A method for improving the cold resistance of grape

By regulating the resveratrol content in grape seedlings, including inducing endogenous synthesis, spraying exogenous resveratrol, and gene editing, the problems of high labor intensity and long variety selection cycle of existing cold-resistant measures have been solved, achieving rapid, environmentally friendly, and stable cold-resistant effects for grapes.

CN120731796BActive Publication Date: 2026-08-25CHANGLI INST OF POMOLOGY HEBEI ACADEMY OF AGRI & FORESTRY SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510849076.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-24
Publication Date
2026-08-25
Estimated Expiration
2045-06-24

AI Technical Summary

Technical Problem

Existing cold-resistant measures, such as burying grapes in soil for frost protection and using chemical antifreeze agents, involve high labor intensity and environmental pollution. Meanwhile, the breeding cycle for cold-resistant varieties is long and may lead to a decline in fruit quality. Therefore, it is urgent to improve the cold resistance of grapes.

Method used

The cold resistance of grapes can be improved by regulating the resveratrol content in grape seedlings, including inducing endogenous synthesis, spraying exogenous resveratrol, selecting rootstock varieties with high synthesis levels, knocking out or silencing the VvERF113 gene, using rootstock varieties with downregulated VvERF113 gene expression, or increasing VvSTS gene expression.

Benefits of technology

Resveratrol pretreatment of grape seedlings reduces ROS accumulation at low temperatures, maintains maximum quantum efficiency of high light system II, and significantly improves cold resistance. Exogenous Res spraying and UV-C irradiation can enhance cold resistance, and gene editing technology can stably improve cold resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120731796B_ABST
    Figure CN120731796B_ABST
Patent Text Reader

Abstract

The present application relates to a method for improving the cold resistance of grape, which comprises any one of the following modes or a combination thereof: (a) inducing the synthesis of endogenous resveratrol in grape scion; (b) spraying exogenous resveratrol on grape seedling; (c) selecting rootstock varieties with higher resveratrol synthesis level; (d) knocking out / silencing the VvERF113 gene of the scion by gene editing technology; (e) using rootstock varieties with down-regulated VvERF113 gene expression; (f) increasing the expression of VvSTS gene of the scion or rootstock. The present application improves the cold resistance of grape seedling by regulating the content of resveratrol in grape seedling, and has the advantages of fast transformation speed, stable cold resistance, good environmental protection, etc. for non-cold-resistant seedlings.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically to a method for improving the cold resistance of grapes. Background Technology

[0002] Grapes (Vitis spp.) are an important global economic crop, and their cultivation is often affected by low-temperature stress. Statistics show that winter temperatures below -5℃ can lead to a 30%-50% mortality rate in grape buds. Traditional cold-resistant measures (such as burying the grapes in soil for frost protection and using chemical antifreeze agents) are labor-intensive and environmentally polluting, while existing cold-resistant varieties have long breeding cycles (usually 8-10 years) and may be accompanied by a decline in fruit quality. Therefore, there is an urgent need to develop technologies for regulating the cold resistance of grapes. Summary of the Invention

[0003] (a) Technical problems to be solved

[0004] In view of the above-mentioned shortcomings and deficiencies of the prior art, the present invention provides a method for improving the cold resistance of grapes. This method improves the cold resistance of grape seedlings by regulating the content of resveratrol in the seedlings. It has the advantages of fast modification speed, stable cold resistance, and good environmental protection for non-cold-resistant seedlings.

[0005] (II) Technical Solution

[0006] This invention provides a method for improving the cold resistance of grapes, comprising any one or a combination of the following:

[0007] (a) Inducing the synthesis of endogenous resveratrol in grape scions;

[0008] (b) Spray exogenous resveratrol onto grape seedlings;

[0009] (c) Select rootstock varieties with higher resveratrol synthesis levels;

[0010] (d) Knockout / silence of the VvERF113 gene in the scion using gene editing technology;

[0011] (e) Rootstock varieties with downregulated VvERF113 gene expression;

[0012] (f) Increase the expression of the VvSTS gene in scions or rootstocks.

[0013] According to a preferred embodiment of the present invention, the method for inducing the synthesis of endogenous resveratrol in grape scions in method (a) is: UV-C irradiation to induce the synthesis of endogenous resveratrol; preferably, the irradiation parameters are 20 seconds / time / day and wavelength 254nm.

[0014] According to a preferred embodiment of the present invention, the timing of spraying exogenous resveratrol in method (b) is: spraying before winter.

[0015] According to a preferred embodiment of the present invention, the amino acid sequence of the VvERF113 gene in mode (d) is shown in SEQ ID NO.1.

