cases, the solid support is modified to have a negative charge. In some cases, the solid support is modified to have a functional group that can bind to a SNAP. In some cases, the solid support comprises an attachment site that is modified to be different from the surrounding surface. In some cases, the solid support comprises an array of attachment sites. In some cases, each attachment site is at least 70 nm away from every other attachment site. In some cases, each attachment site is at least 25 nm away from every other attachment site. In some cases, the distance between the edges of any two attachment sites is greater than the radius of the SNAP used. In some cases, the distance between the edges of any two attachment sites is greater than the diameter of the SNAP used.

[0013] In some cases, the molecule is a protein. In some cases, the seed is an oligonucleotide.

[0014] In some cases, the oligonucleotide is modified with a functional group at the 3' end. In some cases, the oligonucleotide is modified with a functional group at the 5' end. In some cases, the functional group is selected from the group consisting of: amine, thiol, carboxylic acid, triple bond, double bond, epoxide, alkyne, olefin, cycloalkyne, azide, cyclooctyne, cycloalkyne, norbornene, tetrazine, cyclooctane, epoxide and hydroxyl. In some cases, the oligonucleotide is modified to contain a photocleavable bond. In some cases, the SNAP is formed by rolling circle amplification. In some cases, the SNAP is a dendrimer. In some cases, the dendrimer is positively charged and the attachment site on the array is negatively charged. In some cases, the dendrimer is negatively charged and the attachment site on the array is positively charged. In some cases, the diameter of the SNAP is about 100 nm. In some cases, the diameter of the SNAP is about 300 nm. In some cases, the diameter of the SNAP is about 10 nm to 500 μm. In some cases, the SNAP has a diameter of about 10 nm to 50 μm. In some cases, the SNAP has a diameter of about 10 nm to 5 μm. In some cases, the SNAP has a diameter of about 100 nm to 500 nm. In some cases, the SNAP adheres to the solid support via electrostatic interactions.

[0015] One aspect of the present invention provides a method for achieving spatial separation of molecules, the method comprising: obtaining a plurality of molecules; obtaining seeds, each seed having a functional group; covalently attaching each of the plurality of molecules to a single seed via the functional group; growing each attached seed into a SNAP having a desired size; and attaching the SNAP to a solid support, thereby achieving spatial separation of single molecules.

[0016] One aspect of the invention provides an array of single molecules, each single molecule attached to a SNAP of a desired size, the SNAP being attached to the array via an attachment site.

[0017] One aspect of the invention provides a kit for producing an array of single molecules, the kit comprising: an array having attachment sites; seeds, each seed having a single attachment site; and reagents for growing the seeds into SNAPs.

[0018] One aspect of the invention provides a composition comprising a solid support; and a polymer-based molecule directly attached to the solid support, wherein the polymer-based molecule comprises a protein portion oriented substantially opposite the solid support, and wherein the protein portion is accessible to an affinity reagent.

[0019] One aspect of the present invention provides a method for separating biological or chemical entities on an array, the method comprising: generating a plurality of SNAPs; conjugating a single biological or chemical entity to each of the plurality of SNAPs; and attaching the plurality of SNAPs to an array, wherein the biological or chemical entities are substantially opposite the array, such that each biological or chemical entity in each of the plurality of SNAPs is separated by a distance based on a size of each of the plurality of SNAPs.

[0020] One aspect of the invention provides a method of separating molecules, the method comprising converting each molecule into a larger charged molecule.

[0021] In some cases, converting each molecule into a larger charged molecule involves conjugating the molecule to a biopolymer that can grow to a desired size.

[0022] In some cases, converting each molecule into a larger charged molecule includes converting each molecule into a 10-fold larger molecule.

[0023] In some cases, converting each molecule into a larger charged molecule includes conjugating each molecule to the larger charged molecule.

[0024] One aspect of the present invention provides a method for producing an array of spatially separated biological or chemical entities, the method comprising: obtaining a solid support having attachment sites; obtaining a sample comprising a plurality of biological or chemical entities; obtaining SNAPs, each SNAP having a functional group; covalently attaching each biological or chemical entity of the plurality of biological or chemical entities to a single SNAP; and attaching the SNAPs to the attachment sites of the array, thereby producing an array of spatially separated biological or chemical entities.

[0025] In some cases, the SNAP is a rolling circle amplification product. In some cases, the SNAP is a plasmid. In some cases, the SNAP is a DNA origami molecule. In some cases, the SNAP is a nucleic acid cluster. Incorporation by reference

[0026] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The novel features of the present invention are particularly set forth in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by referring to the following detailed description which illustrates illustrative embodiments utilizing the principles of the present invention and the accompanying drawings, in which:

[0028] Figure 1A An exemplary method for attaching proteins to substrates via structured nucleic acid particles (SNAPs) is described, wherein the protein is covalently attached to an oligonucleotide primer, which then anneals to a circular DNA template containing an internal region of complementarity. Rolling circle DNA amplification of the primer on the template generates DNA molecules with internal hybridization regions, resulting in the formation of DNA clusters (an example of a SNAP). Because SNAPs are negatively charged, they can attach to positively charged attachment sites on a solid support.

[0029] Figure 1B An alternative method of attaching proteins to a matrix is ​​shown, in which the SNAPs are formed first and then attached to the protein.

[0030] Figure 1C An alternative method of attaching proteins to a matrix is ​​shown, in which SNAPs are first formed and covalently attached to a cross-linker, which is then attached to the protein.

[0031] Figure 1D An alternative method of attaching proteins to a substrate is shown, in which a SNAP is deposited on a surface and a protein having a chemical moiety reacts with the chemical moiety of the SNAP to attach the protein to the SNAP.

[0032] Figure 2 Methods for producing solid supports with attachment sites arranged at desired intervals are shown.

[0033] Figure 3A The absorption spectrum of SNAP produced in Example 1 is shown.

[0034] Figure 3B Shown is the fluorescence intensity of SNAP imaged as a dot blot.

[0035] Figure 4 Shown is the colocalization of SNAP and attached deep red 200 nm beads in a microscope image of SNAP produced in Example 1. Sybr Gold was used to visualize DNA fluorescence at 488 nm and attached deep red bead fluorescence at 647 nm. Areas of the image are magnified to show detail, and arrows point to examples of colocalization.

[0036] Figure 5 Shown are the radii of particles in SNAP-containing samples before and after anion exchange purification.

[0037] Figure 6 Shown are the intensities detected in fractions collected during anion exchange purification of a sample containing SNAP.

[0038] Figure 7 Shown are the absorption spectra of different batches of SNAP at the 260 nm trace.

[0039] Figure 8 Co-localization of small SNAPs on the chip is shown.

[0040] Figure 9 Shown is the absence of colocalization of large SNAPs on the chip.

[0041] Figure 10 Shown are the counts and number of occupied features when the SNAP titration method was applied to the chip.

[0042] Figure 11 The brightness of a batch of SNAPs is shown.

[0043] Figure 12 Shown is the measurement of SNAP concentration using the OPA assay.

[0044] Figure 13 Fluorescence images of a chip with SNAP before and after conjugation with azide-AlexaFluor 568 at 488 nm and 568 nm are shown.

[0045] Figure 14 Shown are quantifications of the intensity of fluorescence images at 488 nm and 575 nm of a chip with SNAP before and after conjugation with azide-AlexaFluor 568.

[0046] Figure 15 Fluorescence images of the chip with SNAP at 488 nm before and after incubation with azide-AlexaFluor 568 are shown.

[0047] Figure 16 Fluorescence images of the chip with SNAP at 568 nm before and after incubation with azide-AlexaFluor 568 are shown.

[0048] Figure 17 Shown is a fluorescence image of a chip with SNAP on the surface after click conjugation with PE-conjugated azide.

[0049] Figure 18 Shown is the immobilization of proteins from E. coli lysate onto an array with SNAP-coated features.

[0050] Figure 19Specific detection of short peptides of short trimeric peptide epitopes using SNAP is shown. DETAILED DESCRIPTION

[0051] Microarrays and nanoarrays with multiple spatially distributed molecules on a solid support surface and stably associated therewith are becoming increasingly important tools in bioanalysis and related fields. Microarrays of polypeptides and polynucleotides have been developed and used in various applications, such as gene sequencing, monitoring gene expression, gene mapping, bacterial identification, drug discovery, and combinatorial chemistry. One of the areas in which microarrays are particularly useful is gene expression analysis.

[0052] In some cases, it may be desirable to create a microarray or nanoarray in which a plurality of biological or chemical entities are spatially distributed on and stably associated with the surface of a solid support such that each individual biological or chemical entity is spatially separated from every other biological or chemical entity.

[0053] In some embodiments, the present disclosure provides a method for generating an array of spatially separated biological or chemical entities, the method comprising: obtaining a solid support having attachment sites; obtaining a sample comprising a biological or chemical entity; obtaining seeds, each seed having a functional group; covalently attaching each biological or chemical entity to a single seed via the functional group; growing each attached seed into a SNAP (structured nucleic acid particle) of a desired size; attaching the SNAP to the attachment sites of the array, thereby generating a regular array of biological or chemical entities. In some cases, the SNAP can be any type of DNA-based nanoparticle, such as a rolling circle amplification-based nanoparticle, a plasmid, or a DNA origami nanoparticle.

[0054] An example of such a method for generating arrays of entities such as proteins is Figure 1A-1D Available in. Figure 1A A method is depicted that begins by attaching a protein to an oligonucleotide primer via a linker. The primer can then be annealed to a circular DNA template, followed by rolling circle amplification to produce SNAPs (represented as DNA clusters in this example). The SNAPs can then be deposited onto a chip. In this example, the negative charge of the DNA backbone can interact with the positively charged features of the array, causing the SNAPs to become immobilized on the array.

[0055] Figure 1BA method is depicted that begins with a primer with a linker that initiates rolling circle amplification using a circular DNA template. The resulting SNAP (represented in this example as a DNA cluster) thus contains the linker, which can then be conjugated to a protein. The SNAP can then be deposited onto a chip. In this example, the negative charge of the DNA backbone can interact with the positively charged features of the array, causing the SNAP to become immobilized on the array.

[0056] Figure 1C A method is depicted that begins with primers that initiate rolling circle amplification using a circular DNA template. The resulting SNAP (represented as a DNA cluster in this example) can then be linked to a cross-linker, which can then be conjugated to a protein to produce a SNAP cross-linked to the protein. The SNAP can then be deposited onto a chip. In this example, the negative charge of the DNA backbone can interact with the positively charged features of the array, causing the SNAP to become immobilized on the array.

[0057] Figure 1D SNAPs are depicted that have been produced, for example, by rolling circle amplification or other acceptable methods. These SNAPs can then be deposited onto a chip. For example, the negative charge of the DNA backbone can interact with the positively charged features of the array, causing the SNAP to become immobilized on the array. Separately, proteins can be modified with chemical handles that can bind to chemical moieties that can be located on the SNAP. The treated proteins can then be applied to the SNAPs to covalently attach them to the SNAPs.

[0058] In some embodiments, the present disclosure provides arrays of single molecules and methods and kits for producing arrays of single molecules. In some embodiments, the present disclosure provides arrays of biological or chemical entities and methods and kits for producing arrays of biological or chemical entities. In some examples, the array of biological or chemical entities can comprise an ordered series of biological or chemical entities arranged on a solid support. In other examples, the array of biological or chemical entities can comprise an irregular array of biological or chemical entities.

[0059] In some examples, the biological or chemical entities on the array can be separated by less than 10 nm, about 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 120 nm, 140 nm, 160 nm, 180 nm, 200 nm, 250 nm, 300 nm, 350 nm, 400 nm, 450 nm, 500 nm, 550 nm, 600 nm, 650 nm, 700 nm, 750 nm, 800 nm, 850 nm, 900 nm, 1000 nm, 1200 nm, 1400 nm, 1600 nm, 1800 nm, 2000 nm, 2500 nm, 3000 nm, 3500 nm, 4000 nm, 4500 nm, 5000 nm, 5500 nm, 6000 nm, 6500 nm, 7000 nm, 7500 nm, 8000 nm, 8500 nm, 9000 nm, 0nm, 950nm, 1μm, 1.2μm, 1.4μm, 1.6μm, 1.8μm, 2μm, 2.5μm, 3μm, 4μm, 5μm, 6μm, 7μm, 8μm, 9μm, 10μm, 11μm, 12μm, 13μm, 1 4μm, 15μm, 16μm, 17μm, 18μm, 19μm, 20μm, 25μm, 30μm, 40μm, 50μm, 75μm, 100μm, 200μm, 300μm, 400μm, 500μm or greater than 500μm. In some cases, the biological or chemical entities on the array can be separated by about 50 nm to about 1 μm, about 50 nm to about 500 nm, about 100 nm to about 400 nm, about 200 nm to about 300 nm, about 500 nm to about 10 μm, about 50 nm to about 1 μm, or about 300 nm to about 1 μm. In some cases, the spacing of the biological or chemical entities on the array can be determined by the presence of attachment sites arranged on the solid support.

[0060] In some embodiments, an array is produced on a solid support. The solid support can be any solid surface to which molecules can be covalently or non-covalently attached. Non-limiting examples of solid substrates include slides, component surfaces of devices, membranes, flow cells, holes, chambers, and macrofluidic chambers. The solid support used herein can be flat or curved, or can have other shapes, and can be smooth or textured. In some cases, the solid support surface can include micropores. In some cases, the matrix surface can include nanopores. In some cases, the solid support surface can include one or more micropores and one or more nanopores. In some embodiments, the solid support can be made of glass, carbohydrates such as dextran, plastics such as polystyrene or polypropylene, polyacrylamide, latex, silicon, metals such as gold, chromium, titanium or tin, titanium oxide, tin oxide or cellulose. In some examples, the solid support can be a slide or a flow cell.

[0061] In some embodiments, the surface of the solid support can be modified to allow or enhance the covalent or non-covalent attachment of molecules such as SNAPs described herein. The solid support and method for molecular attachment are preferably stable for repeated binding, washing, imaging, and elution steps. In some cases, the surface can be modified to have a positive or negative charge. In some cases, the surface can be functionalized by modifying with specific functional groups (such as maleic acid or succinic acid moieties), or the surface can be derivatized by modifying with chemically reactive groups (such as amino, thiol, or acrylate groups) (for example, by silanization). Suitable silane reagents include aminopropyltrimethoxysilane, aminopropyltriethoxysilane, and 4-aminobutyltriethoxysilane. The surface can be functionalized with N-hydroxysuccinimide (NHS) functional groups. Glass surfaces can also use other reactive groups, such as acrylates or epoxy groups, using, for example, epoxysilanes, acrylate silanes, or acrylamide silanes for derivatization.

[0062] In some embodiments, the solid support can be modified to reduce nonspecific attachment of SNAP to the solid support. In some embodiments, the solid support can be modified to reduce nonspecific attachment of biological entities and / or chemical entities to the solid support. In some embodiments, the solid support can be passivated. In some other embodiments, the surface of the solid support can be passivated. In some embodiments, the passivation layer can include diamond-like carbon, hexamethyldisilazane, Teflon, fluorocarbons, polymers such as polyethylene glycol (PEG) and / or parylene. In some embodiments, the solid support can be passivated by attaching polyethylene glycol (PEG) molecules across the solid support. In some embodiments, the solid support can be passivated using salmon sperm DNA, glycol, albumin, or a combination thereof. In some embodiments, the solid support can be passivated using one or more components selected from the group consisting of salmon sperm DNA, glycol, and albumin. In some embodiments, the passivation component can be exposed to the surface. In some embodiments, the passivation component can not be covalently bound to the surface. In some embodiments, the passivation material can not be covalently bound to the solid support.

[0063] In some embodiments, the solid support can be modified across the surface to which molecules are to be attached. In other embodiments, the solid support can comprise regions modified to allow for molecular attachment and unmodified regions, or regions modified to reduce molecular attachment and unmodified regions, or regions modified to increase molecular attachment and regions modified to reduce molecular attachment. In some cases, attachment sites can be generated in an array (e.g., an ordered array).

[0064] The ordered array of attachment sites can be produced by, for example, photolithography, Dip-Pen nanolithography, nanoimprint lithography, nanosphere lithography, cluster lithography, nanopillar arrays, nanowire lithography, scanning probe lithography, thermochemical lithography, thermal scanning probe lithography, localized oxidation nanolithography, molecular self-assembly, stencil lithography, or electron beam lithography. The attachment sites in the ordered array can be positioned so that each attachment site is less than 20 nanometers (nm), or about 20 nm, about 50 nm, about 75 nm, about 100 nm, about 125 nm, about 150 nm, about 175 nm, about 200 nm, about 225 nm, about 250 nm, about 275 nm, about 300 nm, about 325 nm, about 350 nm, about 375 nm, about 400 nm, about 425 nm, about 50 ... 450nm, about 475nm, about 500nm, about 525nm, about 550nm, about 575nm, about 600nm, about 625nm, about 650nm, about 675nm, about 700nm, about 725nm, about 750nm, about 775nm, about 800nm, about 825nm, about 850nm, about 875nm, about 900nm, about 925nm, about 950nm, about 975nm, about 1000nm, about 10 25nm, about 1050nm, about 1075nm, about 1100nm, about 1125nm, about 1150nm, about 1175nm, about 1200nm, about 1225nm, about 1250nm, about 1275nm, about 1300nm, about 1325nm, about 1350nm, about 1375nm, about 1400nm, about 1425nm, about 1450nm, about 1475nm, about 1500nm, about 1525nm m, about 1550 nm, about 1575 nm, about 1600 nm, about 1625 nm, about 1650 nm, about 1675 nm, about 1700 nm, about 1725 nm, about 1750 nm, about 1775 nm, about 1800 nm, about 1825 nm, about 1850 nm, about 1875 nm, about 1900 nm, about 1925 nm, about 1950 nm, about 1975 nm, about 2000 nm, or greater than 2000 nm.

[0065] In some cases, the spacing of the attachment sites on the solid support can be selected based on the size of the SNAP to be used. For example, the spacing of the attachment sites can be selected so that the distance between the edges of any two attachment sites is greater than the diameter of the SNAP to be used.

[0066] In some cases, the size of the attachment sites on the solid support can be selected based on the size of the SNAP to be used. For example, the size of the attachment sites can be selected so that the diameter of each attachment site is smaller than the diameter of the SNAP to be used.

[0067] In some cases, attachment sites may be provided in micropores or nanopores.

[0068] In some cases, the functional groups may be present at random intervals and may be provided at a concentration such that the functional groups are, on average, at least about 50 nm, about 100 nm, about 150 nm, about 200 nm, about 250 nm, about 300 nm, about 350 nm, about 400 nm, about 450 nm, about 500 nm, about 550 nm, about 600 nm, about 650 nm, about 700 nm, about 750 nm, about 800 nm, about 850 nm, about 900 nm, about 950 nm, about 1000 nm, or greater than 1000 nm away from any other functional groups.

[0069] The solid support can be functionalized indirectly. For example, the solid support can be PEGylated and the functional groups can be applied to all or a subset of the PEG molecules.

[0070] In some cases, the efficiency of attachment of a SNAP to a solid support may be high. In some cases, the efficiency of attachment of a SNAP to a solid support may be moderate. In some cases, the efficiency of attachment of a SNAP to a solid support may be low. The efficiency of attachment of a SNAP to a solid support may be affected by many factors, including, but not limited to, the sequence of the cluster, the size of the SNAP relative to the size of the corresponding binding plaque, the extent of structural modification of the SNAP in a manner that affects binding, the lifespan of the SNAP, the storage conditions of one or more buffers in contact with the SNAP, the storage conditions of the SNAP, the pH or other significant property of the solvent in which binding is desired, the percentage of positive cations, and temperature. In some cases, the reliability of attachment of a SNAP to a solid support may be high. In some cases, the reliability of attachment of a SNAP to a solid support may be moderate. In some cases, the reliability of attachment of a SNAP to a solid support may be low.

