Primers for a molecular marker of the GAREM1 gene associated with the average daily weight gain trait in pigs and their application

Abstract

This invention relates to primers for a molecular marker of the GAREM1 gene associated with the average daily weight gain trait in pigs and its applications, belonging to the field of biotechnology. The GAREM1 gene molecular marker of this invention is located at base 116131455 on chromosome 6 of the pig reference genome Sscrofa11.1 version, with a base mutation of A, resulting in genotypes A / A and A / T. Pigs with the A / T genotype have a higher average daily weight gain than those with the A / A genotype. This invention utilizes forward and reverse primer pairs to amplify fragments containing the aforementioned molecular marker site and performs Sanger sequencing on the amplified products, enabling rapid and accurate identification of an individual's genotype. This molecular marker can serve as a genetic marker for pig breeding, allowing for the selection of pigs of appropriate weight. It can efficiently and accurately detect the average daily weight gain trait in pigs, and has significant value for pig breeding and production.

Description

Technical Field

[0001] This invention relates to primers for a molecular marker of the GAREM1 gene associated with the average daily weight gain trait in pigs and their applications, belonging to the field of biotechnology. Background Technology

[0002] Average daily gain (ADG) and age at 100 kg body weight (AGE) are two core indicators for measuring pig growth efficiency and economic benefits. ADG directly reflects the daily weight gain of pigs and is a key indicator for assessing the production efficiency of the pig industry. A higher ADG means that pigs can gain weight faster, which is significant for shortening the breeding cycle, improving breeding efficiency, and reducing the production cost per unit weight. From a genetic perspective, ADG has a certain degree of heritability, indicating that selectively breeding pigs with high ADG traits can, to some extent, improve the growth rate of the entire pig herd. Furthermore, recent studies have revealed the important role of the gastrointestinal microbiota and serum metabolites in regulating pig ADG, providing new perspectives for improving ADG through nutritional and health management.

[0003] On the other hand, the AGE (Advanced Time to Growth) index measures the time required for pigs to reach market weight. A shorter AGE means pigs can reach slaughter weight faster, which has a positive impact on improving capital turnover and market responsiveness. Factors such as breed, nutrition, environment, and management all affect AGE. For example, different breeds of pigs have different ages required to reach the same weight, which is directly related to the breed's genetic characteristics. At the same time, improving feeding and management conditions and optimizing feed formulation can effectively shorten the AGE of pigs, thereby improving farming efficiency. Therefore, farmers need to comprehensively consider these factors and optimize their farming strategies through scientific methods to improve ADG (Advanced Growth Rate) and shorten AGE, achieving efficient and economical pork production.

[0004] Therefore, accurately identifying genotypes associated with average daily weight gain using molecular markers and applying them to early breeding selection can accelerate the breeding cycle, reduce time and feeding costs, and improve resource utilization. Summary of the Invention

[0005] The purpose of this invention is to address the shortcomings of existing technologies by proposing a primer for a molecular marker of the GAREM1 gene associated with the average daily weight gain trait in pigs and its application, which can rapidly and accurately assess the average daily weight gain of pigs at different growth stages.

[0006] The GAREM1 gene is associated with weight gain. Studies have shown that GAREM1 plays an important regulatory role in weight gain and is related to pig growth and development, suggesting a close link between the GAREM1 gene and body weight.

[0007] This invention measures the average daily weight gain of pigs, uses second-generation sequencing technology to perform whole-genome SNP genotyping, and screens out the GAREM1 gene molecular marker that is significantly associated with the average daily weight gain trait of pigs through genome-wide association analysis, providing new gene and molecular marker resources for the breeding of pigs with the average daily weight gain trait.

[0008] This invention solves the technical problem through the following technical solution: First, it provides a molecular marker for the GAREM1 gene associated with the average daily weight gain trait in pigs. The nucleotide sequences of the SNP primers corresponding to the molecular marker are shown in SEQ ID NO:1 and SEQ ID NO:2. The molecular marker site is located at base 116131455 on chromosome 6 of the pig reference genome Sscrofa11.1, with a base mutation of A. The sequence is shown at base 155 in SEQ ID NO:3 or SEQ ID NO:4.