[0016] According to a preferred embodiment of the present invention, in method (d), the VvERF113 gene of the scion is knocked out using CRISPR-Cas9.

[0017] According to a preferred embodiment of the present invention, method (f) includes: selecting a combination with high grafting compatibility, introducing a VvSTS overexpression vector driven by a strong promoter into a scion or rootstock; and treating the scion with a graft (e.g., grafting a cold-resistant rootstock to a scion, altering chromatin accessibility through scion-rootstock interaction) or an epigenetic regulator (e.g., treatment with a DNA methylation inhibitor) to increase the chromatin accessibility of the endogenous VvSTS locus.

[0018] According to a preferred embodiment of the present invention, the chromatin accessibility region described in mode (f) is located at:

[0019] VvSTS1(VIT_16s0100g00900) promoter region -2000bp to transcription start site;

[0020] VvSTS2(VIT_16s0100g01000) Intron 1 region.

[0021] Secondly, the present invention relates to the application of the VvERF113 gene shown in SEQ ID NO.1 in grape cold resistance breeding and improving grape cold resistance.

[0022] (III) Beneficial Effects

[0023] This invention demonstrates that under cold stress, resveratrol can alleviate ROS-induced grape cell damage by reducing H2O2 and MDA levels. Seedlings pretreated with resveratrol maintained a higher maximum quantum efficiency (Fv / Fm) of photosystem II (PSII) and exhibited reduced ROS accumulation, demonstrating stronger cold resistance. Furthermore, exogenous Res application and exposure to UV-C can jointly enhance the cold resistance conferred by resveratrol on grapes.

[0024] To identify the regulators of resveratrol biosynthesis that promote cold resistance in grafted plants, the association between differentially accessible regions (DARs) and differentially expressed genes (DEGs) in leaves of grafted and self-rooted plants under cold treatment was analyzed. A transcription factor, VvERF113, was ultimately identified. In grafted grapes, chromatin condensation of this gene (reduced DAR) directly led to a decrease in its transcriptional level (DEG downregulation). Yeast two-hybrid experiments showed that VvERF113 can directly bind to multiple VvSTS genes. The promoter of VvERF113 was modified to suppress VvSTS gene expression. Under cold stress, the growth status of VvERF113OE callus (overexpressing VvERF113) was examined, revealing increased cold sensitivity, indicating that VvERF113 may negatively regulate cold resistance by inhibiting resveratrol biosynthesis. Therefore, knocking out / silencing the VvERF113 gene in grafts using gene editing technology or using rootstock varieties with downregulated VvERF113 gene expression can help improve the cold resistance of grapevines. Attached Figure Description

[0025] Figure 1 The study compared the cold resistance of Thomson nucleus-free callus cultured in media without Res and media with Res. A represents the phenotypic changes of callus cultured in media without Res and media with 0.2 mM Res before and after treatment at 4°C for 20 days. B and C represent the changes in callus fresh weight, proline, MDA and hydrogen peroxide content, respectively.

[0026] Figure 2 The study compared the cold resistance of Thomson seedless seedlings pretreated with and without exogenous Res; AC compared the fresh weight, chlorophyll content, and maximum quantum efficiency of seedlings pretreated with and without Res after treatment at 4°C for 2 days; DE showed the ROS accumulation (NBT staining) and DAB staining changes of seedlings pretreated with and without Res after treatment at 4°C for 2 days.

[0027] Figure 3 The study compared the cold resistance of Thomson seedless plants treated with and without UV-C. AC compared the fresh weight, leaf chlorophyll content, and maximum quantum efficiency of Thomson seedless plants treated with and without UV-C after 2 days of treatment at 4°C. DE showed the ROS accumulation (NBT staining) and DAB staining changes of Thomson seedless plants treated with and without UV-C after 2 days of treatment at 4°C.

[0028] Figure 4To evaluate the effects of transcription factor VvERF113 on VvSTS transcription, the experimental results are as follows: A shows the results of a yeast one-way cross experiment, which shows that the VvERF113 protein can directly bind to the promoter of the VvSTS gene; B shows the results of a transient expression experiment in tobacco leaves, which shows that VvERF113 can inhibit the activity of the VvSTSpro:LUC reporter gene.

[0029] Figure 5 The relative expression of the target gene in callus tissue and transgenic plants overexpressing VvERF113 (VvERF113OE) transformed by Agrobacterium-mediated transformation is shown in Figure A. The relative expression of VvERF113 in overexpressing transgenic callus tissue is shown in Figure B.