[0071] In some embodiments, the solid support can be optically opaque. In some cases, the solid support can be optically transparent at one or more wavelengths. In some cases, the solid support can be partially optically transparent, or can be optically transparent in certain regions. For example, the solid support can be optically opaque in unfunctionalized regions and optically transparent in functionalized regions.

[0072] Figure 2A method for producing a solid support having attachment sites arranged at desired intervals is shown. First, a substrate is provided. In some embodiments, the substrate can be glass. In particular, in some embodiments, the substrate can be amorphous glass, fused silica or quartz, among other examples. In some embodiments, the substrate can be silicon. In some embodiments, the thickness of the substrate can be less than 100 microns, 100 microns, 150 microns, 200 microns, 300 microns, 400 microns, 500 microns, 600 microns, 700 microns, 800 microns, 900 microns, 1 mm, 2 mm or greater than 2 mm.

[0073] Initially, the substrate is cleaned, for example, using piranha cleaning. In some embodiments, the substrate can be cleaned using a strong acid, thereby cleaning the substrate without etching the substrate. In some embodiments, the substrate can be cleaned using a detergent. Alternatively, the substrate can be cleaned using a solvent, sonication, or a plasma such as an O2 or N2 plasma, or a combination thereof.

[0074] In some embodiments, the chromium layer is deposited on the back side of the substrate. After the cleaning matrix, the chromium layer is deposited on the back side of the substrate. Deposition method can include, for example, evaporation or sputtering. In some embodiments, when the substrate is opaque, the back side chromium evaporation can not be applied. The thickness of the back side chromium evaporation can be 1 angstrom, 2 angstroms, 10 angstroms, 10 nanometers, 20 nanometers, 30 nanometers, 40 nanometers, 50 nanometers, 60 nanometers, 70 nanometers, 80 nanometers, 90 nanometers, 100 nanometers, 150 nanometers, 200 nanometers, 250 nanometers, 300 nanometers, 400 nanometers, 500 nanometers or greater than 500 nanometers. Alternatively, other metals can be used to be deposited on the back side of the substrate, such as aluminum, tungsten and / or titanium, and other examples. Alternatively, a dielectric mirror can be used to deposit on the back side of the substrate.

[0075] In addition, a reference can be produced on the front side of the substrate. The reference can be produced by adding at least one layer of material and patterning the at least one layer. In some embodiments, this material can be chromium, and / or this material can be other metals, such as tungsten or gold. Alternatively, a dielectric mirror can be used as the material for the reference. Alternatively, a metal oxide can be used as the reference, such as ZrO2. The patterning of this material can be carried out in a variety of ways. The first method for patterning the reference material is to deposit a covering layer of material, then protect the material in selected areas, and remove the material in unprotected areas. For example, this can be achieved by coating the front side of the substrate with a photosensitive material (such as a photoresist), exposing the photoresist to UV light through a mask, and then developing the photoresist to pattern the photoresist. The etching of the reference material can then be performed by wet etching (such as acid) or dry etching (such as reactive ion etching, RIE). Alternatively, the photoresist can be deposited and patterned first. In some embodiments of at first making photoresist deposition and patterning, limit the zone without this photoresist, then can be with reference material deposited on the top of photoresist.Can remove photoresist then (for example, in the solvent bath under supersound process situation), and reference material can be stayed on the zone that does not initially have photoresist (for example, using stripping technique).Alternately, can be by in selected area from matrix removal material, for example, by patterning the photoresist layer on the matrix front, then the matrix in the zone of not coating photoresist is carried out dry etching and produces benchmark.In another alternative, benchmark can be defined (for example, by laser melting and / or fractionation) by local modification matrix.Benchmark can have various shapes, lines and / or orientation.In some embodiments, the pattern of benchmark can be applied on matrix.In another embodiment, the shape of benchmark can change, so that the information about their position on matrix surface is encoded.

[0076] Once a reference pattern is generated on the front side of the substrate, the front side can be coated differently to define features that can fix the target biological object (e.g., a nucleic acid cluster covalently attached to a protein). In a first embodiment, the surface can be patterned differently using two silanes (e.g., HMDS or PEG-silane in the field and APTES on the fixed point). For example, this differential patterning is achieved by depositing an initial HMDS layer on the surface, followed by a peeling layer, then an optional anti-reflective layer, and then a photoresist layer. In some embodiments, when an opaque substrate is used, an anti-reflective layer may not be provided.

[0077] In some embodiments, the second photolithography step can be provided. In particular, desired features can be provided. In some embodiments, desired features can have a length of about 300nm. In some embodiments, feature can have a length less than 50nm, 100nm, 150nm, 200nm, 250nm, 300nm, 350nm, 400nm, 450nm, 500nm, 600nm, 700nm or greater than 700nm. In some other embodiments, the developing step of the second photolithography can not be used to etch one or more layers (for example, anti-reflective coating) deposited on the surface to perform the second photolithography.

[0078] In embodiments where a backside coating is provided, the backside coating may be removed, for example, by using wet etching or dry etching, etc. In addition, directional reactive ion etching (RIE) may be provided to remove layers that have not been removed by the photolithography step (e.g., antireflective coating).

[0079] Once the hole is provided, cleaning can be performed. Figure 2 As shown, an oxygen plasma cleaning and activation step is provided. Once the chip is cleaned, amino-silane deposition can be performed. Once amino-silane deposition is provided, portions of the chip product can be peeled off, for example, using hot DMF. In addition, an ultrasonic treatment step can be performed. The resulting chip can be used in a flow cell for evaluation of biological assays.

[0080] In an alternative embodiment, the surface can be differentially patterned with a silane layer and a metal layer (e.g., (3-aminopropyl)triethoxysilane (APTES) on the fixed points and chromium in the field). In another embodiment, the surface can be differentially patterned with a silane layer and a metal oxide layer (e.g., a PEG-silane layer in the field and a ZrO2 layer on the fixed points). In yet another embodiment, the surface can be differentially patterned with a silane layer (e.g., acyl protein thioesterase (APTS)) on the fixed points and a metal oxide layer (e.g., ZrO2) and a PEG-phosphonic acid layer in the field.

[0081] The biological entities or chemical entities of the present disclosure can be any biological entity or chemical entity that needs to be spatially separated. In some embodiments, the biological entity or chemical entity is a protein. In some cases, the protein can be a protein from a cell or tissue homogenate, from a biological fluid, or from an environmental sample. In some cases, the biological entity or chemical entity can be an antibody. In some embodiments, the biological entity or chemical entity is a nucleic acid. For example, the biological entity or chemical entity can be DNA, RNA, mRNA, tRNA, or miRNA. In some embodiments, the biological entity or chemical entity is a carbohydrate. In some embodiments, the biological entity or chemical entity is a complex polymer. In some embodiments, the biological entity or chemical entity is a small molecule, such as a chemical compound rather than a complex polymer.

[0082] The biological or chemical entities of the present disclosure can be attached to seeds. These seeds are molecules that can be used as starting "seeds" for growing larger polymeric molecules. A seed can be a monomer that can grow into a polymer, or it can contain monomers that can grow into a polymer. Typically, a seed is a molecule that can be covalently attached to a molecule. The seed can have polarity so that only one functional group in the seed can bind to a molecule in the multiple molecules to be separated, while another one or more functional groups of the seed can form the starting point for the polymer.

[0083] Examples of monomers that may be present in a seed include, but are not limited to, oligonucleotides, carbohydrates, proteins, amyloids, fibrils, and triangular tetrapeptide repeats. In some cases, the seed is a small molecule.

[0084] The seed can comprise a monomer and a functional group capable of binding to the biological entity or chemical entity to be separated. Examples of such functional groups may include, but are not limited to, amines, thiols, carboxylic acids, triple bonds, double bonds, epoxides, alkynes, olefins, cycloalkynes, azides, cyclooctynes, cycloalkynes, norbornenes, tetrazines, cyclooctanes, epoxides, and hydroxyls. In some cases, the seed can comprise a functional group compatible with click chemistry. In some cases, the seed can also comprise a linker or spacer between the seed and the functional group. In some cases, the linker or spacer can comprise a photocleavable bond. In some cases, the seed can comprise an oligonucleotide conjugated to an amino group at the 5' end. In some cases, the seed can comprise an oligonucleotide conjugated to a click chemistry component at the 5' end.

[0085] In some cases, bioconjugation can be used to form a covalent bond between two molecules, at least one of which is a biomolecule. Bioconjugation can be formed, but is not limited to, via chemical conjugation, enzymatic conjugation, photoconjugation, thermal conjugation, or a combination thereof. (Spicer, CD, Pashuck, ET, & Stevens, MM, Achieving Controlled Biomolecule-Biomaterial Conjugation. Chemical Reviews., 2018, 118, Pgs. 7702-7743, and Greg T. Hermanson, "Bioconjugate Techniques", Academic Press; 3rd edition, 2013, incorporated herein by reference for this disclosure). In some cases, both the seed and the biological entity (e.g., SNAP) or chemical entity can be functionalized. Functionalizing both partners can increase the efficiency or speed of the conjugation reaction. For example, the sulfhydryl (-SH) or amine (-NH2) of the chemically active site of a seed, biological entity or chemical entity can be functionalized to allow greater reactivity or efficiency of the conjugation reaction. Any of a variety of sulfhydryl reactivity (or thiol reactivity) or amine conjugation chemistry can be used to couple a chemical moiety to a sulfhydryl or amine group. Examples include, but are not limited to, the use of haloacetyl, maleimide, aziridine, acryloyl, arylating agent, vinyl sulfone, pyridyl disulfide, TNB-thiol and / or other sulfhydryl reactivity / amine reactivity / thiol reactivity reagents. Many of these groups are conjugated to sulfhydryl groups by alkylation (e.g., by forming a thioether or amine bond) or disulfide exchange (e.g., by forming a disulfide bond). More strategies and details about bioconjugation reactions are described below and can be extended to other suitable biomolecules.

[0086] Bioconjugation can be accomplished in part by chemical reactions of chemical moieties or linker molecules with chemically active sites on biomolecules. Chemical conjugation can be performed by amide formation, reductive amination, N-terminal modification, thiol Michael addition, disulfide formation, copper (I) catalyzed alkyne-azide cycloaddition (CuAAC), strain-promoted alkyne-azide cycloaddition (SPAAC), strain-promoted alkyne-nitrone cycloaddition (SPANC), inverse electron demand Diels-Alder (IEDDA) reaction, oxime / hydrazone formation, free radical polymerization, or a combination thereof. Enzyme-mediated conjugation can be performed by transglutaminase, peroxidase, sortase, SpyTag-SpyCatcher, or a combination thereof. Photoconjugation and activation can be performed by photoacrylate cross-linking, photothiol-ene reaction, photothiol-yne reaction, or a combination thereof. In some cases, conjugation can be performed through non-covalent interactions, which can be performed through self-assembling peptides, binding sequences, host-guest chemistry, nucleic acids, or a combination thereof.

[0087] In some cases, site-selective methods can be used to modify the reactive parts of biomolecules to improve conjugation efficiency, ease of use and reproducibility. Site-selective bioconjugation generally adopts three common strategies: (i) modification strategies, which can select a single motif from many, rather than targeting a universal reactive handle. This can be determined by subtle differences in surrounding sequence, local environment or reactivity. The ability of enzymes to modify specific amino acids at a single position in a protein sequence or glycan is particularly prominent. Reactions that exhibit excellent chemical selectivity also fall into this category, such as reactions targeting unique reactivities at glycan anomeric positions or protein N-termini. (ii) Site-specific incorporation of non-natural functionalities can be exploited by hijacking natural biosynthetic pathways. (iii) Installation of unique reactivities through chemical synthesis can be exploited. Complete or partial synthesis of peptides and oligonucleotides is common, especially using solid-phase methods. These techniques allow access to sequences of up to 100 amino acids or 200 nucleotides and have the ability to install a variety of functionalized monomers through precise positional control.

[0088] In some cases, chemical conjugation techniques can be used to create biomaterial-biomolecule conjugates. The functional groups used for bioconjugation can be natural to the biomolecule or can be synthetically incorporated. In the following description, R and R' can be biomolecules (for example, but not limited to, SNAPs, proteins, nucleic acids, carbohydrates, lipids, metabolites, small molecules, monomers, oligomers, polymers) and / or solid supports.

[0089] In some cases, reductive amination can be used for bioconjugation. Amines can react reversibly with aldehydes to form a transient imine moiety, accompanied by the elimination of water. This reaction proceeds under rapid equilibrium, with the unconjugated starting material strongly favored under aqueous conditions due to the high water concentration. However, in a second step, the unstable imine can be irreversibly reduced to the corresponding amine by treatment with sodium cyanoborohydride. This mild reducing agent selectively reduces imines even in the presence of unreacted aldehydes. As a result, irreversible conjugation of biomolecules to the target biomaterial can occur gradually. Conversely, stronger reducing agents such as sodium borohydride are also capable of reducing aldehydes. This two-step reductive amination process can also be used to modify ketones. For example, reductive amination has been primarily used to modify sodium periodate-treated alginate and chitosan backbones. By utilizing the terminal aldehyde / ketone generated in an open-chain form, the reaction order can also be reversed for the attachment of reducing sugars. For example, this strategy can be used to mimic the glycosylation and galactosylation patterns of native collagen in the ECM through reductive amination of maltose and lactose, respectively.

[0090] In some cases, isothiocyanates of biomolecules or solid supports can be used for bioconjugation. For example, an isothiocyanate of a biomolecule can react with a nucleophile such as an amine, a sulfhydryl, a phenolate ion of a tyrosine side chain, or other biomolecule to form a stable bond between the two molecules.

[0091] In some cases, isocyanates of biomolecules or solid supports can be used for bioconjugation. For example, isocyanates can react with amine-containing molecules to form stable isourea bonds.

[0092] In some cases, acyl azides of biomolecules or solid supports can be used for bioconjugation. For example, acyl azides are activated carboxylate groups that can react with primary amines to form amide bonds.

[0093] In some cases, amides of biomolecules or solid supports can be used for bioconjugation. For example, reactive N-hydroxysuccinimide (NHS) esters are particularly widely used. Although NHS-esters can be preformed, they are often generated in situ using N-(3-(dimethylamino)propyl)-N'-ethylcarbodiimide (EDC) coupling chemistry and coupled directly to the target substance. Although the formation of activated NHS-esters is favored under weakly acidic conditions (pH approximately 5), the subsequent amide coupling is accelerated at higher pH, at which the amine coupling partner is not protonated. One-step modification at a moderate pH of approximately 6.5 is possible. Conjugation is typically performed by first forming the active NHS-ester at pH 5, then raising the pH to approximately 8 and adding the amine coupling partner in a two-step procedure. In some cases, the water-soluble derivative sulfo-NHS can be used as an alternative. In some cases, NHS esters of biomolecules can react and couple with the -OH groups of tyrosine, serine, and threonine opposite the N-terminal α-amine and the ε-amine of the lysine side chain.

[0094] In some cases, sulfonyl chlorides of biomolecules or solid supports can be used for bioconjugation. For example, the reaction of sulfonyl chloride compounds with primary amine-containing molecules proceeds with the loss of a chlorine atom and the formation of a sulfonamide bond.

[0095] In some cases, tosylate esters of biomolecules or solid supports can be used for bioconjugation. For example, reactive groups comprising tosylate esters can be formed by reacting 4-toluenesulfonyl chloride (also known as tosyl chloride or TsCl) with hydroxyl groups to form sulfonyl ester derivatives. Sulfonyl esters can be coupled with nucleophiles to produce covalent bonds and can result in secondary amine bonds with primary amines, thioether bonds with sulfhydryl groups, or ether bonds with hydroxyl groups.

[0096] In some cases, carbonyl groups on biomolecules or solid supports can be used for bioconjugation. For example, carbonyl groups such as aldehydes, ketones, and glyoxal can react with amines to form Schiff base intermediates that are in equilibrium with their free forms. In some cases, the addition of sodium borohydride or sodium cyanoborohydride to a reaction medium containing an aldehyde compound and an amine-containing molecule results in the reduction of the Schiff base intermediate and the formation of a covalent bond, thereby forming a secondary amine bond between the two molecules. In some cases, epoxides or oxiranes of biomolecules or solid supports can be used for bioconjugation. For example, epoxide or oxirane groups of biomolecules can react with nucleophiles through a ring-opening process. The reaction can occur with primary amines, sulfhydryls, or hydroxyls to form secondary amine bonds, thioether bonds, or ether bonds, respectively.

[0097] In some cases, carbonates of biomolecules or solid supports can be used for bioconjugation. For example, carbonates can react with nucleophiles to form carbamate bonds, i.e., disuccinimidyl carbonates, which can be used to activate hydroxyl-containing molecules to form amine-reactive succinimidyl carbonate intermediates. In some cases, the carbonate activation procedure can be used to couple polyethylene glycol (PEG) to proteins and other amine-containing molecules. In some cases, nucleophiles (e.g., primary amino groups of proteins) can react with succinimidyl carbonate functional groups to form stable carbamate (aliphatic urethane) bonds.

[0098] In some cases, aryl halides of biomolecules or solid supports can be used for bioconjugation. For example, aryl halides such as fluorobenzene derivatives can be used to form covalent bonds with amine-containing molecules such as proteins. Other nucleophiles of amino acid side chains (such as thiols, imidazoles, and phenolate groups) can also react to form stable bonds with biomolecules or solid supports. In some cases, fluorobenzene-type compounds have been used as functional groups in homobifunctional cross-linking agents. For example, their reaction with amines involves nucleophilic substitution of the fluorine atom by an amine derivative, resulting in a substituted arylamine bond.

[0099] In some cases, imidoesters of biomolecules or solid supports can be used for bioconjugation. For example, α-amines and ε-amines of proteins can be targeted and crosslinked by reacting with homobifunctional imidoesters. In some cases, after conjugating two proteins using a bifunctional imidoester crosslinker, excess imidoester functionality can be blocked with ethanolamine.

[0100] In some cases, carbodiimide can be used for bioconjugation. Generally, carbodiimide is a zero-length cross-linking agent, which can be used to mediate the formation of amide or phosphoramidate bonds between a carboxylate group and an amine or between a phosphate and an amine. Carbodiimide is a zero-length reagent because other chemical structures are not introduced between the conjugated molecules when these bonds are formed. In some cases, N-substituted carbodiimides can react with carboxylic acids to form highly reactive O-acylisourea derivatives. Then, the active substance can react with nucleophilic reagents such as primary amines to form amide bonds. In some cases, sulfhydryl groups can attack active substances and form thioester bonds. In some cases, carbodiimide-mediated reactions can also be used to couple hydrazide-containing compounds with carboxylate groups. Using bifunctional hydrazide reagents, carboxylate can be modified to have a terminal hydrazide group that can be conjugated with other carbonyl compounds.

[0101] In some cases, biomolecules containing phosphate groups (such as the 5' phosphate of oligonucleotides) can also be conjugated to amine-containing molecules using carbodiimide-mediated reactions. For example, carbodiimides of biomolecules can activate phosphates to intermediate phosphates, similar to their reactions with carboxylates. In the presence of amines, esters react to form stable phosphoramidate bonds.

[0102] In some cases, anhydrides of biomolecules or solid supports can be used for bioconjugation. Anhydrides are highly reactive towards nucleophiles and can acylate many important functional groups of proteins and other biomolecules. For example, protein functional groups that can react with anhydrides include, but are not limited to, α-amines at the N-terminus, ε-amines of lysine side chains, cysteine ​​sulfhydryls, phenolate ions of tyrosine residues, and imidazolyl rings of histidine. In some cases, the reactive site of anhydrides in protein molecules is modification of any attached carbohydrate chain. In some cases, in addition to amino modifications in polypeptide chains, glycoproteins can also be modified on their polysaccharide hydroxyl groups to form esterified derivatives.