[0009] This invention further provides an application of the GAREM1 gene molecular marker associated with the average daily weight gain trait in pigs, using the SNP primers for detecting the average daily weight gain trait in pigs. Specifically, the method for detecting the SNP genotype associated with the average daily weight gain trait in pigs using PCR amplification combined with Sanger sequencing includes the following steps:

[0010] The first step involves providing a DNA sample from the pig to be tested, and performing PCR amplification using DNA-specific primers designed for the MEP1B gene molecular marker to obtain the amplification product. The pig DNA sample contains an SNP molecular marker at position 116131455 of chromosome 6.

[0011] The second step is to perform Sanger sequencing on the PCR products.

[0012] The third step is to determine the SNP molecular marker genotype at position 116131455 of chromosome 6 of the pig based on the sequencing results from the second step.

[0013] The deoxyribonucleotide sequence of the DNA-specific primer pair mentioned in the first step is as follows:

[0014] Upstream primer: 5'- AGTCTTCGTTCCAGTCGGTT-3' (SEQ ID NO: 1)

[0015] Downstream primer: 5'-CACTTCCCCTTGCACTTGAC-3' (SEQ ID NO: 2) wherein the amplification product of the first step is 270 bp in length and contains the base at position 116131455 of the 6th chromosome of pig.

[0016] The final concentration of the reaction system (25 μl) is:

[0017] 50 ng of pig DNA to be tested

[0018] 2 x Accurate Taq Master Mix 12.5μl

[0019] upstream primer 1 μl

[0020] 1 μl of downstream primer

[0021] Add sterile water to a final volume of 25 μl.

[0022] The PCR amplification reaction conditions were as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 60 sec, for a total of 30 cycles; 72℃ extension for 2 min; and storage at 4℃.

[0023] The criterion for the third step is that the average daily weight gain of pigs with the SNP locus A / T genotype is higher than that of individuals with the A / A genotype at all stages.

[0024] This invention reveals that at a specific locus in the GAREM1 gene, pigs with a particular genotype exhibit significantly higher average daily weight gain than individuals with other genotypes. Specifically, pigs with the A / T genotype show a higher average daily weight gain than those with the A / A genotype. This discovery provides new genetic markers and selection methods for pig breeding and production.

[0025] To achieve rapid and accurate identification of average daily weight gain in pigs, this invention uses genomic DNA from the pigs to be tested as a template and employs specific primers for PCR amplification. These specific primers are designed based on SNP sites in the GAREM1 gene associated with the target trait and can accurately amplify DNA fragments containing these SNP sites. Subsequently, the PCR amplification products are subjected to Sanger sequencing, and the sequencing results can determine the SNP molecular marker genotype of the pig GAREM1 gene.

[0026] In breeding practice, based on breeding objectives, breeders can select pig herds with higher average daily weight gain by culling A / A genotype individuals and retaining A / T genotype individuals. This method is not only efficient and rapid, but also significantly improves the uniformity of average daily weight gain in pig herds, providing a scientific basis for early selection and breeding of pigs.

[0027] Furthermore, the detection method disclosed in this invention is simple and easy to operate, and can be widely carried out under laboratory conditions, providing great convenience for pig breeding and production practices. This discovery is not only of great value for pig breeding, but also provides a useful reference for the genetic improvement of other livestock. Moreover, the detection method disclosed in this invention is simple and easy to operate, and can be carried out in a laboratory. Attached Figure Description

[0028] Figure 1 Manhattan plots show the longitudinal trait association analysis of average daily weight gain in pigs over four periods.

[0029] Figure 2 These are Sanger sequencing results of PCR amplification products from three genotypes. Detailed Implementation

[0030] The following examples are applicable to the breeding of pigs.

[0031] Example

[0032] In this embodiment, the average daily weight gain of Large White pigs was measured, and genome-wide SNP genotyping was performed using next-generation sequencing technology. Genome-wide association analysis was used to screen for the GAREM1 gene molecular marker, which was significantly associated with average daily weight gain. The results are as follows: Figure 1 As shown.