[0030] Figure 6 This study compares the cold resistance of wild-type and VvERF113-OE transgenic non-embryonic callus / VvERF113-OE transgenic plants; A shows the phenotypic changes of wild-type and VvERF113-OE transgenic non-embryonic callus before and after 21 days of treatment at 4℃; B shows the changes in VvERF113 gene expression in callus at different time points; CF shows the changes in fresh weight, proline, hydrogen peroxide, and MDA of callus before and after cold treatment; GH shows the changes in trans (G) and cis (H) resveratrol content in callus before and after cold treatment; I shows the cold resistance of wild-type and VvERF113-OE transgenic plants. - Phenotypic changes in OE transgenic plants before and after 8 h of treatment at 4℃; JK represents chlorophyll fluorescence images and NBT staining (characterizing ROS damage) of leaves of wild-type and VvERF113-OE transgenic plants before and after cold stress; MN represents changes in trans (G) and cis (H) resveratrol content in wild-type and VvERF113-OE transgenic plants before and after cold stress; data are expressed as mean ± standard deviation; n = 3 biological replicates; different lowercase letters above the error line indicate significant differences obtained by one-way ANOVA combined with Tukey's test (P < 0.05). Detailed Implementation

[0031] To better explain and facilitate understanding of the present invention, the present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0032] Example 1

[0033] This embodiment investigated the regulatory mechanism of resveratrol (Res) on cold stress in grapes from multiple perspectives. The experimental methods are as follows:

[0034] 1. Culture grape 'Thomson Seedless' callus under low temperature conditions and evaluate its growth with and without the addition of exogenous resveratrol.

[0035] The following groups were set up in this experiment:

[0036] Non-cold stress control group: 'Thomson nucleus-free' callus was cultured in a dark incubator at 23°C.

[0037] Cold stress experimental group: ① 'Thomson nucleus-free' callus was inoculated into solid B5 medium containing 0.2 mM RES (resveratrol) and cultured in a dark incubator at 4℃ for 20 days. ② 'Thomson nucleus-free' callus was inoculated into solid B5 medium without RES and cultured in a dark incubator at 4℃ for 20 days.

[0038] Experimental results are as follows Figure 1 As shown in the AE diagram, compared with the non-cold stress control (day 0), cold stress (day 20) significantly inhibited callus growth and decreased plant fresh weight. Simultaneously, cold stress led to the accumulation of compounds such as proline content, hydrogen peroxide, and malondialdehyde (MDA). However, it is noteworthy that the concentrations of hydrogen peroxide and MDA were significantly lower in the resveratrol-containing medium group under cold stress (Res group, day 20), while the proline content was higher in the resveratrol-containing medium group under cold stress. Proline plays a crucial protective and regulatory role in plant response to low-temperature stress and enhancing cold resistance. These results indicate that resveratrol (Res) can alleviate ROS-induced grape cell damage by reducing H2O2 and MDA levels and increase proline content to improve grape cell cold resistance.

[0039] 2. Under low-temperature conditions, the cold tolerance of 'Thomson Seedless' subculture seedlings was compared between those treated with and without Res pretreatment. The 'Thomson Seedless' seedlings used in this experiment were obtained by transplanting tissue culture seedlings into soil and cultivating them at 25℃ under a 16-hour light / 8-hour dark light cycle to obtain two-month-old seedlings. During the low-temperature treatment, all plants were placed in a 0℃ low-temperature storage environment for 48 hours (2 days) before being photographed. The Res pretreatment group involved spraying the seedling leaves with a 0.2 mM RES solution until droplets were visible.

[0040] Experimental results are as follows Figure 2 As shown in the AE, the fresh weight of seedlings pretreated with Res and the chlorophyll content of leaves were both greater than those of the control group (e.g., Figure 2 (A and B), and maintains a higher maximum quantum efficiency (Fv / Fm) for optical system II (PSII) (e.g. Figure 2 (C). Figure 2 The D value represents the result of NBT (nitroblue tetrazolium) staining, indicating that seedling leaves pretreated with Res have less ROS accumulation. Figure 2E was detected by staining with DAB (dimethylbenzidine) dye. The staining results showed that the leaves of seedlings pretreated with Res had fewer lesions. These experiments demonstrate that Res pretreatment reduces ROS accumulation in seedlings, resulting in plants exhibiting stronger cold resistance.

[0041] 3. First, expose the 'Thomson Seedless' vines to 20 seconds of UV-C irradiation, followed by 24 hours of dark treatment at 4°C. Then, irradiate with UV light for 20 seconds daily for two consecutive days. UV-C light is the most effective Res biosynthesis inducer among all tested stimuli, therefore, short-pulse UV-C irradiation before cold treatment increases the endogenous Res level of the grapes.