[0103] In some cases, fluorophenyl esters of biomolecules or solid supports can be used for bioconjugation. Fluorophenyl esters can be another type of carboxylic acid derivative that can react with amines. They consist of esters of fluorophenol compounds, forming groups that can form amide bonds with proteins and other molecules. In some cases, the fluorophenyl esters can be: pentafluorophenyl (PFP) esters, tetrafluorophenyl (TFP) esters, or sulfotetrafluorophenyl (STP) esters. In some cases, fluorophenyl esters react with amine-containing molecules at slightly basic pH to produce amide bonds similar to NHS esters.

[0104] In some cases, hydroxymethylphosphines of biomolecules or solid supports can be used for bioconjugation. Phosphine derivatives with hydroxymethyl substituents can serve as bioconjugation reagents for coupling or cross-linking purposes. For example, tris(hydroxymethyl)phosphine (THP) and β-[tris(hydroxymethyl)phosphino]propionic acid (THPP) are small trifunctional compounds that react spontaneously with nucleophiles such as amines to form covalent bonds.

[0105] In some cases, the thiol reactivity of biomolecules or solid supports can be used for bioconjugation. For example, the thiol group of cysteine ​​is the most nucleophilic functional group found among the 20 proteinogenic amino acids. Selective modification of other nucleophilic residues such as lysine can be easily achieved by careful control of pH. As another example, thiol modification of oligonucleotides can be used to achieve derivatization, although the ease with which alternative reactive handles with enhanced chemical orthogonality can be installed limits their use for biomaterial conjugation. In addition, the conjugation addition of thiols to α, β unsaturated carbonyl groups (also known as Michael addition) can be used to form polypeptide conjugates in the fields of tissue engineering, functional materials and protein modification. In general, the reaction rate and conjugation efficiency are mainly controlled by three factors, which can be modified as needed: (i) the pK of the thiol; a ; (ii) the electrophilicity of the Michael acceptor; and (iii) the choice of catalyst. Regarding (i): the thiol anion is the active nucleophile in the Michael addition process, and the tendency of the thiol to undergo deprotonation can determine the concentration of the thiol and thus the reaction rate. For example, the lower pK of aromatic thiols compared to their aliphatic counterparts a This results in a higher reaction rate, while weak bases can be used to catalyze this. As a result, local structure can significantly alter conjugation efficiency, especially for polypeptide substrates. The pK of cysteine-containing peptides can be significantly altered by judicious selection of surrounding amino acids. a and reactivity, the presence of positively charged amino acids (e.g., lysine and arginine) decreases the thiol pK a and thereby enhance reactivity. Regarding (ii): The Michael acceptor becomes more electron-deficient and more reactive to nucleophilic attack, thus increasing the reaction rate. Among the most widely used acceptors in the biomaterials field, the reactivity trend can be summarized as: maleimide > vinyl sulfone > acrylate > acrylamide > methacrylate. Regarding (iii), Michael addition can be accelerated by either alkaline or nucleophilic catalysis (although both work by increasing the concentration of the reactive thiolate).

[0106] In some cases, the unique nucleophilicity of thiols can be exploited to react selectively with a number of alternative electrophilic reagents, allowing efficient and selective biomolecule attachment. For example, one such group is α-halocarbonyl, of which iodoacetamide reagents are particularly useful. Using less electrophilic bromine or even chlorine derivatives can achieve higher thiol selectivity, although reactivity is also greatly reduced. Recently, methylsulfonyl heteroaromatic derivatives have become promising reagents for thiol-specific conjugation. In other cases, alternative thiol-reactive handles such as disulfide-bridged pyridazinediones, carbonyl acrylic acid reagents, and cyclopropenyl ketones can be used for bioconjugation.

[0107] In some cases, the sulfhydryl group of biomolecules or solid supports can be used for bioconjugation. In some cases, three forms of activated halogen derivatives can be used to generate sulfhydryl reactive compounds: haloacetyl, benzyl halide and alkyl halide. In each of these compounds, the halogen group can be easily replaced by an aggressive nucleophilic substance to form an alkylated derivative (wherein X is a halogen, and hydrogen is from a nucleophilic reagent) with HX loss. Haloacetyl compounds and benzyl halide are typically derivatives of iodine or bromine, while halogenated mustards mainly adopt the form of chlorine and bromine. Iodoacetyl has also been successfully used for coupling affinity ligands to chromatographic supports.

[0108] In some cases, maleimides of biomolecules or solid supports can be used for bioconjugation. The double bond of maleimide can undergo alkylation reaction with sulfhydryl groups to form a stable thioether bond.

[0109] In some cases, aziridines of biomolecules or solid supports can be used for bioconjugation. The highly hindered nature of this heterocycle makes it highly reactive toward nucleophiles. For example, sulfhydryl groups react with aziridine-containing reagents during ring-opening to form thioether bonds. The simplest aziridine compound, ethyleneimine, can be used to convert available sulfhydryl groups into amines. In some cases, substituted aziridines can be used to form homobifunctional and trifunctional crosslinkers.

[0110] In some cases, due to the value of the biomolecule matrix, the thiol-maleimide reaction is particularly useful for conjugation at low concentrations or when extremely high efficiency is required. The use of maleimides in bioconjugation has been further enhanced by the ease with which maleimides can be introduced into a wide range of scaffold materials by modifying amines with a bifunctional reagent (succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate, more commonly referred to as SMCC). For example, this reagent has been widely used to first introduce maleimide-reactive handles on selected biomaterials, and then enable the attachment of both peptides and growth factors to create bioactive scaffolds.

[0111] In some cases, the acryloyl group of a biomolecule or solid support can be used for bioconjugation. Reactive double bonds can react with sulfhydryl groups. In some cases, the reaction of acryloyl compounds with sulfhydryl groups occurs in the presence of stable thioether bonds. In some cases, acryloyl groups have been found to be used in the design of the sulfhydryl-reactive fluorescent probe 6-acryloyl-2-dimethylaminonaphthalene.

[0112] In some cases, aryl groups of biomolecules or solid supports can be used for bioconjugation with sulfhydryl groups. Although aryl halides are commonly used to modify amine-containing molecules to form arylamine derivatives, they can also react very easily with sulfhydryl groups. For example, fluorobenzene-type compounds have been used as functional groups in homobifunctional cross-linkers. Their reaction with nucleophiles involves bimolecular nucleophilic substitution, resulting in the replacement of fluorine atoms by sulfhydryl derivatives and the generation of substituted aryl bonds. Conjugates formed with sulfhydryl groups can be reversed by cleavage with excess thiols (e.g., DTT).

[0113] In some cases, disulfide groups on biomolecules or solid supports can be used for bioconjugation. In some cases, compounds containing disulfide groups can participate in disulfide exchange reactions with another thiol. The disulfide exchange (also known as interconversion) process involves the attack of a disulfide by a thiol, breaking the -S–S- bond and subsequently forming a new mixed disulfide containing a portion of the original disulfide compound. Reduction of disulfide groups in proteins to sulfhydryls using thiol-containing reducing agents proceeds through the formation of mixed disulfide intermediates. In some cases, crosslinking or modification reactions can utilize the disulfide exchange process to form disulfide bonds with sulfhydryl-containing molecules.

[0114] In some cases, disulfide bonds can be used for bioconjugation. For example, disulfide exchange reactions can be used to facilitate the introduction of target peptides or proteins. The most commonly used reagents in tissue engineering are based on reactive pyridylthiodisulfides, which rapidly undergo thiol exchange to release 2-mercaptopyridine, which has poor nucleophilicity and spectrally active properties. In addition, due to the reversibility of disulfide bond formation, cleavage can be controlled with time precision by adding reducing agents such as dithiothreitol (DTT) or glutathione.

[0115] In some cases, pyridyl dithiol functional groups can be used to construct crosslinkers or modifiers for bioconjugation. Pyridyl disulfides can be generated from available primary amines on a molecule through the tandem reaction of 2-iminothiolane and 4,4'-dipyridyl disulfide. For example, the simultaneous reaction between a protein or other biomolecule, 2-iminothiolane, and 4,4'-dipyridyl disulfide produces a modification containing a reactive pyridyl disulfide group in a single step. Pyridyl disulfides will readily undergo exchange reactions with free sulfhydryl groups, resulting in a single mixed disulfide product.

[0116] In some cases, sulfhydryl groups activated by the leaving group 5-thio-2-nitrobenzoic acid can be used to couple free thiols via disulfide exchange similar to the pyridyl disulfides described herein. The disulfide of the Ellman reagent readily undergoes disulfide exchange with free sulfhydryls to form mixed disulfides and simultaneously release a chromogenic species, 5-thio-2-nitrobenzoate, also known as 5-thio-2-nitrobenzoic acid (TNB). The TNB-thiol group can then exchange with a sulfhydryl-containing target molecule, resulting in a disulfide crosslink. After coupling with the sulfhydryl compound, the TNB group is released.

[0117] In some cases, disulfide reduction can be performed using thiol-containing compounds such as TCEP, DTT, 2-mercaptoethanol, or 2-mercaptoethylamine.

[0118] In some cases, the vinyl sulfone groups of biomolecules or solid supports can be used for bioconjugation. For example, Michael addition of thiols to activated vinyl sulfones has been used to form biomolecule-material conjugates, which shows that cysteine-terminated peptides can cross-link vinyl sulfone-functionalized multi-arm PEG to form protease-responsive hydrogels, thereby achieving cell invasion during tissue growth. In some cases, in addition to thiols, vinyl sulfone groups can also react with amines and hydroxyls under higher pH conditions. The reaction product of thiols and vinyl sulfones gives a single stereoisomer structure. In addition, cross-linkers and modifiers containing vinyl sulfones can be used to activate surfaces or molecules to contain thiol-reactive groups.

[0119] In some cases, thiol-containing biomolecules can interact with metal ions and metal surfaces to form coordinate bonds for bioconjugation. In some cases, oxygen- and nitrogen-containing organic or biomolecules can be used to chelate metal ions, for example, in the form of various lanthanide chelates, bifunctional metal chelate compounds, and FeBABEs. In addition, amino acid side chains and prosthetic groups in proteins often form bioinorganic motifs by coordinating metal ions as part of the active site.

[0120] In some cases, thiol organic compounds can be routinely used to coat metal surfaces or particles to form a biocompatible layer or to generate functional groups for further conjugation of biomolecules. For example, thiol-containing aliphatic / PEG linkers have been used to form self-assembled monolayers (SAMs) on planar gold surfaces and particles.

[0121] In some cases, a number of alternative coupling systems are available for biomolecule functionalization. These include the use of O-nitrophenyl esters (which have reduced stability under aqueous conditions) or 1,1′-carbonyldiimidazole (CDI) to form amine-bridged carbamate bonds instead of amides. Hydrazines can also be used in place of amines in EDC / NHS-mediated coupling processes. Hydrazine-functionalized peptides can be coupled to biomaterials in a single step at pH 5-6. In this way, a certain degree of site selectivity can be achieved for existing lysine residues. Madl and colleagues have successfully implemented this approach to conjugate reactive groups to alginate hydrogels, enabling indirect functionalization with growth factors and adhesion peptides.

[0122] In some cases, N-terminal modifications of biomolecules can be used for bioconjugation. For example, 2-pyridinecarboxaldehyde-modified acrylamide hydrogels can react specifically with the N-termini of ECM proteins to form cyclic imidazolinone products with adjacent amide bonds, enabling the directed display of these key bioinstructive motifs.

[0123] In some cases, acrylates, acrylamides, and methacrylates of biomolecules or solid supports can be used for bioconjugation. In some cases, thiol-yne groups of biomolecules or solid supports can be used for bioconjugation.

[0124] In some cases, thiol-reactive conjugation (e.g., native chemical ligation (NCL)) can be utilized to attach peptides and proteins to biomaterial backbones through peptide bond formation. For example, a peptide with a C-terminal thioester reacts with an N-terminal cysteine ​​residue in another peptide to undergo a trans-thioesterification reaction, which results in the formation of an intermediate thioester with a cysteine ​​thiol.

[0125] In some cases, the strong binding of (streptavidin) can be used for the bioconjugation of small molecule biotin. In some cases, (streptavidin) and biotin can be attached to biomolecules or solid supports for bioconjugation. In some cases, functional biotin groups can be added to proteins, nucleic acids and other biomolecules by modifiers. In some cases, depending on the functionality present on the biotinylated compound, specific reactive groups on antibodies or other proteins can be modified to form (streptavidin) avidin binding sites. Amines, carboxylates, sulfhydryls and carbohydrate groups can be specifically targeted for biotinylation by the appropriate selection of biotin derivatives. In some cases, biotin groups are non-selectively added to molecules that do not contain convenient functional groups for modification using photoreactive biotinylation reagents. In some cases, biotin-binding proteins can be fixed on surfaces, chromatographic supports, microparticles and nanoparticles to be used in coupled biotinylated molecules. In some cases, a series of (strept)avidin-biotin interactions can be established with each other to take advantage of the multivalent nature of each tetrameric (strept)avidin molecule and enhance the detection ability of the target. In some cases, amine-reactive biotinylation reagents that can contain reactive groups of the biotin pentanoic acid side chain are capable of forming covalent bonds with primary amines in proteins and other molecules. In some cases, NHS esters react spontaneously with amines to form amide bonds, while carboxylate-containing biotin compounds can be coupled to amines using EDC through a carbodiimide-mediated reaction. In some cases, NHS-iminobiotin can be used to label amine-containing molecules with an iminobiotin tag, thereby providing reversible binding potential with avidin or streptavidin. In some cases, sulfo-NHS-SS-biotin (also known as NHS-SS-biotin) is sulfosuccinimidyl-2 (biotinamido) ethyl-1,3-dithiopropionate, a long-chain cleavable biotinylation reagent that can be used to modify amine-containing proteins and other molecules. In some cases, 1-biotinamido-4-[4′-(maleimidomethyl)cyclohexane-carboxamido]butane (a biotinylation reagent containing a maleimide group at the end of an extended spacer arm) reacts with sulfhydryl groups in proteins and other molecules to form stable thioether bonds. In some cases, N-[6-(biotinamido)hexyl]-3′-(2′-pyridyldithio)propionamide, where the reagent contains a 1,6-diaminohexane spacer attached to the pentanoic acid side chain of biotin, can be further modified by amide bonding with an acid precursor of SPDP to generate a terminal sulfhydryl-reactive group. The pyridyl disulfide terminus of biotin-HPDP can react with free thiol groups in proteins and other molecules to form disulfide bonds with the loss of pyridine-2-thione.

[0126] In some cases, carboxylate esters of biomolecules or solid supports can be used for bioconjugation. In some cases, diazomethane and other diazoalkyl derivatives can be used to label carboxylate groups. In some cases, N,N′-carbonyldiimidazole (CDI) can be used to react with carboxylic acids under nonaqueous conditions to form highly reactive N-acylimidazoles. The activated carboxylate can then react with amines to form amide bonds or with hydroxyl groups to form ester bonds. Additionally, activation of styrene / 4-vinylbenzoic acid copolymers with CDI can be used to immobilize the enzyme lysozyme or other biomolecules to carboxyl groups on a matrix via their available amino groups.

[0127] In some cases, carbodiimides are used as zero-length cross-linkers that can activate carboxylate groups for coupling to amine-containing compounds or solid supports for bioconjugation. In some cases, carbodiimides are used to mediate the formation of amide or phosphoramidate bonds between carboxylates and amines or between phosphates and amines.

[0128] In some cases, N,N′-disuccinimidyl carbonate or N-hydroxysuccinimidyl chloroformate can be used for bioconjugation. N,N′-disuccinimidyl carbonate (DSC) consists of a carbonyl group containing essentially two NHS esters. The compound is highly reactive toward nucleophiles. In aqueous solution, DSC will hydrolyze to form two molecules of N-hydroxysuccinimide (NHS) and release one molecule of CO2. In non-aqueous environments, the reagent can be used to activate the hydroxyl group to a succinimidyl carbonate derivative. The DSC-activated hydroxy compound can be used to conjugate with amine-containing molecules to form a stable cross-linked product.

[0129] In some cases, sodium periodate can be used to oxidize hydroxyl groups on adjacent carbon atoms to form reactive aldehyde residues suitable for coupling to amine- or hydrazide-containing molecules for bioconjugation. For example, these reactions can be used to create crosslinking sites in carbohydrates or glycoproteins for subsequent conjugation of amine-containing molecules via reductive amination.

[0130] In some cases, enzymes can be used to oxidize hydroxyl-containing carbohydrates to generate aldehyde groups for bioconjugation. For example, galactose oxidase reacts on terminal galactose or N-acetyl-d-galactose residues to form C-6 aldehyde groups on the polysaccharide chain. These groups can then be used for conjugation reactions with amine- or hydrazide-containing molecules.

[0131] In some cases, reactive alkyl halide compounds can be used to specifically modify hydroxyl groups in carbohydrates, polymers, and other biomolecules for bioconjugation.

[0132] In some cases, aldehydes or ketones of biomolecules or solid supports can be used for bioconjugation. For example, hydrazine derivatives, particularly hydrazide compounds formed from carboxylate groups, can react specifically with aldehyde or ketone functional groups in target biomolecules. To further stabilize the bond between the hydrazide and aldehyde, hydrazones can be reacted with sodium cyanoborohydride to reduce the double bond and form a strong covalent bond.

[0133] In some cases, aminooxy groups of biomolecules or solid supports can be used for bioconjugation. For example, the chemoselective ligation reaction between an aldehyde group and an aminooxy group produces an oxime bond (aldoxime), which has been used in many bioconjugation reactions and the coupling of ligands to insoluble supports (including surfaces). The reaction is also very effective in the case of ketones to form oximes known as ketoximes.

[0134] In some cases, cycloaddition reactions can be used for bioconjugation. In cycloaddition reactions for bioconjugation, two or more unsaturated molecules are brought together to form a cyclic product with reduced unsaturation. These required reaction partners are often not found in natural systems, so using cycloadditions for conjugation requires the introduction of non-natural functionality into the biomolecular coupling partner.

[0135] In some cases, copper-catalyzed azide-alkyne cycloadditions can be used for bioconjugation. In some cases, the (3+2) cycloaddition reaction between azide and alkyne proceeds spontaneously at elevated temperatures (>90°C), producing a mixture of two triazole isomers. In some cases, the reaction is performed at room temperature, in ambient, oxygenated, and / or aqueous environments. In some cases, for example, peptide-material conjugates are formed via CuAAC, using alkynyl-terminated peptides to form hydrogels with azide-functionalized PEG. In some cases, CuAAC has been widely used to functionalize scaffolds with alkyne- and azide-functionalized peptides and carbohydrates, in part because the amino acids azidolysine and homopropargylglycine can be easily introduced via solid-phase peptide synthesis. In some cases, the required copper(I) catalyst for biomaterial conjugation via CuAAC can be added directly or generated in situ by reducing an initial copper(II) complex (most commonly using ascorbic acid). The addition of a reducing agent further reduces the sensitivity of the CuAAC ligation to oxygen. Although no additional ligand is required for the formation of the triazole, the addition of tertiary amine-based ligands can be used.

[0136] In some cases, strain-promoted azide-alkyne cycloadducts (SPAAC) can be used for bioconjugation. In some cases, under physiological conditions, highly strained cyclooctynes ​​readily react with azides to form triazoles without the addition of any catalyst. In some cases, in addition to using SPAAC for peptide conjugation, many well-known reports have also used SPAAC to conjugate protein matrices to cyclooctyne-functionalized biomaterials by introducing non-natural azide motifs into protein coupling partners. For example, in some cases, this can be achieved by maleimide functionalization including the natural cysteine ​​present in bone morphogenetic protein 2 (BMP-2), by enzyme-mediated N-terminal modification of IFN-γ, or by codon redistribution with the non-natural amino acid 4-azidophenylalanine in many protein matrices. In some cases, supramolecular host-guest interactions can also be used to promote azide-alkyne cycloadditions. For example, efficient cycloadditions can be achieved on protein surfaces by bringing two reactive partners into close proximity within the cavity of a cucurbit[6]uril host, a strategy that can be extended to other suitable biomolecules.