[0033] This embodiment uses the following experiments to identify and apply the molecular marker of the GAREM1 gene related to average daily weight gain in pigs.

[0034] 1. Phenotypic determination and genotypic testing

[0035] (1) Experimental materials and determination of average daily weight gain phenotype

[0036] Five hundred Large White pigs were selected as experimental animals and raised under the same feeding conditions. Throughout the process, they were given free access to food and water. The average daily weight gain of the 500 pigs was recorded as phenotypic data of the average daily weight gain of the pigs.

[0037] (2) Extraction of genomic DNA

[0038] ① Take 25 mg of ear tissue from the left and right sides and place it in a centrifuge tube. Add the mixture to a 1.5 ml centrifuge tube, add 400 µl of Buffer Digestion, and vortex to mix. Incubate at 65°C for 1 h until the cells are completely lysed.

[0039] ② Add 20 μL of Proteinase K solution, vortex to mix, and place in a 56°C water bath for digestion overnight.

[0040] ③ Add 500 µl of Buffer PA, mix thoroughly by inverting, and place in a -20°C refrigerator for 5 min.

[0041] ④ Centrifuge at 10,000 rpm for 5 min at room temperature, and transfer the supernatant (500-550 µl) to a new 1.5 ml centrifuge tube.

[0042] ⑤ Add an equal volume of isopropanol, invert 5-8 times to mix thoroughly, and let stand at room temperature for 2-3 minutes. Centrifuge at 10,000 rpm for 5 minutes at room temperature and discard the supernatant.

[0043] ⑥ Add 1 ml of 75% ethanol, rinse by inversion for 1-3 min, centrifuge at 10,000 rpm for 2 min, and discard the supernatant.

[0044] ⑦ Repeat step 6.

[0045] ⑧ Open the lid and invert at room temperature for 5-10 minutes until the residual ethanol has completely evaporated.

[0046] ⑨ Dissolve the obtained DNA in 50-100 µl of TE buffer. The extracted DNA can be used immediately for the next experiment or stored at -20°C.

[0047] ⑩ Determine the concentration. After measuring the mass and concentration with a spectrophotometer, dilute the concentration to 50 ng / μL and store at -20℃ for later use.

[0048] (3) PCR amplification

[0049] Using the extracted genomic DNA as a template, the fragment containing base 116131455 of chromosome 6 was amplified.

[0050] Upstream primer: 5'- AGTCTTCGTTCCAGTCGGTT-3' (SEQ ID NO: 1)

[0051] Downstream primer: 5'-CACTTCCCCTTGCACTTGAC-3' (SEQ ID NO: 2)

[0052] The final concentration of the reaction system (25 μl) is:

[0053] DNA to be tested 50 ng

[0054] 2 x Accurate Taq Master Mix 12.5μl

[0055] upstream primer 1 μl

[0056] 1 μl of downstream primer

[0057] Add sterile water to a final volume of 25 μl.

[0058] The PCR amplification reaction conditions were as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 60 sec, for a total of 30 cycles; 72℃ extension for 2 min; storage at 4℃; 10 μl was used for agarose gel assay, and an amplification product with a single target band length of 270 bp was obtained, containing the SNP molecular marker at position 116131455 of porcine chromosome 6. The sequence of the amplified product is shown in SEQ ID NO: 3.

[0059] CACGGTGGTTGTGGCCAGTGCATCGGCCCTTCTTGGGGCTCTTACAGTCTTCGTTCCAGTCGGTTTTCACATCTCGGACAGCCCGTGAATACTCATCGATGTCGAACTGTTCTTGGCAGATACCCAGCCAGTGATG GACCAAGGTTTCAGGCCATTCTCCCCCTTCACCAGGTGTTCAGGGAGGCTAAACTTGGGGACAGTCAAGTGCAAGGGGAAGTGCATGGGGAGGATCTTGTTGTTCCGCAGCACACAGCAAACCACCACTGTCTT