[0137] In some cases, the inverse electron demand Diels-Alder reaction (IEDDA) can be used for bioconjugation. For example, the inverse electron demand Diels-Alder reaction (IEDDA) between 1,2,4,5-tetrazine and strained olefins or alkynes can be used. A variety of suitable derivatives for biomolecule conjugation have been reported, for example, a series of trans-cyclooctenes with increasing strain (and therefore reactivity) can be used. In some cases, functionalized norbornene derivatives can be used to perform the IEDDA reaction. In some cases, triazines can be used. In some cases, spirohexene can be used. These strategies can be extended to other suitable biomolecules. In some cases, hetero-Diels-Alder cycloadditions of maleimides and furans can be used for bioconjugation. For example, the coupling of furan-functionalized RGDS peptides with maleimide-functionalized PEG-hydrogels can be utilized, and this strategy can be extended to other suitable biomolecules. In some cases, furan-functionalized hyaluronic acid hydrogels can be cross-linked with bismaleimide-functionalized peptides via a Diels-Alder cycloaddition reaction. MMP-cleavable peptides enable migration of cancer seeds through the gel.

[0138] In some cases, the formation of oximes and hydrazones can be used for bioconjugation. In some cases, peptides and DNA can be stably attached to biomaterials via hydrazone formation by bifunctional cross-linking, a strategy that can be extended to other suitable biomolecules. In some cases, the attachment of ketone- or aldehyde-modified green fluorescent protein (GFP) or metallothionein to hydroxylamine-functionalized synthetic polymers can be extended to other suitable biomolecules. For example, by oxime modification at the N- and C-termini of proteins, protein cross-linked hydrogels were produced.

[0139] In some cases, the Diels-Alder reaction consists of the covalent coupling of a diene and an olefin to form a six-membered ring complex for bioconjugation.

[0140] In some cases, transition metal complexes can be used for bioconjugation. The properties of late transition metals can make transition metal complexes very suitable for manipulating unsaturated and polarizable functional groups (olefins, alkynes, aryl iodides, arylboronic acids, etc.). For example, Pd(0)-functionalized microspheres can mediate the deprotection of allyl carbamates and the Suzuki-Miyaura cross-coupling in the cytoplasm. In other examples, ruthenium catalysts can be used to mediate the deprotection of allyl carbamates of caged fluorophores in living cells. In some cases, applications based on palladium in cell culture include copper-free Sonagashira coupling, extracellular Suzuki coupling on the surface of E. coli cells, and conjugation of thiol groups to allyl selenosulfate salts. In some cases, olefin metathesis can be used for bioconjugation. For example, using ruthenium complexes, S-allylcysteine ​​can be readily introduced into proteins by a variety of methods, including conjugated addition of allylthiol to dehydroalanine, direct allylation of cysteine, desulfurization of allylic disulfide, or metabolic incorporation as a methionine substitute in methionine auxotrophic Escherichia coli.

[0141] In some cases, complex formation with boronic acid derivatives can be used for bioconjugation. For example, boronic acid derivatives can form ring structures with other molecules having adjacent functional groups consisting of 1,2- or 1,3-diols, 1,2- or 1,3-hydroxy acids, 1,2- or 1,3-hydroxyamines, 1,2- or 1,3-hydroxyamides, 1,2- or 1,3-hydroxyoximes, and various sugars or biomolecules containing these substances.

[0142] In some cases, enzyme-mediated conjugation can be used for bioconjugation. For example, the transglutaminase family catalyzes the formation of isopeptide bonds between the primary amine of the lysine side chain and the amide bond of the complementary glutamine residue, and this strategy can be extended to other suitable biomolecules. In other cases, peroxidase-mediated conjugation can be used for bioconjugation. For example, horseradish peroxidase (HRP) can be used to oxidize a variety of organic matrices, such as the phenolic group of tyrosine, thereby producing highly reactive free radicals or quinone intermediates, which undergo spontaneous dimerization, resulting in the formation of adjacent carbon-carbon bonds between two tyrosine residues, and this strategy can be extended to other suitable biomolecules. In some cases, short peptide tags can be used for bioconjugation. These peptide tags can be as short as 5 amino acids in length and can be attached to peptides or protein matrices that allow them to be modified subsequently. In some cases, polymerization of low-molecular-weight monomers can be used for bioconjugation. Polymerization can be categorized as proceeding via either chain-growth or step-growth mechanisms. In chain-growth polymerization, monomers are added to the "living" ends of growing polymer chains, resulting in the formation of high-molecular-weight materials even at low conversion rates. In step-growth polymerization, short oligomer chains couple to form polymers, requiring high conversion rates to achieve high molecular weights. Both techniques can be used to form biomolecule-polymer conjugates. Polymerization of acrylate and methacrylate monomers has proven particularly effective. For example, acrylate- and methacrylate-modified peptides and glycans can be readily polymerized. Similarly, with the availability of synthetic oligonucleotide phosphoramidite building blocks, "Acrydites," free radical polymerization remains one of the most common methods for forming DNA- and RNA-functionalized biomaterials. By conducting polymerization in the presence of comonomers, the biomolecule presentation density can be easily tuned, overcoming potential difficulties caused by steric hindrance. Initiation of polymerization can be triggered by a variety of means, including heat, UV and visible light, redox reactions, and electrochemistry. Acrylate-modified proteins can also be polymerized to produce functional materials while retaining biological activity. In some cases, living radical polymerization (LRP) can be used for bioconjugation. For example, the most commonly used LRPs for forming bioconjugates include atom transfer radical polymerization (ATRP), reversible addition-fragmentation chain transfer (RAFT) polymerization, and nitroxide-mediated polymerization (NMP).

[0143] In some cases, photoconjugation can be used for bioconjugation. In some cases, polymerization is initiated by the generation of free radicals, which then propagate through bond formation to produce active polymer chains. The initiation step can be induced by a variety of stimuli, the most common of which are thermal decomposition, redox activation, and electrochemical ionization of the initiating species. Alternatively, many initiators can be activated by light-induced photolysis bond cleavage (Type I) or photosensitized proton extraction from a co-initiator (Type II). Photoinitiation provides the following benefits: it can be used over a wide temperature range, uses a narrow and adjustable activation wavelength depending on the initiator used, rapidly generates free radicals, and has the ability to control polymerization by removing the light source. Importantly, the tolerance of polymerization to oxygen is greatly enhanced, enabling polymerization in the presence of cells and tissues. Incorporation of acrylate-functionalized peptides and proteins during photopolymerization can be used as a method for producing biomaterial conjugates. Alternatively, photoinitiated attachment of peptides to vinyl side groups on preformed materials has also been widely reported, and has recently been used for 3D patterning by two-photon excitation. A variety of photoinitiators can be used in photoconjugation. For example, but not limited to, Eosin Y, 2,2-dimethoxy-2-phenyl-acetophenone, Igracure D2959, lithium phenyl-2,4,6-trimethylbenzoylphosphinate, and riboflavin can be used as photoinitiators. Photoinitiators typically absorb light to initiate the photoreaction process. In some cases, photoconjugation can utilize a photothiol-ene reaction. Thiols can also react with alkenes via a free radical mechanism. First, a thiol radical reacts with an alkene to form a carbon-centered free radical, which can then extract a proton from another thiol and thus propagate the reaction. Electron-rich alkenes can accelerate the photothiol-ene reaction, generating unstable carbon radical intermediates that can rapidly extract a thiol hydrogen. The exception to this rule is norbornene derivatives, where reactivity is driven by the release of ring strain after thiol addition. This leads to a general trend of reactivity of norbornene > vinyl ether > propenyl > allyl ether > acrylate > maleimide. Norbornene and allyloxycarbonyl (alloc group) have been particularly widely used for the functionalization of peptide / protein biomaterials, respectively, because the contribution of chain transfer is almost negligible and they are easy to introduce during peptide synthesis. For example, the alloc group, which is commonly used as an orthogonal lysine protecting group during solid-phase peptide synthesis, is an effective photothiol-ene reactive handle. In other examples, the norbornene photothiol-ene reaction can be used for the tethering and spatial patterning of bioactive peptides and growth factor proteins. In addition to the most commonly used alloc group and norbornene reactive group, other alkenes have also been used for biomaterial functionalization. For example, codon redistribution has been used to site-specifically incorporate allyl-cysteine ​​residues into proteins, which can then be conjugated using a photothiol-ene reaction.Alternatively, acrylates can undergo mixed-mode photopolymerization in the presence of cysteine-terminated peptides, while allyl disulfide structures have recently been shown to allow reversible and controlled conjugated thiol exchange.

[0144] In some cases, aryl azides or halogenated aryl azides of biomolecules or solid supports can be used for bioconjugation.

[0145] In some cases, the photoreactive group benzophenone can be used for bioconjugation.

[0146] In some cases, the photoreactive group anthraquinone can be used for bioconjugation.

[0147] In some cases, photothiol-yne reactions can be used for bioconjugation. Most examples of photothiol-yne reactions utilize simple propargyl-ether or propargyl-amine reactive handles.

[0148] In some cases, photocaging and activation of reactive functionalities can be used for bioconjugation. Typically, both acrylate- and thiol-derived free radicals form transient reactive species. In some cases, photocaging can be used to mask or protect functional groups until they are exposed. In some cases, the most widely used cages are based on o-nitrobenzyl and coumarin chromophores. For example, nitrobenzyl-terminated cysteine ​​residues can be de-caged by irradiation with 325nm UV light, and the released thiol can then react with maleimide-functionalized peptides via Michael addition to generate patterned hydrogels capable of guiding cell migration. In some cases, 6-bromo-hydroxycoumarin can be used for thiol caging. In some cases, photoaffinity probes can be used for bioconjugation, where highly reactive intermediates react rapidly with the closest accessible functional groups with a high degree of spatial precision after irradiation. In some cases, phenyl azide, benzophenone, and phenyldiazirconium are the most commonly used. In some cases, photocaged cycloadditions can be used. For example, UV irradiation of tetrazoles has been shown to generate reactive nitrile-imine intermediates that can undergo rapid cycloadditions with electron-deficient olefins such as acrylates or acrylamides. In some cases, the side reaction of nitrile-imines with thiols can be used to site-specifically conjugate cysteine-containing proteins to tetrazole-functionalized surfaces.

[0149] In some cases, non-covalent interactions can be used for bioconjugation. In some cases, non-covalent binding plays a vital role in controlling biomolecular interfaces and influencing protein-protein interactions, DNA-DNA complexation, DNA-protein interfaces, protein localization, etc. in cells. In some cases, non-covalent sequences that exhibit binding affinity for target biomolecules allow for post-production modification or simple isolation of natural biomolecules from the surrounding environment in biological samples. The most commonly used binding sequences are short peptides of 7 to 20 amino acids in length, which are derived from a variety of sources, including known protein binding domains present in vivo or identified by techniques such as phage display. In some cases, short oligonucleotides called aptamers can also be used to bind to a variety of protein matrices, including the cytokines vascular endothelial growth factor (VEGF) and platelet-derived growth factor (PDGF) and cell surface proteins such as epidermal growth factor receptor (EGFR). In some cases, binding sequences can also be introduced into biomaterials through affinity with natural biopolymers (such as heparin). In some cases, by first inducing biopolymer binding, it is then possible to control the adsorption of added or endogenous growth factors or signaling proteins to the biomaterial backbone. In some cases, binding affinity at the amino acid level can also be exploited to enable conjugation of peptides and proteins to certain biomaterial matrices. For example, the conjugation of amino acids based on non-natural catechols can be used to induce binding to bioglass and metal implants containing metal oxides, thereby enhancing the bioactivity of these important technologies.

[0150] In some cases, self-assembling peptides can be used for bioconjugation. For example, natural peptides and proteins adopt a range of secondary structures, including β-sheets and α-helices, which can both stabilize individual sequences and control interprotein aggregation. In some cases, self-assembling peptides have been widely used to assemble hydrogels and fiber materials. In many of these structures, biological epitopes or functional groups can be attached to some or all of the peptide building blocks during peptide synthesis to add desired biological activity to the system. Peptide ligands ranging from simple adhesion motifs to laminin-derived epitopes and growth factor mimics have been displayed on the surface of self-assembling fibers. Alternatively, glycopeptides can be assembled to recruit extracellular signaling proteins and growth factors, mimic glycosylation patterns in hyaluronic acid, or study optimal sulfonation rates in glycosaminoglycan backbones. In some cases, self-assembling domains can also be added to full-length proteins, resulting in the incorporation of side-chain functionality during hydrogel formation. In some cases, the propensity of peptides to form secondary structures is also exploited in non-self-assembling backbones. This can be achieved by incorporating self-assembling peptides into covalent hydrogels composed of non-interacting polymers (e.g., PEG interpenetrating networks) or systems where additional charge interactions further stabilize the final construct (e.g., between positively charged peptides and negatively charged alginate gel). Alternatively, helical side groups can be attached to covalent materials and used to drive the non-covalent attachment of bioactive groups (e.g., growth factors) through self-assembly into coiled-coil triple helices.

[0151] In some cases, host-guest chemistry can be used for bioconjugation. For example, the adhesion properties of β-cyclodextrin-modified alginate scaffolds can be controlled in situ by adding a guest naphthyl-functionalized RGDS peptide and subsequently introducing a non-cell-adhesive adamantane-RGES peptide with a higher host binding constant, enabling dynamic regulation of fibroblast attachment. The host-guest interaction between cyclodextrin and naphthyl-functionalized or adamantane-functionalized peptides allows for the functionalization of alginate, which can be applied to other suitable biomolecules.

[0152] In some cases, biotin-(streptavidin) avidin can be used for bioconjugation. For example, avidin and streptavidin are homotetrameric proteins that can simultaneously bind up to four molecules of their small molecule binding partner biotin. The small size of biotin (only 244Da mass) and the ease of functionalization by its free carboxylic acid have led to biotin-(streptavidin) avidin binding being widely used as a means for biomaterial conjugation. Streptavidin-protein fusion can be recombinantly produced and bound to a suitably functionalized surface to achieve conjugation. In some cases, biomolecule biotinylation is performed and the construct is then bound to a (streptavidin) avidin-functionalized surface. In some cases, this can be achieved by direct approaches, via chemical pre-conjugation of the material to (streptavidin) avidin or by utilizing the tetramer of (streptavidin) avidin to mediate indirect modification or cross-linking of the biotin-functionalized scaffold.

[0153] In some cases, nucleic acids can be used for bioconjugation. In some cases, nucleic acids themselves can also form assembly materials in a manner similar to self-assembling peptides to create tunable platforms for displaying biomolecules. In some cases, DNA-tagged peptides and growth factors can be conjugated to appropriately functionalized biomaterials and used to elicit desired biological effects on localized cell populations.

[0154] Typically, incorporating reactive handles can be used for bioconjugation. For example, unique reactive motifs are introduced into biomolecular matrices to provide chemical "tags", which enable single-site selectivity or specificity. In some cases, short peptides and oligonucleotides can generally be produced by solid phase synthesis (SPS). The versatility of organic synthesis overcomes the difficulties of incorporating reactive handles, where various appropriately functionalized amino acids and oligonucleotides as described herein are available. In some cases, an alternative approach is to introduce non-natural amino acids (UAAs) with desired reactive handles. This can be achieved by modifying lysine residues with amine-reactive derivatives. In some cases, using auxotrophic bacterial strains (which cannot biosynthesize specific amino acids and therefore need to be taken from growth medium), by starving bacteria for natural amino acids and supplementing them with structurally related non-natural analogs, bacterial cells can incorporate UAA during translation. This technology can be used to install methionine mimetics based on azide and alkynes, thereby introducing reactive handles for carrying out CuAAC and SPAAC reactions. Similar strategies can be used to incorporate non-natural monosaccharides, thereby achieving the remodeling of complex polysaccharides. In some cases, codon reassignment using an orthogonal tRNA and tRNA synthetase pair that selectively recognizes and charges UAA during translation is used. In some cases, this can be accomplished by replacing a tRNA from another kingdom with a tRNA from another kingdom. CUAThis is achieved by incorporating a tRNA synthetase / tRNA synthetase pair into the host cell to redistribute the amber stop codon UAG. This pair can install the desired UAA while being virtually invisible to the endogenous cellular machinery. As a result, site-directed mutagenesis can be used to introduce a single TAG codon at the desired position in the coding DNA, thereby single-introducing UAA with high specificity and selectivity.

[0155] In some cases, one or more functional groups release a reporter upon reaction with another functional group or with a SNAP or a biological or chemical entity. Release of the reporter upon conjugation of the SNAP to the biological or chemical entity can allow tracking of the reaction. In some cases, it is possible to monitor the degree of completion of the SNAP-biological / chemical entity conjugation reaction by monitoring the concentration of the free reporter. In some cases, the reporter fluoresces once released by the conjugation reaction.

[0156] In some cases, the biological or chemical entity can be functionalized with a linker. In some cases, functionalizing the biological or chemical entity with a linker can reduce steric hindrance. The linker can comprise a rigid or semi-rigid portion that can distance the biological or chemical entity from the SNAP. In some cases, the linker can be a long, medium, or short linker. In some cases, the linker can comprise one or more components selected from PEG, DNA, a short carboxyl group, a carbon chain, a peptoid, a spacer, and / or glycerol, among other examples.

[0157] In some cases, a SNAP, seed, and / or biological or chemical entity can be functionalized using a one-pot proteomics approach. One-pot proteomics approaches can result in very high functionalization efficiencies. In some cases, one-pot proteomics approaches can be used to functionalize biological or chemical entities with very low levels of entity loss.

[0158] In some embodiments, a SNAP is a polymer that can be grown from a seed. For example, if the seed is a DNA oligonucleotide, the SNAP can be a DNA molecule. In some cases, the SNAP can be a DNA molecule with regions of internal complementarity, allowing the molecule to self-hybridize. For example, a SNAP can be a DNA cluster formed by intramolecular self-hybridization. In some cases, a SNAP can be formed from DNA, RNA, L-DNA, L-RNA, LNA, PNA, or a mixture of two or more different types of nucleic acids. In some cases, a SNAP can have a repeating structure, such as a repeating sequence of nucleotides. In some cases, a SNAP can be an irregular polymer without a repeating sequence. For example, a SNAP can comprise a random sequence of nucleotides.

[0159] In some cases, SNAPs can be formed by rolling circle amplification. A plasmid or other circular nucleic acid molecule can be provided as a template together with a primer that binds to the circular nucleic acid molecule, wherein the primer comprises a functional group at the 5' end. A polymerase chain reaction (PCR) with a sufficiently long extension step, or only a polymerase extension reaction, is performed, which allows the functionalized primer to bind to the circular nucleic acid molecule and produce a single-stranded nucleic acid product. The length of the single-stranded nucleic acid product can be affected by varying the extension time, the polymerase used, or the reaction conditions. In some cases, the circular nucleic acid template comprises a region with internal complementarity, such that the single-stranded nucleic acid product will comprise a region that can self-hybridize. In some cases, the circular nucleic acid template is a dsDNA molecule. In some cases, the single-stranded nucleic acid product is an ssDNA molecule. In some cases, the polymerase used is a DNA polymerase.

[0160] In some cases, SNAPs can be formed from nucleic acid origami, or DNA origami. DNA origami generally refers to the nanoscale folding of DNA to create non-arbitrary two- and three-dimensional shapes at the nanoscale. The specificity of interactions between complementary base pairs makes DNA a useful building block. In some cases, the base sequence can be designed to control the interactions between different regions. DNA origami can be used to create scaffolds that hold other molecules in place or to generate structures on their own.

[0161] SNAPs as described herein may include those produced by nucleic acid origami. Generally, nucleic acid origami may refer to DNA origami, but may also refer to RNA origami, origami of combinations of DNA and RNA molecules, or origami of nucleic acid molecules other than DNA or RNA, such as silicon-based nucleic acids. Nucleic acid origami can produce nucleic acid molecules with engineered shapes. An engineered shape can be a shape that has been partially or completely planned. Planning of the shape can include planning or engineering which portion of the nucleic acid binds, which segment of the nucleic acid can fold, which segment of the nucleic acid can be single-stranded, which segment of the nucleic acid can be double-stranded, which segment of the nucleic acid can bind to a nucleic acid segment on the same strand, or which segment of the nucleic acid can bind to a nucleic acid segment on another strand. In some cases, non-nucleic acid molecules, such as proteins, can be used to facilitate the nucleic acid to become engineered.

[0162] Typically, nucleic acid origami may comprise at least one or more long nucleic acid chains and one or more short nucleic acid chains. Typically, these nucleic acid chains are single-stranded, but they may have segments that may be double-stranded. One of the short chains may include at least one first segment that may be complementary to the first segment of the long chain, and a second segment that may be complementary to the second segment of the long chain. When the short chain and the long chain are incubated under conditions that allow nucleotide hybridization, the shorter oligonucleotide may hybridize with the longer oligonucleotide. This hybridization can give the nucleic acid molecule a shape. For example, if the two segments on the first chain are separated, the two segments may be put together during hybridization to form a shape. In some cases, the short chain may be combined with at least 2, 3, 4, 5, or 6 segments, which may be combined with at least 2, 3, 4, 5, or 6 complementary segments of the long nucleic acid chain.

[0163] In some cases, the short strand can have one or more segments that are not complementary to the long strand. In this case, the segment that is not complementary to the long strand can be at least about 1, 2, 3, 4, 5, 10, 15 or 20 nucleotides long.

[0164] This process can be performed using at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300 or more short nucleic acid chains. These short nucleic acid chains can each be combined with one or more different sections of the long nucleic acid chain. Each short nucleic acid chain hybridized with the long nucleic acid chain can result in a fold in the long nucleic acid chain. In some cases, the number of short chains can be related to the complexity of the engineered shape. For example, an engineered shape with many folds can utilize more short nucleic acid chains than an engineered shape with few folds. The engineered shape can have at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300 or more folds.

[0165] In some cases, more than one long chain can be incorporated into a nucleic acid origami structure. This can be done, for example, to increase the complexity of the engineered shape, simplify the design or planning of the engineered shape, avoid generating a shape that is thermodynamically more stable than the desired engineered shape, make generating the engineered shape easier, or manage the cost of generating the engineered shape.

[0166] Incorporation of more than one long chain can be achieved by designing two or more long chains such that each chain has at least one segment that is complementary to a segment of the other chain, or by designing two or more long chains such that each chain has at least one segment that is complementary to a region of a short nucleic acid chain such that both long chains have segments that are complementary to the short nucleic acid chain.

[0167] A short nucleic acid strand can be complementary to one long nucleic acid strand or more than one long nucleic acid strand. In some cases, a short nucleic acid strand can also be complementary to one or more short nucleic acid strands.

[0168] The terms "long" and "short" herein refer to general terms. Long chains can be longer than short chains, but in some cases, the size of long chains can be the same as short chains. In some cases, long chains can be at least about 30, 40, 50, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000 or more nucleotides long. In some cases, short chains can be at least about 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100 or more nucleotides long.

[0169] The shape through through engineering approaches can be designed for a specific purpose. For example, the shape through through engineering approaches can be designed to support a load, encapsulate a molecule, bind a molecule, connect two or more molecules, fit into a cavity, bind projections or other purposes. The shape through through engineering approaches can be any shape, for example, oval, rectangular, circular, annular, spherical, flat, textured, smooth, symmetrical, asymmetrical, tapered or irregularly shaped. The shape through through engineering approaches can be a cube, pyramid, box, cage, ladder or tree.

[0170] The engineered shapes or SNAPs formed by nucleic acid origami as described above can be assembled. Assembly can refer to the process by which nucleic acid strands hybridize to each other to produce an engineered shape.

[0171] Engineered shapes, or SNAPs, can spontaneously self-assemble. Self-assembly occurs when long and short oligonucleotides with complementary regions are incubated together. During this spontaneous self-assembly process, the nucleotides hybridize and form the engineered shape without the aid of auxiliary molecules or catalysts. This self-assembly can occur under specific conditions or within a specific range of conditions. Conditions that can be considered when incubating DNA strands for self-assembly include salt concentration, temperature, and time.

[0172] Sometimes, assembly can utilize or require a catalyst. In this case, the catalyst can speed up the assembly process or ensure that the assembly results in a specific desired engineered shape. The catalyst can comprise RNA, DNA, or protein components.

[0173] The salt concentration during assembly can be less than 1 M, less than 0.5 M, less than 0.25 M, less than 0.1 M, less than 0.05 M, less than 0.01 M, less than 0.005 M, or less than 0.001 M.

[0174] The temperature during assembly can be at least room temperature. In some cases, the temperature during assembly can be at least about 50, 60, 70, 80, 85, 90 or 95°C. In some cases, the temperature during assembly can vary. For example, the temperature can be raised to at least about 20, 30, 40, 50, 60, 70, 80, 85, 90 or 95°C. This increase can ensure that the nucleic acid chain does not contain secondary structure before assembly. As described, once the temperature is raised, it can be reduced to, for example, about 20, 30, 40, 50, 60, 70 or 80°C. This reduction in temperature can allow nucleic acid hybridization. In some cases, the temperature reduction can be carried out over about 0.5, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 45 or 60 minutes.

[0175] Assembly can be performed stepwise. In this case, a subset of nucleic acid molecules can be first incubated together. After these molecules are hybridized, one or more additional nucleic acid molecules can be added and allowed to hybridize. In some cases, two or more assembled engineered shapes can be incubated together to assemble into a larger engineered shape.

[0176] In some cases, assembly can include fractal assembly. Fractal assembly can produce SNAPs, which can be arrays of engineered shapes. Assembly can be performed in stages, which can simplify the design process or ensure correct assembly. Such arrays can be assembled in at least 1, 2, 3, 4, 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 1000 or more stages. In some cases, the number of stages used can be correlated with a reduction in spurious interactions. This may be due to a reduction in the total number of possible reactions at any given time.

[0177] SNAPs can be assembled into arrays of at least 3 x 3, at least 5 x 5, at least 10 x 10, at least 50 x 50, at least 100 x 100, or at least 1000 x 1000 (engineered shape x engineered shape).

[0178] Each hybridization reaction can spend about 10,20,30,40,50 or 60 seconds.In some cases, each hybridization reaction can spend about 1,2,3,4,5,10,15,20,30,40,50 or 60 minutes.In some cases, hybridization reaction can spend more than 1 hour.

[0179] Nucleic acid origami can be used to preferentially select how a SNAP will "land" on a solid support. For example, nucleic acid origami can be used to construct a SNAP with a seating surface that can preferentially contact a solid support. SNAPs made, for example, via nucleic acid origami can be designed to include regions that can generate steric or electrostatic interactions with the support that can affect the orientation of the SNAP on the support. For example, the region can include nucleotides with modifications to the nucleic acid backbone that can, for example, promote interaction between the SNAP and the solid support. In another example, the region can include a protrusion or cavity that can "fit" into a cavity or protrusion on a solid support. In some cases, the surface of the support can include chemical structures (e.g., nanoparticles or oligonucleotides), click reagents, or other rationally designed materials that can affect the position and orientation of the SNAP structure, including SNAPs synthesized via nucleic acid origami.

[0180] Nucleic acid origami can be used to construct SNAPs with linkers to which biological or chemical entities can be attached, wherein the linkers are positioned relative to the seating surface such that the biological or chemical entity can be at or about the distal end of the solid support. The linkers can also contain dsDNA regions to facilitate a rigid outpost from the SNAP. In some cases, protein origami can also be used.

[0181] A surface may have properties such that a SNAP can be attached to the surface in a manner that allows it to fall or tilt. The SNAP can fall or tilt left, right, forward, backward, or any combination thereof. The SNAP can fall or tilt once and remain in place, or it can freely fall between two sides over time. In some cases, the SNAP can preferentially fall in one direction over one or more other directions. In some cases, the SNAP can preferentially avoid falling in a particular direction.

[0182] In some cases, for example, filamentous or chain-like molecules, such as nanoparticles or oligonucleotide chains, can be attached to a surface. A SNAP, which can comprise an engineered shape, can comprise one or more moieties that can bind to a filamentous or chain-like molecule (e.g., a suspended single-stranded oligonucleotide or nanoparticle). When a surface is contacted with such a SNAP, the one or more moieties can interact with one or more of the filamentous or chain-like molecules. In some cases, the moieties can tightly bind to the filamentous or chain-like molecule. In such cases, the SNAP can be mobile or immobile.

[0183] Computational modeling or simulation tools can be employed to design and optimize oligonucleotide or protein sequences to produce specific SNAP structures.

[0184] In some cases, a SNAP can be a nucleic acid plasmid, such as a DNA plasmid. Plasmids can exist in a compacted form, known as supercoiled DNA. The radius of a supercoiled plasmid can be determined by the size of the plasmid, i.e., plasmids with longer backbones will form larger supercoiled entities. In some cases, a SNAP can include plasmids with backbones between 5 kb and 150 kb. In some cases, a SNAP can include plasmids with backbones between 5 kb and 100 kb. In some cases, a SNAP can include plasmids with backbones between 5 kb and 90 kb. In some cases, a SNAP can include plasmids with backbones between 25 kb and 50 kb. In some cases, a SNAP can comprise a plasmid having a backbone of at least about 5 kb, 10 kb, 15 kb, 20 kb, 25 kb, 30 kb, 35 kb, 40 kb, 45 kb, 50 kb, 55 kb, 60 kb, 65 kb, 70 kb, 75 kb, 80 kb, 85 kb, 90 kb, 95 kb, 100 kb, 105 kb, 110 kb, 115 kb, 120 kb, 125 kb, 130 kb, 135 kb, 140 kb, 145 kb, or 150 kb. In some embodiments, a SNAP can be imaged using an imaging platform such as a Nanocyte or Leica.

[0185] In some cases, the SNAP can have a branched structure. For example, the SNAP can be a dendrimer. Some examples of dendrimers can be found in Newkome, George R., and Carol D. Shreiner. "Poly(amidoamine), polypropylenimine, and related dendrimers and dendrons possessing different 1→2 branching motifs: an overview of the divergent procedures." Polymer 49.1 (2008): 1-173. The dendrimer used with the methods of the present disclosure can be a G1, G2, G3, G4, G5, G6, G7, G8, G9, G10, G11, G12, G13, G14, or G15 dendrimer. In some cases, the dendrimer can be higher than a G15 dendrimer, for example, a G15 to G30 dendrimer.

[0186] In some embodiments, the SNAP can be a protein or be composed of a protein. For example, the SNAP can be a protein fibril. The SNAP can be composed of a protein known to form fibrils, such as tau protein or a portion of tau protein. The 31 residue portion of tau that assembles into fibrils is described in Jan et al. "A 31-residue peptide induces aggregation of tau's microtubule-binding region in cells." Nature chemistry 9.9 (2017): 874. In some cases, SNAP may comprise a triangular tetrapeptide repeat. Examples of triangular tetrapeptide repeats can be found in Blatch, Gregory L., and Michael "The tetratricopeptiderepeat: a structural motif mediating protein-protein interactions." Bioessays 21.11 (1999): 932-939. Other examples of proteins that can be assembled can be found in Speltz, Elizabeth B., Aparna Nathan, and Lynne Regan. "Design of protein–peptide interaction modules for assembling supramolecular structures in vivo and in vitro." ACS chemicalbiology 10.9 (2015): 2108-2115.

[0187] In some embodiments, a SNAP can be a single molecule. In some embodiments, a SNAP can be non-single molecule. In some cases, a SNAP can be assembled from multiple molecules that are non-covalently bound. For example, a SNAP can be formed from two or more nucleic acid molecules that are hybridized together. In another example, a SNAP can be formed from two or more protein molecules that are assembled together by non-covalent bonds.

[0188] In some embodiments, the SNAP has a diameter between about 50 nm and about 100 um.

[0189] SNAPs are typically polymer molecules. These can be grown by controlled polymerization, stepwise polymerization, or stepwise synthesis methods. The growth of a SNAP can be controlled by the amount of available monomer, the length of time the reaction is allowed to proceed, or the number of synthetic steps performed.

[0190] The diameter of each SNAP can be at least about 10 nanometers (nm), or about 10 nm, about 50 nm, about 75 nm, about 100 nm, about 125 nm, about 150 nm, about 175 nm, about 200 nm, about 225 nm, about 250 nm, about 275 nm, about 300 nm, about 325 nm, about 350 nm, about 375 nm, about 400 nm, about 425 nm, about 450 nm, about 475 nm, about 500 nm, about 525 nm, about 550 nm, about 575 nm, about 600 nm, about 625 nm, about 650 nm, about 675 nm, about 680 nm, about 690 nm, about 700 nm, about 715 nm, about 725 nm, about 730 nm, about 740 nm, about 750 nm, about 760 nm, about 775 nm, about 780 nm, about 790 nm, about 800 nm, about 815 nm, about 820 nm, about 830 nm, about 840 nm, about 850 nm, about 860 nm, about 875 nm, about 880 nm, about 890 nm, about 900 nm, about 910 nm, about 920 nm, about 930 nm 5nm, about 650nm, about 675nm, about 700nm, about 725nm, about 750nm, about 775nm, about 800nm, about 825nm, about 850nm, about 875nm, about 900nm, about 925nm, about 950nm, about 975nm, about 1000nm, about 1025nm, about 1050nm, about 1075nm, about 1100nm, about 1125nm, about 1150nm, about 1175nm, about 1200nm, about 1225nm, about 1250nm, about 12 75nm, about 1300nm, about 1325nm, about 1350nm, about 1375nm, about 1400nm, about 1425nm, about 1450nm, about 1475nm, about 1500nm, about 1525nm, about 1550nm, about 1575nm, about 1600nm, about 1625nm, about 1650nm, about 1675nm, about 1700nm, about 1725nm, about 1750nm, about 1775nm, about 1800nm, about 1825nm, about 1850nm, about 1875nm In some cases, a SNAP may have a diameter of about 100 nm to 500 nm, about 200 nm to about 400 nm, about 5000 nm to about 10 μm, or about 1000 nm to about 10 μm.

[0191] In some cases, click chemistry can be used to covalently attach SNAPs to solid supports. Generally, the term "click chemistry" is used to describe reactions that are high yield, broad in scope, generate only byproducts that can be removed without chromatography, are stereospecific, are easy to perform, and can be performed in easily removable or benign solvents (McKay, C., & Finn MG (2014) Click Chemistry in Complex Mixtures Bioorthogonal Bioconjugation Vol. 21, No. 9, pp. 1075-1101; MGMeldal, M., & CW (2008). Cu-Catalyzed Azide-Alkyne Cycloaddition. Chemical Reviews, 108(8), 2952-3015; Lutz, J., & Zarafshani, Z. (2008). Efficient construction of therapeutics, bioconjugates, biomaterials and bioactive surfaces using azide–alkyne “click” chemistry. Advanced Drug Delivery Reviews, 60(9), 958–970., incorporated herein by reference).

[0192] In some cases, the click chemistry reaction can be CuAAC, SPAAC, SPANC, or as described elsewhere herein. In some cases, the click chemistry reaction may require a copper source, such as CuSO4, Cu(0), CuBr(Ph3P), CuBr, CuBr / Cu(OAc)2, CuBr2, [Cu(CH3CN)4]PF6, PS-NMe2:CuI, silica:CuI, (EtO)3P:CuI, CuCl / Pd2(dba)3, CuBF4, CuCl, CuCl2, Cu(AcO)2, Cu(2), TTA:CuSO4, Cu(1) zeolite (USY), Cu(CH3CN)4OTf, CuOTf, Cu(2):bis-batho or a combination thereof. In some cases, the click chemistry reaction may be performed without a copper source. In some cases, the reducing agent of the click chemistry reaction can be, for example, NaAsc, air, ICl, oxygen, N2, HAsc, TCEP, dithiothreitol (DTT), PPh3, mercaptoethanol, tris (2-carboxyethyl) phosphine (TCEP), TCEPT-hydrochloric acid, or a combination thereof, or no reducing agent. In some cases, the solvent of the click chemistry reaction can be, for example, THF, pyridine, DMSO, DMF, toluene, NMP, acetonitrile, water, tBuOH, iBuOH, EtOH, MeOH, dioxane, dichloromethane, HEPES, NaCl buffer, acetone, PBS, SFM, Tris buffer, borate buffer, PB, TFH, AcOEt, PIPES, urea, acetone, Tris, saline, AllOCO2Me, TMS-N3, urea solution, bicarbonate buffer, a combination thereof, or no solution. In some cases, the base of the click chemistry reaction can be, for example, DIPEA, Lut Na2CO3, iPr2NH, DBU, Et3N, Et3N·HCl, Et3NH+-OAc, K2CO3, TBAF, CuSO4, PS-NMe2, piperidine, a desired pH, or a combination thereof. In some cases, the ligand of the click chemistry reaction can be, for example, TBTA, proline, BMAH, Lut, chiral Lig's, pyridine, His, Batho, TTA, Bim, Phen, Bipy, PMDETA, dNbipy, TRMEDA, or a combination thereof. In some cases, the temperature of the click chemistry reaction can be, for example, 0-5°C, 5-15°C, 15-25°C, 20-25°C, 25-35°C, 35-45°C, 45-55°C, 55-65°C, 65-75°C, 75-85°C, 85-95°C, or higher. In some cases, the temperature of the click chemistry reaction can be below 0° C. In some reactions, the click chemistry reaction can be covered with aluminum foil. In some cases, the click chemistry reaction can include an acid, such as trifluoroacetic acid, trichloroacetic acid, or tribromoacetic acid.

[0193] In some cases, a cross-linker can be used for conjugation. In some cases, the cross-linker can be a zero-length cross-linker, a homobifunctional cross-linker, a heterobifunctional cross-linker, or a trifunctional cross-linker. The cross-linker can be incorporated into a preformed or in situ biomolecule.

[0194] In some cases, zero-length cross-linking agents mediate the conjugation for bioconjugation by forming a key that does not contain other atoms. Therefore, an atom of a molecule is covalently attached to the atom of a second molecule, without intermediate linkers or intermoleculars. In such a conjugation scheme, final complex is combined together by chemical components, and these chemical components add foreign structures to the cross-linked material. Carbodiimide can be used to mediate the formation of the amido bond between carboxylate and amine or the phosphoramidate bond between phosphate and amine, and is a common type of spendable zero-length cross-linking agent, which can effectively form a conjugate between two protein molecules, between a peptide and a protein, between an oligonucleotide and a protein, between a biomolecule and a surface or between a particle, or a conjugate between any combination of these and a small molecule. In some cases, EDC (or EDAC; 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride) can be used to conjugate the biomolecule containing carboxylate and amine. In some cases, CMC or 1-cyclohexyl-3-(2-morpholinoethyl)carbodiimide (commonly synthesized as methyl p-toluenesulfonate) is a water-soluble reagent used to form an amide bond between one molecule containing a carboxylate and a second molecule containing an amine, which can be used as a cross-linker for bioconjugation. In some cases, DIC or diisopropylcarbodiimide can be used as a zero-length cross-linker for bioconjugation. In some cases, DCC (dicyclohexylcarbodiimide) can be used as a zero-length cross-linker for bioconjugation. In some cases, Woodward reagent K is N-ethyl-3-phenylisoxazolium-3'-sulfonate, a zero-length cross-linker that can cause condensation of carboxylate and amine to form an amide bond. In some cases, CDI or N,N'-carbonyldiimidazole can be used as a zero-length cross-linker for bioconjugation. In some cases, Schiff base formation and reductive amination can be used as a zero-length cross-linker for bioconjugation.