[0060] Or SEQ ID NO: As shown in 4, CACGGTGGTTGTGGCCAGTGCATCGGCCCTTCTTGGGGCTCTTACAGTCTTCGTTCCAGTCGGTTTTCACATCTCGGACAGCCCGTGAATACTCATCGATGTCGAACTGTTCTTGCCAGATACCCAGCCAGTGA TGGACCAAGGTTTCAGGCCATACTTCCCCCTTCACCAGGTGTTCAGGGAGGCTAAACTTGGGGACAGTCAAGTGCAAGGGGAAGTGCATGGGGAGGATCTTGTTGTTCCGCAGCACACAGCAAACCACCACTGTCTT.

[0061] (4) Sanger sequencing and genotyping

[0062] The PCR products of each sample were subjected to Sanger sequencing, and the sequencing peak diagrams of different genotypes were obtained as follows: Figure 2 As shown.

[0063] (5) Genotyping and genome-wide association analysis of 60K SNP microarray in the pig genome

[0064] Genotyping of pigs was performed according to the company's standard procedures. The "Zhongxin-1" 50K SNP chip was used to detect SNP genotypes in breeding pigs with average daily weight gain records. Quality control was performed on all SNP marker detection results. Genome-wide association analysis revealed that significant SNPs at the genome level were concentrated on pig chromosome 6.

[0065] 2. Correlation analysis

[0066] Five hundred Large White pigs with clearly recorded average daily weight gain phenotypes were selected, and their average daily weight gain was recorded. Statistical analysis was performed using the ANOVA function in R 4.2 statistical plotting software. The pairwise mean comparison mode was selected to statistically test the genotype and average daily weight gain traits of the experimental pig population. P < 0.05 indicated a significant difference. The average daily weight gain of the A / T genotype individuals was 811g, higher than the 759g of the A / A genotype (P < 0.05). The results show that the porcine GAREM1 gene molecular marker is significantly correlated with the average daily weight gain trait, as shown in Table 1. Based on actual breeding goals, selecting A / T genotype individuals can improve the overall average daily weight gain and uniformity, thereby increasing breeding efficiency.

[0067] Table 1. Genotype frequencies of the two genotypes in the sample.

[0068] In addition to the above-described embodiments, the present invention may have other implementations. All technical solutions formed by equivalent substitution or equivalent transformation fall within the protection scope claimed by the present invention.

Claims

1. The use of a GAREM1 gene molecular marker primer for detecting a trait associated with average daily gain in swine, characterized by: The nucleotide sequence of the primer is shown as SEQ ID NO: 1 and SEQ ID NO: 2, the molecular marker site is located at the 116131455th base of chromosome 6 of the pig reference genome Sscrofa11.1 version 6, and the base mutation is A / T; the primer is used for detecting the average daily gain trait of pigs, the pigs are Large White pigs, and the detection method comprises the following steps, ​ In the first step, the DNA sample of the pig to be detected is subjected to PCR amplification with the SNP primer shown as SEQ ID NO: 1-2 to obtain an amplification product containing the 116131455th base of chromosome 6 of the pig; In the second step, the PCR product is subjected to Sanger sequencing; In the third step, the SNP molecular marker genotype of the 116131455th base of chromosome 6 of the pig reference genome Sscrofa11.1 version 6 is judged according to the sequencing result of the second step, and the judgment standard is that the average daily gain of the pig with A / A genotype at the SNP site is higher than that of the individual with A / T genotype at each period.

2. The use of the GAREM1 gene molecular marker primer for detecting the pig average daily gain trait-related gene according to claim 1, characterized in that: The PCR reaction system in the first step is 25 μl, and the system is DNA of the pig to be detected 50 ng 2 x Accurate Taq Master Mix 12.5 μl Upstream primer 1 μl Downstream primer 1 μl Sterile water is supplemented to 25 μl.

3. The use of the GAREM1 gene molecular marker primer for detecting the pig average daily gain trait-related gene according to claim 2, characterized in that: The reaction conditions of the PCR amplification in the first step are 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 60 sec, a total of 30 cycles; 72℃ extension for 2 min; and 4℃ storage.

Images