[0195] In some cases, homobifunctional cross-linkers mediate conjugation for bioconjugation. In some cases, homofunctional NHS esters can be used for bioconjugation. For example, Lomant's reagent [(dithiobis(succinimidyl propionate) or DSP]) is a homobifunctional NHS ester cross-linker containing a length of The sulfo-NHS version of DSP, dithiobis(sulfosuccinimidyl propionate) or DTSSP, is a water-soluble analog of Lomant's reagent that can be added directly to aqueous reactions without prior organic solvent dissolution. In some cases, disuccinimidyl suberate (DSS), an amine-reactive, homobifunctional NHS ester cross-linker, can generate an octatom bridge between conjugated biomolecules. In some cases, disuccinimidyl tartrate (DST), a homobifunctional NHS ester crosslinker containing a central diol that is easily cleaved by sodium periodate, can be used to form amide bonds with α- and ε-amines of proteins or other amine-containing molecules. In some cases, BSOCOES [bis[2-(succinimidyloxycarbonyloxy)ethyl]sulfone], a water-insoluble homobifunctional NHS ester crosslinker containing a central sulfone group, wherein the two NHS ester termini react with amine groups in proteins and other molecules to form stable amide bonds. In some cases, ethylene glycol bis(succinimidyl succinate) (EGS), a homobifunctional crosslinker containing NHS ester groups at both termini, can be used. Both NHS esters are amine-reactive and form stable amide bonds between the crosslinked molecules in the pH range of approximately 7 to 9. In some cases, disuccinimidyl glutarate (DSG), a water-insoluble, homobifunctional cross-linker containing amine-reactive NHS esters at both ends, can be used for dual conjugation. In some cases, N,N′-disuccinimidyl carbonate (DSC), the smallest homobifunctional NHS ester cross-linker available, can be used. In some cases, dimethyl adipimidate (DMA), dimethyl pimelimidate (DMP), dimethyl suberimidate (DMS), dimethyl 3,3'-dithiobismalonimidate (DTBP), 1,4-bis-[3'-(2'-pyridyldithio)propionamido]butane, bismaleimidohexane, 1,5-difluoro-2,4-dinitrobenzene or 1,3-difluoro-4,6-dinitrobenzene, DFDNPS (4,4'-difluoro-3,3'-dinitrobenzene sulfone), bis-[β-(4-azidosalicylamido)ethyl]disulfide (BASED), formaldehyde, glutaraldehyde, 1,4-butanediol diglycidyl ether, adipic acid hydrazide, carbohydrazide, 3,3'-dimethylbenzidine, p-diaminodiphenyl or haloacetyl derivatives can be used as homobifunctional cross-linking agents.

[0196] In some cases, heterobifunctional cross-linkers mediate conjugation for bioconjugation. Heterobifunctional reagents can be used to cross-link proteins and other molecules through a two-step or three-step process. In some cases, a protein is modified with a heterobifunctional compound using the most reactive or least unstable end of the cross-linker. The modified protein can then be purified from the excess reagent by gel filtration or rapid dialysis. In some cases, the heterobifunctional compound contains at least one reactive group that exhibits extended stability in an aqueous environment, thereby allowing purification of the activated intermediate before adding the second molecule to be conjugated. For example, N-hydroxysuccinimide (NHS ester-maleimide heterobifunctionality) can be used to react with the amine group of a protein through its NHS ester end (the most unstable functional group) while retaining the activity of its maleimide functionality. Since the maleimide group has greater stability in aqueous solution than the NHS ester group, a maleimide-activated intermediate can be produced. After the rapid purification step, the maleimide end of the cross-linker can then be used to conjugate to the sulfhydryl-containing molecule. Heterobifunctional cross-linkers can also be used to direct the conjugation reaction to a specific part of the target molecule. In some cases, an amine can be coupled to one molecule, while a sulfhydryl or carbohydrate is targeted on another molecule. In some cases, heterobifunctional reagents containing a photoreactive end can be used to non-selectively insert into the target molecule by UV irradiation. Another component of heterobifunctional reagents is a cross-linking bridge or spacer that connects the two reactive ends together. The choice of cross-linker can be based not only on their reactivity, but also on the length and type of cross-link they have. Some heterobifunctional families differ only in the length of their spacers. The nature of the cross-linking bridge can also control the overall hydrophilicity of the reagent. For example, cross-linking bridges based on polyethylene glycol (PEG) produce hydrophilic reagents that provide water solubility to the entire heterobifunctional compound. In some cases, many heterobifunctional groups contain cleavable groups in their cross-linking bridges, which provides greater flexibility in experimental design. A few cross-linking agents contain special cross-linking bridge components that actually affect the reactivity of their functional groups. For example, maleimide groups adjacent to aromatic rings are known to be less stable to ring opening and loss of activity than maleimides adjacent to aliphatic rings. In addition, conjugates intended for in vivo use can have different properties depending on the type of spacer on the cross-linking agent in question. Some spacers can be immunogenic and lead to the production of specific antibodies against them. In other cases, the half-life of the conjugate in vivo can be altered by the choice of cross-linking bridge, especially when cleavable reagents are used.In some cases, the heterobifunctional cross-linker can be N-succinimidyl 3-(2-pyridyldithio) propionate (SPDP), standard SPDP, LC-SPDP, sulfo-LC-SPDP, succinimidyloxycarbonyl-α-methyl-α-(2-pyridyldithio)toluene, succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate, sulfosuccinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate, m-maleimidobenzoyl-N-hydroxysuccinimide ester, m-maleimidobenzoyl-N-hydroxysulfo-succinimide ester, N-succinimidyl (4-iodoacetyl)aminobenzoate, sulfosuccinimidyl (4-iodoacetyl)aminobenzoate, succinimidyl-4-(p-maleimidophenyl))butyrate, N-(γ-maleimidobutyryloxy)succinimide ester, succinimidyl-3-(bromoacetamide)propionate, succinimidyl iodoacetate, 4-(4-N-maleimidophenyl)butyric acid hydrazide, 4-(N-maleimidomethyl)cyclohexane-1-carboxy-hydrazide, 3-(2-pyridyldithio)propionyl hydrazide, N-hydroxysuccinimidyl-4-azidosalicylic acid, sulfosuccinimidyl-2-(p-azidosalicylic acidamido)ethyl- 1,3'-dithiopropionate, N-hydroxysulfosuccinimidyl-4-azido-benzoate, N-succinimidyl-6-(4'-azido-2'-nitrophenylamino)hexanoate, sulfosuccinimidyl-6-(4'-azido-2'-nitrophenylamino)hexanoate, N-5-azido-2-nitrobenzoyloxysuccinimide, sulfosuccinimidyl-2-(m-azido-o-nitrobenzamido)-ethyl-1,3'-dithiopropionate, N-succinimidyl-(4-azidophenyl) 1,3'-dithiopropionate, sulfosuccinimidyl-4-(p-azidophenyl)butyrate, sulfosuccinimidyl-2-(m-azido-o-nitrobenzamido)-ethyl-1,3'-dithiopropionate Imido 2-(7-azido-4-methylcoumarin-3-acetamido)ethyl-1,3'-dithiopropionate, sulfosuccinimidyl 7-azido-4-methylcoumarin-3-acetate, p-nitrophenyldiazopyruvate, p-nitrophenyl-2-diazo-3,3,3-trifluoropropionate, 1-(p-azidosalicylamido)-4-(iodoacetamido)butane, N-[4-(p-azidosalicylamido)butyl]-3'-(2'-pyridyldithio)propionamide, benzophenone-4-maleimide, p-azidobenzoylhydrazide, 4-(p-azidosalicylamido)butylamine, or p-azidophenylglyoxal.

[0197] Other examples of cross-linking agents include, but are not limited to, NHS-PEG4-azide, NHS-phosphine, N-γ-maleimidobutyryl-oxysulfosuccinimide ester, m-maleimidobenzoyl-N-hydroxysuccinimide ester, sulfosuccinimidyl (4-iodoacetyl) aminobenzoate, succinimidyl 3-(2-pyridyldithio) propionate, sulfosuccinimidyl (4-iodoacetyl) aminobenzoate, m-maleimidobenzoyl-N-hydroxysuccinimide ester, 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride, dimethyl pimelimidate, sulfosuccinimidyl 6-(3'-(2-pyridyldithio) propionamido) hexanoate, 6-(3'-[2-pyridyldithio] propionamido) hexanoate [dithio]propionamido)hexanoate, tris-(succinimidyl)aminotriacetate, sulfo-NHS-LC-bisaziridine, bismaleimidohexane, 1,4-bismaleimidobutane, sulfosuccinimidyl 4-(N-maleimidophenyl)butyrate, sulfo-SBED biotin label transfer reagent, succinimidyl 6-(3(2-pyridyldithio)propionamido)hexanoate, succinimidyl 3-(2-pyridyldithio)propionate, sulfosuccinimidyl 6-(3'-(2-pyridyldithio)propionamido)hexanoate, L-photoreactive-leucine, L-photoreactive-methionine, sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate, Pierce BS(PEG)5, sulfosuccinimidyl 2-((4,4'-azipentanamidoethyl)-1,3'-dithiopropionate, sulfo-NHS-SS-bis(aziridine), Pierce SM(PEG)n, NHS-dPEG-Mal, N-hydroxysulfosuccinimide, sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate, sulfosuccinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride, N-α-maleimidoacetoxysuccinimide ester, sulfo-NHS-LC-biotin, bis(sulfosuccinimidyl) suberate, trans-4-(maleimidomethyl) methyl)cyclohexane-1-carboxylate, bismaleimidohexane, 1,8-bismaleimido-diglycol, N-β-maleimidopropionic acid hydrazide, N-succinimidyl 3-(2-pyridyldithio)-propionate, sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate, 3-(2-pyridyldithio)propionyl hydrazide, 4-(4-N-maleimidophenyl)butyric acid hydrazide, 3,3'-dithiobis(sulfosuccinimidyl propionate, bis(sulfosuccinimidyl) 2,2,4,4-glutaric acid ester-d4 or succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate.

[0198] In some cases, the alkyne derivative attached to the solid support or SNAP can be, for example, dibenzocyclooctyne-amine, dibenzocyclooctyne-acid, dibenzocyclooctyne-N-hydroxysuccinimidyl ester, dibenzocyclooctyne-N-hydroxysuccinimidyl ester, dibenzocyclooctyne-sulfo-N-hydroxysuccinimidyl ester, dibenzocyclooctyne-sulfo-N-hydroxysuccinimidyl ester, dibenzocyclooctyne-SSN-hydroxysuccinimidyl ester, or dibenzocyclooctyne-SSN-hydroxysuccinimidyl ester. Amine ester, dibenzocyclooctyne-PEG4-N-hydroxysuccinimidyl ester, dibenzocyclooctyne-PEG4-acid, dibenzocyclooctyne-maleimide, sulfo-dibenzocyclooctyne-biotin conjugate, (1R,8S,9s)-bicyclo[6.1.0]non-4-yn-9-ylmethyl N-succinimidyl carbonate, (1R,8S,9s)-bicyclo 6.1.0non-4-yn-9-ylmethanol, APN- BCN, (1R,8S,9s)-bicyclo 6.1.0 non-4-yn-9-ylmethanol, ethyl (1R,8S,9s)-bicyclo 6.1.0 non-4-ene-9-carboxylate, alkyne-PEG5-acid, (R)-3-amino-5-hexynoic acid hydrochloride, (S)-3-amino-5-hexynoic acid hydrochloride, (R)-3-(Boc-amino)-5-hexynoic acid, (S)-3-(Boc-amino)-5 -hexynoic acid, N-Boc-4-pentyn-1-amine, 4-pentyn-1-amine, Boc-propargyl-Gly-OH, 3-ethynylaniline, 4-ethynylaniline, PC biotin-alkyne, propargyl chloroformate, propargyl-N-hydroxysuccinimidyl ester, NZ-4-pentyn-1-amine, 1-azido-2-(2-(2-ethoxyethoxy)ethoxy)ethane, O-(2-azidoethyl)heptanediol, DIBO TAMRA, DIBO-Biotin, DIBO-amine, DIBO-maleimide, DIBO-succinimidyl ester, Alexa 488 Alkynes, Alexa 555 Alkyne, triethylammonium salt, Alexa 594 Carboxamido-(5-(and 6-)propargyl), bis(triethylammonium salt), 3-propargyloxypropionic acid, succinimidyl ester, biotin alkyne, tetraacetylfucose alkyne, Oregon 488Alkyne*6-isomer*, iodoacetamide alkyne, or 5-carboxytetramethylrhodamine propargylamide.

[0199] In some cases, the azide derivative attached to the solid support, SNAP, or biomolecule can be, for example, (S)-5-azido-2-(Fmoc-amino)pentanoic acid, (S)-(-)-2-azido-6-(Boc-amino)hexanoic acid (dicyclohexylammonium), (S)-2-azido-3-(4-tert-butyloxyphenyl)propionic acid cyclohexylammonium salt, L-azidohomoalanine hydrochloride, (S)-2-azido-3-(3-indolyl)propionic acid cyclohexylammonium salt, (S)-2-azido-3-methylbutanoic acid cyclohexylammonium salt, (S)-2-azido-3-phenylpropionic acid (dicyclohexylammonium) salt, Boc-3-azido-Ala -OH (dicyclohexylammonium) salt, N-Boc-4-azido-L-homoalanine (dicyclohexylammonium) salt, N-Boc-6-azido-L-norleucine (dicyclohexylammonium) salt, Boc-4-azido-Phe-OH, (S)-(-)-4-tert-butylhydrogen 2-azidosuccinate (dicyclohexylammonium) salt, N2-[(1,1-dimethylethoxy)carbonyl]-N6-[(2-propynyloxy)carbonyl]-L-lysine, Fmoc-β-azido-Ala-OH, 2-acetamido-2-deoxy-β-D-glucopyranosyl azide, 2-acetamido-2-deoxy-β-D-glucopyranosyl azide Azide 3,4,6-triacetate, 2-acetamido-3,4,6-tri-O-benzyl-2-deoxy-β-D-glucopyranosyl azide, N-azidoacetylgalactosamine-tetraacyl, N-azidoacetylglucosamine, N-azidoacetylglucosamine-tetraacyl, 6-azido-6-deoxy-1,2:3,4-di-O-isopropylidene-α-D-galactopyranose, 1-azido-1-deoxy-β-D-galactopyranoside, 1-azido-1-deoxy-β-D-galactopyranoside tetraacetate, 6-azido-6-deoxy-D-galactose, 1-azido-1-deoxy-β-D-glucopyranosyl Glycosides, 2-azido-2-deoxy-D-glucose, 6-azido-6-deoxy-D-glucose, 1-azido-1-deoxy-β-D-lactopyranoside, 3-azido-2,3-dideoxy-1-O-(tert-butyldimethylsilyl)-β-D-arabinosyl-hexopyranose, 2-azido-D-galactose tetraacetate, 1,2-di-O-acetyl-3-azido-3-deoxy-5-O-(p-toluoyl)-D-ribofuranose, α-D-mannopyranosyl azide tetraacetate, 2,3,4,6-tetra-O-acetyl-1-azido-1-deoxy-α-D-galactopyranosyl cyanide, 2,3,4-tri-O-acetyl-β-D-xylopyranosyl azide, 3'-azido-3'-deoxythymidine, γ-(2-azidoethyl)-ATP sodium salt solution, γ-[(6-azidohexyl)-acylimino]-ATP sodium salt, (2'S)-2'-deoxy-2'-fluoro-5-ethynyl uridine, 5-ethynyl-2'-deoxycytidine, N6-propargyl-ATP sodium salt, 4-acetamidobenzenesulfonyl azide, (E)-N-(2-aminoethyl)-4-{ 2-[4-(3-azidopropoxy)phenyl]diazenyl]benzamide hydrochloride, azidoacetic acid NHS ester, 1-azidoadamantane, 4-azidoaniline hydrochloride, (4S)-4-[(1R)-2-azido-1-(benzyloxy)ethyl]-2,2-dimethyl-1,3-dioxolane, NHS-PEG4-azide, [3aS-(3aα,4α,5β,7aα)]-5-azido-7-bromo-3a,4,5,7a-tetrahydro-2, 2-Dimethyl-1,3-benzodioxol-4-ol, 3'-azido-3'-2-azido-1-methylquinolinium tetrafluoroborate, 5-azidopentanoic acid, 4-azidophenacyl bromide, 4-azidophenyl isothiocyanate, 3-(4-azidophenyl)propionic acid, 3-azido-1-propylamine, 3-azido-1-propanol, azobiotin-azide, biotin methylpyridine azide, 2-(4-{[4-(3-(azidopropoxy)phenyl] tert-butyl}benzamido)ethylcarbamate, 4-carboxybenzenesulfonyl azide, 7-(diethylamino)coumarin-3-carbonyl azide, ethidium bromide monoazide, ethyl azidoacetate, 4-methoxybenzyloxycarbonyl azide, aryl azide, diazierine, or O-(2-aminoethyl)-O'-(2-azidoethyl)heptanediol, bromoacetamido-PEG3-azide, iodoacetamide azide, Alexa, 488 Azide, Alexa 488 5-Carboxamido-(6-azidohexyl), bis(triethylammonium salt), Alexa 555 triethylammonium azide, Alexa 594 Carboxamido-(6-azidohexyl), bis(triethylammonium salt), Alexa 647 azide triethylammonium salt, 3-(azidotetra(ethyleneoxy))propionic acid succinimidyl ester, biotin azide, L-azidohomoalanine, L-homopropargylglycine, Farnesyl alcohol azide, 15-azidopentadecanoic acid, 12-azidododecanoic acid, tetraacetylated N-azidoacetylgalactosamine, tetraacetylated N-azidoacetyl-D-mannosamine, tetraacetylated N-azidoacetylglucosamine, iodoacetamide azide or tetramethylrhodamine 5-carboxamido-(6-azidohexyl).

[0200] In some cases, the SNAP can be covalently attached to the solid support using the intrinsic chemistry of the SNAP. In some cases, the solid support can be covered with functional groups that are reactive toward the SNAP. These functional groups can be, for example, hydroxyl, carbonyl, carboxyl, amino, amide, azide, alkyne, olefin, phosphate, sulfhydryl, thiol, isothiocyanate, isocyanate, acyl azide, NHS ester, silane, sulfonyl chloride, aldehyde, ester, glyoxal, epoxide, ethylene oxide, alkanethiols, carbonate, aryl halide, imide ester, carbodiimide, anhydride, fluorophenyl ester, amine, thymine, or a combination thereof. In some cases, the SNAP can have a functional group that can react with a functional group on the solid support to form a covalent bond. For example, a DNASNAP can be attached to a solid support by reacting one or more thymines in the DNA with an amine on the solid support. For example, the -NH2 at the N-terminus of the polypeptide chain or the -COOH at the C-terminus of the polypeptide chain can react with an appropriate functional group and be attached to the solid support via a covalent bond. In some cases, for example, the functional group of the SNAP can be a hydroxyl, carbonyl, carboxyl, amino, amide, azide, alkyne, silane, olefin, phosphate, sulfhydryl, thiol, isothiocyanate, isocyanate, acyl azide, NHS ester, sulfonyl chloride, aldehyde, ester, glyoxal, epoxide, oxirane, alkanethiols, carbonate, aryl halide, imide ester, carbodiimide, anhydride, fluorophenyl ester, amine, thymine, or a combination thereof. Other bioconjugation processes, reactions, and functional groups are described elsewhere, which can be used to attach the SNAP to a solid support. Such reactions can be spontaneous or can be induced by applying heat or ultraviolet radiation.

[0201] In some cases, silane chemistry can be used for bioconjugation. In some cases, functional silane compounds comprising organic functional arms or organic reaction arms can be used for biomolecules and inorganic matrix conjugation. The appropriate selection for specific applications of functional groups or reactive groups can allow proteins, oligonucleotides, whole cells, organelles or even tissue sections to be attached to matrix. Organosilanes used for these applications can include functional groups or reactive groups, such as hydroxyl, amino, aldehyde, epoxy, carboxylate, thiol and even alkyl groups, to bind molecules by hydrophobic interactions. In some cases, 3-aminopropyltriethoxysilane (APTS) and 3-aminopropyltrimethoxysilane are used to form functional groups on inorganic surfaces or particles. In some cases, once alkoxy is deposited on matrix, covalent polymer coatings will be formed, wherein primary amine groups stick to the surface away from the ground and can be used for subsequent conjugation. Carbodiimide reaction or reductive amination can be used to directly couple carboxyl or aldehyde-containing ligands to aminopropyl. Alternatively, in some cases, surfaces initially derivatized with aminopropylsilane compounds can be further modified with spacers or crosslinkers to create reactive groups for coupling affinity ligands or biomolecules. For example, amine groups can be derivatized with NHS-PEGn-azide for use in click chemistry or Staudinger ligation reactions to attach proteins or other biomolecules. In some cases, APTS-modified surfaces can be further derivatized with amine-reactive crosslinkers to create additional surface features and reactivity. Modification with NHS–PEG4-azide creates a hydrophilic PEG spacer terminated with an azide group that can be used in click chemistry or Staudinger ligation reactions to couple other molecules.

[0202] In some cases, other cross-linkers containing an amine-reactive group on one end can also be used to modify and activate APTS-modified substrates. The surface can be designed to contain, for example, reactive hydrazines or aminooxy groups for conjugation to carbonyl-containing molecules such as aldehydes formed by periodate oxidation of carbohydrates or aldehydes naturally present on the reducing ends of sugars and glycans.

[0203] In some cases, amine groups on the ATPS surface can be acylated with glutaric anhydride to generate carboxylate functionality, which can then be activated with NHS / DCC to form NHS esters. This derivative can be used to couple amine-containing proteins and other molecules via amide bond formation. In a second activation strategy, aminopropyl groups on the surface are activated with 1,4-phenylene diisothiocyanate (PDITC) to generate terminal isothiocyanate groups for coupling amines. Both methods have successfully coupled amine-dendrimers to silica surfaces for use in arrays. In some cases, amine surfaces prepared using aminosilane compounds can be modified to contain carboxylate groups using the following protocol, which involves reaction with anhydrides such as succinic anhydride or glutaric anhydride. Following modification, the carboxylates are then used to couple amine-containing molecules using a carbodiimide reaction with EDC plus sulfo-NHS. In some cases, APTS surfaces are modified with glutaric anhydride to generate terminal carboxylates for coupling amine-containing ligands useful for bioconjugation.

[0204] In some cases, aminosilane surfaces can also be activated using bifunctional crosslinkers to contain reactive groups for subsequent coupling to biomolecules. In one such reaction, N,N'-disuccinimidyl carbonate (DSC) is used to react with amines on the slide surface and generate terminal NHS-carbonate groups, which can then be coupled to amine-containing molecules that can be used for bioconjugation. In some cases, APTS-modified surfaces can be activated with DSC to form amine-reactive succinimidyl carbonates for coupling proteins or other amine-containing molecules.

[0205] In some cases, silane coupling agents containing carboxylate groups can be used to functionalize surfaces with carboxylic acids for subsequent coupling with amine-containing molecules. For example, carboxyethylsilanetriol contains an acetate organic group on the inorganic reactive end of the silanetriol. As with most other silanization reagents, the silanetriol component can react immediately with inorganic -OH matrices without the need for prior hydrolysis of the alkoxy groups. In some cases, carboxyethylsilanetriol has been used to add carboxylate groups to fluorescent silica nanoparticles for coupling to antibodies for multiple bacterial monitoring. This reagent can be used in a similar manner to add carboxylate functionality to many inorganic or metallic nanomaterials, which will also generate negative charge repulsion to maintain particle dispersion in aqueous solutions. In some cases, covalent coupling to the carboxylated surface can then be accomplished by activating the carboxylic acid groups with carbodiimides to promote direct reaction with amine-containing molecules or to form intermediate NHS esters, which can be used for bioconjugation. In some cases, carboxyethylsilanetriol can be used to modify inorganic substrates to contain carboxylate groups for coupling to amine-containing ligands.

[0206] In some cases, silane modifiers (e.g., glycidyl groups) can be used for bioconjugation to surface matrices. Glycidyl compounds contain reactive epoxy groups. Depending on the pH of the reaction, surfaces covalently coated with these silane coupling agents can be used to conjugate thiol-, amine-, or hydroxyl-containing ligands. In some cases, inorganic silica or other metal surfaces containing -OH groups can be connected to biomolecules containing any three of these primary functional groups using 3-glycidoxy-propyltrimethoxysilane (GOPTS) or 3-glycidoxypropyltriethoxysilane. In some cases, epoxy-containing silane coupling agents form reactive surfaces that can be used to couple amine-, thiol-, or hydroxyl-containing ligands that can be used for bioconjugation.

[0207] In some cases, reactions of epoxides with thiols produce thioether bonds, while reactions with hydroxyls produce ethers, and reactions with amines produce secondary amine bonds. The relative reactivity of epoxy groups is thiol > amine > hydroxyl, which is reflected in the optimal pH range for each reaction. In this case, the less reactive the functional group, the higher the pH required to effectively drive the reaction.

[0208] In some cases, isocyanate groups can be used for bioconjugation with surface supports. Isocyanate groups are highly reactive to nucleophiles and are rapidly hydrolyzed in aqueous solutions, making them particularly useful for covalent coupling with hydroxyl groups under non-aqueous conditions and for conjugation with many carbohydrate ligands. Silanization can be accomplished in anhydrous organic solvents to form reactive surfaces while retaining the activity of isocyanate. Isocyanatepropyltriethoxysilane (ICPTES) comprises an isocyanate group at the end of a short propyl spacer, which is connected to a triethoxysilyl group for attachment to an inorganic matrix. In some cases, silane coupling agents containing isocyanate can be used for coupling hydroxyl-containing molecules to inorganic surfaces that can be used for bioconjugation.

[0209] In some cases, ICPTES can be used to produce novel chitosan-siloxane hybrid polymers by coupling isocyanate groups to carbohydrate functional groups and using a triethoxysilane backbone to form silica polymers. In some cases, ICPTES and APTS are used in combination to produce organically modified silica xerogels by carboxylic acid solvolysis, which forms hybrid materials with luminescent properties.

[0210] In some cases, nanoparticles or microparticles can be used as surface supports for bioconjugation. In some cases, the types and compositions of particles are almost unlimited in shape and size, including spherical, amorphous or aggregated particles, as well as fine geometric shapes such as rods, tubes, cubes, triangles and pyramids. In addition, new symmetrical organic constructs have emerged in the nanometer range, including fullerenes (e.g., buckyballs), carbon nanotubes and dendrimers, which are highly defined synthetic structures used as bioconjugation scaffolds. The chemical composition of the particles can vary only with their shape. Particles can include polymers or copolymers, inorganic constructs, metals, semiconductors, superparamagnetic complexes, biodegradable constructs, synthetic dendrimers and dendrimers. Polymer particles can be constructed from a variety of different monomer or copolymer combinations. Some of the more common ones include polystyrene (traditional "latex" particles), poly(styrene / divinylbenzene) copolymers, poly(styrene / acrylate) copolymers, polymethyl methacrylate (PMMA), poly(hydroxyethyl methacrylate) (pHEMA), poly(vinyltoluene), poly(styrene / butadiene) copolymers, and poly(styrene / vinyltoluene) copolymers. In some cases, by incorporating a combination of functional monomers into the polymerization reaction, reactive groups or functional groups can be generated on the surface of the particles for subsequent coupling to affinity ligands. An example of this is poly(styrene / acrylate) copolymer particles, which produce carboxylate groups within the polymer structure, the number of which depends on the ratio of monomers used in the polymerization process. In some cases, inorganic particles are widely used in various biological applications. For example, gold nanoparticles can be used as detection labels for immunohistochemistry (IHC) staining and lateral flow diagnostic tests. In some cases, the use of particles in biological applications such as bioconjugation involves attaching affinity capture ligands to their surface by passive adsorption or covalent coupling. The coupling of affinity ligands to such particles results in the ability to selectively bind biological targets in complex sample mixtures. Thus, affinity particle complexes can be used to separate and isolate proteins or other biomolecules, or to specifically detect the presence of these targets in cells, tissue sections, lysates, or other complex biological samples. In some cases, the reactions used to couple affinity ligands to nanoparticles or microparticles are essentially the same as those used for bioconjugation of the molecules described herein.

[0211] In some cases, the particle type for biological application (such as biological conjugation) is polymer microsphere or nanosphere, which comprises spherical non-porous " hard " particles consisting of long, winding linear or cross-linked polymers. In some cases, the generation of these particles relates to the emulsion polymerization process using vinyl monomers, sometimes in the presence of divinyl cross-linking monomers. In some cases, larger microparticles can be constructed from continuous polymerization steps by the growth of much smaller nanoparticle seeds. In some cases, polymer particles include polystyrene or styrene copolymers, such as styrene / divinylbenzene, styrene / butadiene, styrene / acrylate or styrene / vinyl toluene. Other common polymer supports include polymethyl methacrylate (PMMA), polyvinyl toluene, poly (hydroxyethyl methacrylate) (pHEMA) and copolymer poly (ethylene glycol dimethacrylate / 2-hydroxyethyl methacrylate) [poly (EGDMA / HEMA)].

[0212] In some cases, one method for attaching biomolecules to hydrophobic polymer particles is to use passive adsorption. In some cases, protein adsorption onto hydrophobic particles occurs through strong interactions of nonpolar or aromatic amino acid residues with surface polymer chains on the particles, accompanied by the exclusion of water molecules. Because proteins typically contain a hydrophobic core structure with a predominantly hydrophilic surface, their interaction with hydrophobic particles necessarily involves significant conformational changes to generate large-scale hydrophobic contacts.

[0213] In some cases, the particle types contain functional groups built into the polymer backbone and displayed on their surface. The amount of these groups can vary widely depending on the type and ratio of monomers used in the polymerization process or the extent of secondary surface modification that has been performed. In some cases, the functionalized particles can be used to covalently couple biomolecules through appropriate reaction conditions. Common functional or reactive groups on particles for bioconjugation

[0214] In some cases, the particles can be coupled with a cross-linker for bioconjugation.

[0215] In some cases, the rate of attachment of a DNASNAP to a solid support, or the efficacy or strength of attachment, can be altered by changing the sequence of the DNA comprising the SNAP. For example, where a DNASNAP attaches to a solid support via a reaction involving one or more thymines, attachment can be altered by changing the number of thymines in the DNA sequence. In some cases, increasing the number of thymines can facilitate attachment of the SNAP to the solid support.

[0216] In some cases, the solid support is part of the flow cell. In some cases, the SNAP can be attached to the solid support in the flow cell. In some cases, the SNAP can be conjugated directly to the solid support in the flow cell. In some cases, the SNAP can be adsorbed onto the solid support in the flow cell. Attaching the SNAP in the flow cell can allow visualization of the SNAP as it attaches to the solid support. By monitoring the number of attached SNAPs compared to the number of attachment sites during the attachment process, the attachment of the SNAP can be optimized. In some cases, the attachment of the SNAP can be optimized by monitoring the area of ​​the solid support covered by the SNAP and the area of ​​the solid support not occupied by the SNAP during the attachment process.

[0217] In some cases, the SNAP can be conjugated directly in the flow cell. In some cases, the SNAP can be conjugated to a surface within the flow cell. In some cases, the SNAP can be conjugated to a surface within the flow cell and then conjugated to the biological or chemical entity. In some cases, the biological or chemical entity can be flowed into the flow cell and conjugated to a SNAP that is already conjugated to a solid support. In some cases, the biological or chemical entity can be conjugated to the SNAP, and then the SNAP can be introduced into the flow cell and conjugated to the solid support in the flow cell. In some cases, the biological or chemical entity and the SNAP can be introduced into the flow cell and conjugated to each other within the flow cell, and then the SNAP can be conjugated to the solid support within the flow cell.

[0218] In some cases, a biological or chemical entity can be conjugated to a SNAP, which is then attached to a solid support. Following such a reaction, the product can be purified to separate the conjugated SNAP-biological / chemical entity portion from the unconjugated SNAP and biological / chemical entity.

[0219] The methods of the present disclosure can be used to spatially separate biological entities or chemical entities. In some embodiments, the methods of the present disclosure can be used to spatially separate proteins, small molecules, DNA, RNA, glycoproteins, metabolites, carbohydrates, enzymes or antibodies. In some embodiments, the methods of the present disclosure can be used to spatially separate complexes, such as protein complexes, protein nucleic acid complexes or other complexes comprising two or more proteins. In some cases, the methods can be used to spatially separate viral particles or viroids. In some cases, the methods can be used to separate cells, such as bacterial cells, microbial cells, mammalian cells or other cells.

[0220] In some embodiments, a SNAP can be formed on a seed, which is then attached to a biological or chemical entity.

[0221] In some embodiments, the present disclosure provides a composition comprising a nucleic acid SNAP attached to a protein, a nucleic acid SNAP attached to a small molecule, a nucleic acid SNAP attached to a protein complex, a nucleic acid SNAP attached to a protein nucleic acid SNAP, a nucleic acid SNAP attached to a carbohydrate, a nucleic acid SNAP attached to a viral particle, or a nucleic acid SNAP attached to a cell.

[0222] In some embodiments, the present disclosure provides a composition comprising a dendrimer attached to a protein, a dendrimer attached to a small molecule, a dendrimer attached to a protein complex, a dendrimer attached to a protein dendrimer, a dendrimer attached to a carbohydrate, a dendrimer attached to a viral particle, or a dendrimer attached to a cell.

[0223] In some cases, the biological or chemical entity can be eluted from the solid support by cleavage of a photocleavable bond or by chemical or enzymatic digestion of the SNAP.

[0224] In some cases, the biological or chemical entity can be directly attached to the solid support, while the SNAP prevents other biological or chemical entities from attaching in close proximity. In some cases, the biological or chemical entity can be directly attached to an attachment site within a microwell or nanopore, and the size of the SNAP can be selected to prevent more than one SNAP from occupying the microwell or nanopore. In this case, the SNAP can be removed by cleaving a photocleavable bond or by chemical or enzymatic digestion of the SNAP.

[0225] In some embodiments, the SNAPs of the present disclosure can be used as nanoparticles. For example, the SNAPs of the present disclosure can be used as nanoparticles for detection or visualization. In some cases, nucleic acid SNAPs can be formed that incorporate modified nucleotides containing fluorescent moieties. Any fluorescently labeled nucleotide known in the art can be used in the SNAPs of the present disclosure. Examples of fluorescently labeled nucleotides include, but are not limited to, Alexa Fluor 5-11, 5-12, 5-16, 5-17, 5-18, 5-19, 6-7, 7-8, 8-9, 9-11, 10-12, 11-13, 12-14, 13-15, 14-16, 15-17, 16-18, 17-19, 18-20, 19-21, 20-22, 21-23, 22-24, 23-25, 24-26, 25-27, 26-28, 27-29, 30-40, 31-41, 32-43, 33-44, 34-45, 35-46, 36-47, 37-48, 38-49, 40-51, 41-52, 42-43, 43-45 TM 555-aha-dCTP, Alexa Fluor TM 555-aha-dUTP, 1 mM in TE buffer, Alexa Fluor TM 647 ATP (adenosine 5'-triphosphate, Alexa Fluor TM 647 2'-(or 3')-O-(N-(2-aminoethyl)carbamate), hexa(triethylammonium) salt, Alexa Fluor TM 647-aha-dCTP, Alexa Fluor TM647-aha-dUTP, 1 mM in TE buffer, BODIPY TM FL ATP (adenosine 5'-triphosphate, BODIPY TM FL2'-(or -3')-O-(N-(2-aminoethyl)urethane), trisodium salt), 5 mM in buffer, BODIPY TM FL ATP-γ-S, thioester (adenosine 5'-O-(3-thiotriphosphate), BODIPY TM FL thioester, sodium salt), BODIPY TM FL GDP (guanosine 5'-diphosphate, BODIPY TM FL 2'-(or 3')-O-(N-(2-aminoethyl)carbamate), bis(triethylammonium) salt), ChromaTide TM Alexa Fluor TM 488-5-UTP, ChromaTide TM Alexa Fluor TM 488-5-dUTP, ChromaTide TM Alexa Fluor TM 546-14-UTP, ChromaTide TM Alexa Fluor TM 546-14-dUTP, ChromaTide TM Alexa Fluor TM 568-5-dUTP, ChromaTide TM Alexa Fluor TM 594-5-dUTP, ChromaTide TM Fluorescein-12-dUTP, ChromaTide TM Texas Red TM -12-dUTP, fluorescein-12-dUTP solution (1 mM), fluorescein-aha-dUTP-1 mM in TE buffer, guanosine 5'-O-(3-thiotriphosphate), BODIPY TM FL thioester, sodium salt (BODIPY TM FL GTP-γ-S, thioester), guanosine 5'-triphosphate, BODIPY TM FL 2'-(or -3')-O-(N-(2-aminoethyl)carbamate), trisodium salt (BODIPY TM FL GTP), guanosine 5'-triphosphate, BODIPY TMTR 2'-(or -3')-O-(N-(2-aminoethyl)carbamate), trisodium salt (BODIPY TM MANT-GTP (2'-(or -3')-O-(N-methylanthraniloyl)adenosine 5'-diphosphate, disodium salt), MANT-ATP (2'-(or -3')-O-(N-methylanthraniloyl)adenosine 5'-triphosphate, trisodium salt), MANT-GDP (2'-(or -3')-O-(N-methylanthraniloyl)guanosine 5'-diphosphate, disodium salt), MANT-GMPPNP (2'-(or -3')-O-(N-methylanthraniloyl)-β:γ-acylimidoguanosine 5'-triphosphate, and trisodium salt), MANT-GTP (2'-(or -3')-O-(N-methylanthraniloyl)guanosine 5'-triphosphate, trisodium salt).

[0226] In some cases, the SNAPs of the present disclosure can be designed so that probes can be attached to the surface of the SNAP. The SNAP with attached probes can be used as a detection reagent. In some cases, the SNAP with attached probes is also labeled with a fluorescent moiety to form a fluorescent detection reagent. In some cases, the SNAP with attached probes and fluorescent moieties can provide a high degree of signal amplification. The amount of probe on the SNAP can be titrated to achieve the desired degree of sample amplification. In some cases, SNAPs of different sizes can be attached to different probes. In some cases, SNAPs of different colors can be attached to different probes. In some cases, a library of different probes can be attached to a fluorescently labeled SNAP, such that a first probe is attached to a SNAP that is a different size and / or color than the SNAP to which the other probes are each attached. Example Example 1 - Generation of DNA SNAP

[0227] Oligonucleotides were reconstituted in dH2O to a final concentration of 100 uM, except for the extension primer which was reconstituted to 500 uM (2.9 mg / ml). The extension primer was conjugated to Deep Red 200 nm beads. Primer 1-5'-GCCAGGGTGCGAGGGTTGTTTCATTGCTTCACGCCCTT ACCCTCGCACCCTGGCACGG Primer 2-5'-TCCCACGGTGGCACCTCGCACCT Primer 3-5'-CGCACGCTGCCACCCTCGCTTTTGCGAGGGTGGCAGCG T Primer 4-5'-GCGAGGTGCGAGGTGCCACCGTGGGACCGT Extension primer - 5'-AAGGGCGTGAAGCAATGA Template amplification

[0228] The following submixes were prepared: Submix 1: Water 187.5 μL 1M Tris-HCl pH 7.5 12.5 μL Primer 1 [100uM] 50μL Submix 2: Sub-mix 3: Water 187.5 μL 1M Tris-HCl pH 7.5 12.5 μL Primer 3 [100uM] 50μL

[0229] Aliquot each submix into 100 µL aliquots and incubate as follows: Thermal cycler conditions: 95℃ 30 seconds Decrease to 50℃ at 0.1℃ / s Keep at 4°C Connection of rolling ring template mixture: Submix 1 100 μL Submix 2 100 μL Submix 3 100 μL connect: 10X NEB T4 DNA ligase buffer 200 μL Mixed oligonucleotide submix [5uM] 200μL 1500 μL water mix. Add 100 μL NEB T4 DNA ligase [400,000 u / ml]

[0230] The complete mixture was aliquoted into PCR tubes and incubated at 20°C for approximately 20 hours and then at 65°C for 10 minutes.

[0231] Combine the solutions and add 50 μL of 100 uM stock extension primer and mix. Aliquot the mixture into 100 μL aliquots in PCR tubes and subject to the following temperature conditions: Thermal cycler conditions: 70℃ 30 seconds Decrease to 40℃ at 0.1℃ / s Keep at 4°C

[0232] The template can now be stored at -20°C until ready for use. Rolling circle amplification for nanoparticle construction PCR mixture: Vortex to mix and then add: 300 μL of primed rolling circle template Vortex to mix and then add: NEB phi29 polymerase [10Ku / ml] 50μL Invert to mix. Aliquot the reaction mixture into 63 μL aliquots in PCR tubes. Incubate as follows: 30℃ for 120 minutes 65℃ for 10 minutes The samples were combined and 90 μl of 250 mM EDTA was added. The sample was centrifuged at 12,500 G for 5 minutes at 4° C. The supernatant was recovered and the white precipitate was discarded. Analysis of nanospheres

[0233] The sample (100 μl) was serially diluted 1:100 + 1:10, and then 2 μl of Sybr Gold (1x) was added. 1 μl of the spot was applied to an amine-treated slide and imaged. Figure 3A-3B and Figure 4 As shown, DNA SNAP was successfully formed, and a high degree of colocalization was found between DNA SNAP and deep red spheres. Combined analysis

[0234] In some cases, the SNAP can be removed from a surface to which it is attached (e.g., a chip or array). Removal of the SNAP can be mediated, for example, by a large amount of acetonitrile, a high concentration of sodium hydroxide, or a high concentration of salt. The large amount of acetonitrile can be a final percentage of at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% acetonitrile. The large amount of sodium hydroxide can be at least about 0.1M, 0.5M, 1M, 2M, 3M, 4M, 5M, 6M, 7M, 8M, 9M, or 10M. The large amount of salt can be at least about 0.1M, 0.5M, 1M, 2M, 3M, 4M, 5M, 6M, 7M, 8M, 9M, or 10M. The salt used can be, for example, MgCl2 or NaCl. In some cases, a chaotropic agent (e.g., DMSO or formamide) can mediate the removal of the SNAP. Example 2 - Production of SNAP using EpimarkTaq polymerase

[0235] In another example, SNAP production was optimized using Epimark Taq polymerase. SNAP templates were prepared according to the method described in Example 1 (paragraphs

[0093] -

[0098] ). Taq polymerase was determined to provide better control of SNAP size than phi29 polymerase. A 500 μl reaction mixture was prepared using 8683 ng of template. The following reagents were combined in a 1.5 ml PCR tube: PCR mixture: Briefly vortex the PCR mixture in the PCR tube. After vortexing, add 2.5 μl of Epimark Taq polymerase to the PCR mixture. Invert the PCR tube to allow the polymerase to mix with the other reagents. Place the PCR mixture in a thermal cycler. First, denature the template DNA at 94°C for 30 seconds. Amplify the reaction mixture for 30 cycles under the following thermal conditions: Denature at 94°C for 30 seconds; annealing at 53°C for 60 seconds; Extension at 68°C for 30 seconds; After the final thermocycling, the SNAP was maintained at 68°C for an additional 5 minutes. The PCR tubes were then cooled to 4°C and maintained there until purification.

[0236] SNAP was purified after synthesis. dNTPs were removed via an EDTA spin purification method. 30 μl of 250 mM EDTA was added to 500 μl of PCR mixture in a PCR tube. The PCR tube was centrifuged at 12,500G for 5 minutes at 4°C. The supernatant was saved and the precipitate was discarded. The SNAP sample was filtered through a 0.22 μm filter tube and then purified using an AKTA FPLC using a gradient method. SNAP was purified by anion exchange chromatography using 1 L of deionized water and 1 M NaCl solution (filtered through a 0.22 μm filter) each. After collecting the SNAP-containing fractions, the solution was desalted using overnight dialysis in a dialysis cassette. SNAP was concentrated using a vacuum centrifuge. The solvent was evaporated at 28°C for approximately 4 hours until the final volume was less than 500 μl. Example 3: Purification of SNAP

[0237] A batch of SNAP can be produced as described herein. Once SNAP is produced, it can be purified. A three-step example protocol for purifying SNAP is described below. Step 1: Anion exchange chromatography

[0238] Fast protein liquid chromatography (FPLC) anion exchange chromatography was used to purify SNAP. Here, a salt gradient was used to separate the differently charged DNA molecules (SNAP) for collection. Three fractions (bottom, middle, and top) were collected for analysis.

[0239] An example of anion exchange purification is Figure 5 Figure 2 shows a SNAP sample with a hydrodynamic radius of approximately 100 nm and a SNAP sample with a hydrodynamic radius of approximately 100 nm.

[0240] In some cases, size exclusion chromatography can be used instead of anion exchange chromatography for purification.

[0241] Samples from three channels were imaged using standard microscopy protocols ( Figure 6 , left), and the intensity was quantified (right). SNAP in the bottom channel exhibits higher intensity than SNAP in the middle and top channels. Therefore, in some cases, the size and / or brightness of the SNAP may elute in a specific anion exchange fraction. Step 2: Dialysis

[0242] After anion exchange chromatography, salts are removed by standard dialysis protocols. In short, dialysis is a separation technique that facilitates the removal of small, unwanted compounds (e.g., salts) from macromolecules (e.g., SNAPs) in solution by selective and passive diffusion through a semipermeable membrane. The anion exchange-purified sample containing the SNAP to be desalted and a buffer solution are placed on opposite sides of the membrane. The SNAPs are retained on the sample side of the membrane, but salts are able to pass freely through the membrane. Salts are concentrated on the side of the membrane opposite the SNAPs, thereby reducing the concentration of salts in the sample. In this way, the concentration of small contaminants such as salts in the sample is reduced to acceptable or negligible levels. Step 3: Concentration

[0243] Using a standard vacuum centrifugation protocol, batches of SNAP can be concentrated with minimal losses compared to conventional methods.

[0244] SNAP can be concentrated to a final concentration of 1 μM to 100 μM. For example, batches of SNAP were produced at concentrations of approximately 63.6 μM, 47.5 μM, 38 μM, and 8.9 μM.

[0245] Figure 7The absorption spectra at 260 nm (A260) trace for different SNAP batches are shown. Each batch was produced using different fluorescent dNTP types, fluorescent dNTPs from different suppliers, different fluorescent dyes, different Taq polymerases, and / or Taq polymerases from different suppliers. Each SNAP exhibited similar absorption spectra. Example 4: Generation of SNAPs of Desired Size

[0246] SNAPs were produced and nanoparticle size was measured as described herein.

[0247] Methods for measuring the size of nanoparticles (e.g., SNAPs) can include dynamic light scattering, nanoparticle tracking analysis, and microscopy techniques such as transmission electron microscopy (TEM), scanning electron microscopy (SEM), and atomic force microscopy (AFM).

[0248] Dynamic light scattering, as used herein, can measure the diffusion coefficient through constructive and destructive interference patterns of the entire SNAP population. Nanoparticle tracking analysis can measure the diffusion coefficient by tracking individual particles if the particle size is greater than 30 nm. Microscopy techniques including TEM, SEM, and AFM can measure particle size and allow subsequent image analysis of individual particles without relying on light scattering.

[0249] Images were taken using standard imaging protocols, and the hydrodynamic radius of the SNAPs was determined by anion exchange chromatography to be 25 nm to 27 nm. This size range may allow multiple SNAPs to occupy each feature in some applications. Figure 8 As shown, these small SNAPs were observed to colocalize within a single feature. In this example, SNAPs were applied to an array and imaged (SNAP 1 in the bottom panel and SNAP 2 in the middle panel), and colocalization was determined by merging the images (top panel).

[0250] In other experiments, larger SNAPs were applied to the chip surface. In this case, the large SNAPs arranged themselves on the chip surface, achieving "single occupancy of features." Figure 9 SNAPs with large hydrodynamic radii are shown applied to a chip with features. SNAPs are imaged in the bottom (SNAP1) and middle (SNAP2) images, and these images are superimposed in the top image (SNAP 1 and SNAP 2). No significant colocalization is observed. Thus, when SNAPs are larger in size, they can localize to features with little colocalization. In contrast, when SNAPs are smaller in size, they can colocalize to features in some cases.

[0251] To determine the appropriate size range for SNAPs, the occupancy of the SNAPs on the array can be measured. This can be measured as brightness versus dilution.

[0252] Titrate SNAP to a range of 10 -5 to 10 0 dilutions were applied to the array and the signal was measured using dynamic light scattering. For each dilution, the number of counts and the number of SNAP-occupied features ( Figure 10 ). The dark line represents the fluorescent control, while the light line represents SNAP. The dashed line represents the number of occupied features, while the solid line represents the number of counts. Different signal trends were observed for small molecules for the dyes compared to SNAPs on the array.

[0253] A constant number of counts was recorded for SNAP (solid bright line) regardless of the dilution factor, which may indicate discrete occupancy of SNAP on the features of the array.

[0254] The apparent number of occupied features was observed to vary with the detection threshold (dashed bright line). This suggests that the number of occupied features may be a function of dilution. An observer operating characteristic (ROC) curve can be developed for detection sensitivity and specificity.

[0255] SNAPs can be produced in a variety of sizes. In some cases, the diameter of a SNAP can be about 1 nm, 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 150 nm, 200 nm, 250 nm, or 300 nm. The diameter can be a large diameter, a small diameter, or an average diameter. In some cases, SNAPs can be produced such that SNAPs having a range of diameters can be produced. Example 5: Brightness of SNAP

[0256] A batch of SNAPs was applied to the array with features and imaged using a standard imaging protocol. The maximum grayscale value was approximately 12,000, and the grayscale value difference between areas with and without SNAPs was approximately 6,000, as measured by the change in grayscale value across the array. Therefore, SNAPs were able to bind to the array, and the conjugated SNAPs could be detected. Example 6: Measurement of SNAP Concentration

[0257] After SNAP is concentrated, the concentration of SNAP can be measured. For example, the o-phthalaldehyde (OPA) free amine reaction can be used to quantify amine-conjugated SNAP, such as Figure 12 Briefly, OPA can be reacted with amines to enable fluorescence detection and can be used to perform a standard curve (e.g., serial dilutions of poly-T amine from 0 to 100 μM, Figure 12) enables quantification.

[0258] The fluorescence generated by this reaction was measured at Ex / Em: 380 nm / 460 nm in three independent batches of SNAP, as Figure 12 As shown (right). A260 (absorbance at 260 nm) was quantified and applied to a standard curve to determine the concentration of each batch. The concentrations of the three batches were determined to be 47.5 μM, 38 μM, and 8.9 μM. The concentration of another batch was determined to be 63.6 μM (data not shown). The assay can measure SNAP concentrations in the range of at least 1 μM to 100 μM. In some cases, the SNAP sample can be diluted as needed to fit this range. Using this assay, relatively small amounts of amine-modified DNA (e.g., SNAP) can be measured. Example 7: SNAP Conjugation #1

[0259] The experiment was performed so that click conjugation of azide-AlexaFluor 586 to SNAP was performed on the chip. DBCO-SNAP (488) (SNAP with a DBCO group conjugated to a dye that can emit fluorescence at 488nm) was fixed on the array by flow, and images were collected at 488nm (SNAP channel) and 575nm (azide dye channel). Then, azide-568 (azide-AlexaFluor 568), which can emit fluorescence at 568nm, was incubated on the array to allow conjugation reaction between DBCO and azide, and the array was washed after incubation. After this protocol, images were collected again at 488nm and 575nm to assess the extent of the DBCO-azide reaction. After incubation, the azide dye channel showed significantly more fluorescence than before. The SNAP channel (control) showed similar signals before and after the reaction ( Figure 14 This indicates that click conjugation between DBCO and azide on the chip (array) is feasible.

[0260] For both channels, the signal-to-noise ratio and intensity ( Figure 14 These data confirm that the intensity increases significantly after the click reaction and that the click reaction performs well on the chip.

[0261] Another set of SNAPs was then immobilized on the array and conjugated with azide-AlexaFluor 568, where azide-AlexaFluor 568 was applied in a 10-fold excess of the total number of features. There were approximately 23.5 million features per flow channel. Images were taken at 488 nm and 568 nm before and after incubation, and the intensity was quantified. The intensity at 488 nm was slightly lower at 568 nm, which may be an effect of differential manual washing of the blocking solution ( Figure 15 After incubation with 10X Azide-AlexaFluor 568, the intensity at 568 nm was significantly higher (approximately 2-2.5 times), as shown in Figure 2. Figure 16 In other words, after conjugation of azide-AlexaFluor 568 at a 10-fold excess of the characteristic amount per channel, a uniform localization signal was observed at 568 nm. Example 8: SNAP Conjugation #2

[0262] Experiments were performed to perform click conjugation of PE-conjugated (R-phycoerythrin-conjugated) azide on the chip. SNAP was prepared using a DBCO handle and a nucleotide capable of fluorescing at 488 nm. SNAP was deposited on the chip surface and allowed to incubate for 1 hour to attach to the chip surface. The chip was incubated with blocking buffer for 15 to 30 minutes, and then PE (1 mg / ml) with an azide handle on the amine was flowed through the chip to give a 1000× molar excess of PE SNAP. The chip was then incubated overnight. The channel was then washed with phosphate-buffered saline with 2% Tween (PBST) and imaged.

[0263] Image such as Figure 17 As shown. Overall, there is a high PE signal throughout the flow channel, which may indicate significantly high nonspecific binding. Dotted signals or on and off features are observed. The on features are generally observed to be higher by about 2000 counts. The DBCO SNAP is present on the features and produces a lower signal than the signal from PE. In some cases, the batch of SNAP can be optimized, for example by improving the quality and increasing the concentration to produce better results. A titration series (titration of the amount of PE used) can also be performed. In addition, optimizing the blocking procedure can improve the results. Example 9: Biotinylated click-processed lysate conjugation

[0264] SNAPs prepared using DBCO handles can be deposited on the chip surface and allowed to incubate long enough to attach to the chip surface. The chip can then be incubated with blocking buffer for 15 to 30 minutes.

[0265] The lysate can be biotinylated and treated with an azide click modifier. The biotinylated lysate can be passed through the chip to allow click conjugation of the lysate to DBCO SNAP. The lysate can then be detected, for example, by a streptavidin lobe. Example 10: DNA origami

[0266] DNA origami SNAPs can be prepared, for example, using a DBCO handle and deposited on a chip surface and allowed to incubate for a sufficient time to attach to the chip surface. In some cases, the DNA origami SNAPs can be deposited on the array in a grid-like manner. In some cases, the origami SNAPs can be approximately 300 nm.

[0267] In some cases, DNA origami SNAPs can provide flexibility in SNAP organization, shape, design, and size compared to other types of SNAPs. Example 11: Immobilization of proteins from lysates on arrays

[0268] SNAP was immobilized on the array by flow cytometry. SNAP fluorescence was detected using a standard imaging protocol with a 100 × 100 μm field of view ( Figure 18 A and Figure 18 D in FIG). E. coli lysate containing a biotin handle was applied to the array and the protein was allowed to bind to the SNAP. As a control, the SNAP was exposed to a lysate lacking a biotin handle and allowed to conjugate with it. Fluorescence imaging was performed using a standard imaging protocol using fluorescent streptavidin (which can bind to biotin for detection) with a 100 × 100 μm field of view to detect the lysate, as shown in FIG. Figure 18 B (biotin handle) and Figure 18 As shown in (E) (control). Because the immobilized lysate does not contain a biotin tag, the fluorescent streptavidin cannot detect the protein. This control demonstrates that the detection signal observed in (B) is specific for the immobilized protein (i.e., there is no nonspecific binding of the streptavidin detection reagent to the array surface).

[0269] exist Figure 18 In C (biotin handle) and F (control) in 18, black and white images are composited to show the colocalization of SNAP and biotin-treated lysates. In the colocalization images, white indicates colocalization, and black indicates no colocalization.

[0270] The fiducial is visible in the lower left corner of the image. HMDS lanes without feature patterning can be seen as dark stripes at the top and right edges of the field of view. SNAPs can be seen on individual features within the subarray. Note: SNAPs are also easier to visualize due to fluorescence cross-talk from the detection channel into this channel (see B). Example 12: Specific detection of short peptide epitopes (trimers)

[0271] Fluorescently labeled SNAP was immobilized on the array by flow cytometry. A small peptide (HHH*) was conjugated to SNAP. As a control, SNAP was immobilized on the chip and no peptide was conjugated to SNAP. A fluorescent aptamer specific for the small HHH peptide was applied. SNAP fluorescence was detected using a standard imaging protocol with a 35×35 μm field of view ( Figure 19 A and Figure 19 (D in Figure 1). This field of view shows the corner of one subarray on the chip. The immobilized SNAPs can be seen as discrete spots on the array (each of these spots has a diameter of 300 nm).

[0272] Fluorescence imaging was performed to detect the peptide ( Figure 19 B (peptide) and Figure 19 E in (no peptide control).

[0273] The black and white images were composited to show the colocalization of SNAP and HHH peptides. Figure 19 C (peptide) and Figure 19 F (no peptide control) in FIG shows colocalization of fluorescence between the SNAP peptide channel and the aptamer detection channel. Colocalization can indicate successful binding and identification of the HHH peptide on the SNAP on the array feature. Figure 19 There is no bound aptamer in F, so the merged image of the control image shows no colocalization.

[0274] In the no-peptide control image, no HHH was detected in the aptamer fluorescence channel because the HHH peptide was unable to bind to the SNAP on the array. Therefore, this result confirms that the HHH peptide is 1) directly attached to the SNAP and 2) the signal observed in the aptamer channel is only observed in the presence of the target peptide.

[0275] Two chrome fiducial marks can be seen in the lower right corner of the image. The darker channel in the image is the HMDS-coated area and does not contain patterned features.

[0276] Although preferred embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Many variations, changes, and substitutions will occur to those skilled in the art at this time without departing from the present invention. It should be understood that various alternatives to the embodiments of the present invention described herein may be employed in practicing the present invention. It is intended that the following claims define the scope of the invention, and that methods and structures within the scope of these claims and their equivalents are also encompassed within the present invention.

Claims

1. A composition comprising a structured nucleic acid particle (SNAP) covalently attached to a protein.

2. The composition of claim 1, wherein the SNAP is attached to a solid support.

3. The composition of claim 2, wherein the SNAP is covalently attached to a solid support.

4. The composition of claim 2, wherein the SNAP is non-covalently attached to a solid support.

5. A composition comprising a nucleic acid SNAP covalently attached to a biomolecule.

6. The composition of claim 5, wherein the SNAP is attached to a solid support.

7. The composition of claim 6, wherein the SNAP is covalently attached to a solid support.

8. The composition of claim 6; wherein the SNAP is non-covalently attached to a solid support.

9. A composition comprising a solid support attached to a plurality of structured nucleic acid particles (SNAPs), wherein each of the plurality of SNAPs is attached to a biomolecule.

10. The composition of claim 9, wherein the plurality of SNAPs are arranged in an array.

Images