[0042] The 'Thomson Seedless' seedlings used in this experiment were obtained by transplanting tissue culture seedlings into soil and cultivating them at 25℃ under a 16-hour light / 8-hour dark light cycle to obtain two-month-old seedlings. UV-C (ultraviolet C band) is the shortest wavelength and highest energy part of the ultraviolet spectrum, with a wavelength range of 200–280 nm, and a commonly used wavelength of 254 nm. Since it is completely absorbed by the Earth's ozone layer and does not exist in the natural environment, artificial light sources (such as low-pressure mercury lamps) are used to stably emit 254 nm UV-C.

[0043] Experimental results are as follows Figure 3 As shown in the AE, the fresh weight of seedlings treated with UV-C and the chlorophyll content of their leaves were both greater than those of the control group (e.g., Figure 3 (A and B), and maintains a higher maximum quantum efficiency (Fv / Fm) for optical system II (PSII) (e.g. Figure 3 (C), seedling leaves pretreated with Res showed higher SOD activity (e.g., C), Figure 3 (D) and fewer damage spots (e.g.) Figure 3 The above experiments demonstrate that UV-C pretreatment can promote the synthesis of endogenous Res in plants, thereby reducing ROS accumulation in seedlings and resulting in stronger cold resistance in the plants.

[0044] Figure 1-3 In this study, data are expressed as mean ± standard deviation; n = 3 biological replicates. Different lowercase letters above the error lines indicate significant differences obtained through one-way ANOVA combined with Tukey's test (P < 0.05).

[0045] Example 2

[0046] This embodiment evaluates the effect of transcription factor VvERF113 on VvSTS transcription to examine whether VvERF113 regulates resveratrol biosynthesis. The VvSTS gene family is a key gene family in grape (Vitis vinifera) encoding stilbene synthase (STS), responsible for catalyzing the biosynthesis of resveratrol and its derivatives. This embodiment includes a yeast one-hybrid experiment and a transient expression experiment in tobacco (Nicotiana abenthamiana) leaves.

[0047] The VvERF113 gene sequence (SEQ ID NO.1) is as follows:

[0048] ATGTCCGCTATGGTTTCAGCTCTCACTCAAGTCATTGGAAACACTGACAAAAACCCACTTCATGATCTTGGAAACCCCATCACCAATCTCACCACTCCGCCACAACCCCACATGATCAACCTTCTCAGCTTCTTCAAGATCAAGGGAACCAGCTGAGGAGAAGACACTATAGGGGAGTAAGGCA AAGACCTTGGGGGAAGTGGGCAGCTGAGATACGTGATCCAAATAAGGCAGCTCGAGTATGGCTGGGCACTTTCGACACTGCTGAGGATGCTGCACTTGCCTATGATGAAGCTGCTCTTAGGTTCAAAGGAAACAAAGCCAAGCTTAACTTCCCTGAAAGAGTTCAAGGCCGAAGCGAATTAGGTT ACCTCACAAATCGTCAAGACTTCCTTCTTCCTCAGCAACAACAGCTTCCCAACCCTGCTGTTCCTCCTCTTCCTCATCCATCCCTCCCTCGACCGTCATATCCCAATCTTCATCACTATGCTCAGCTCCTTCCAGGTGGAGGTGGTGATTTAAATCATGCTATGTCCAGTCTTTATGGTAGAGAA GCTTCTACTACGCAGTCTTTGTCAACTACATCTTCATCTTCTTCTACAACCTCTCATCCACAACACCATCAGCGAAGACGACAACGAGAAGAAGAAGAATTACAACAACCACAACTTCTACAATTTTCATCACTGTTTGGAAGTTCTTCTAGCAACGACCCTCACAATAACAGGAGAGATGACTGA

[0049] The experimental results and outcomes of this embodiment are as follows:

[0050] 1. Yeast one-hybrid experiment

[0051] (1) Activation of yeast strains

[0052] Take the glycerol tube of yeast strain EGY48 from the -80℃ freezer, dip a small amount of bacterial solution into the inoculation loop, streak it on a YPD solid medium plate, and incubate it upside down in a 30℃ incubator for 2-3 days until a single colony grows.

[0053] (2) Preparation of yeast competent cells

[0054] Select a single colony of EGY48 yeast and inoculate it into 5ml LYPD liquid medium. Incubate overnight at 30°C with shaking at 220 rpm to allow the yeast cells to enter the logarithmic growth phase.

[0055] Take an appropriate amount of the overnight culture and transfer it to 50ml of LYPD liquid medium to allow the initial OD to rise. 600 The value is approximately 0.2; continue culturing until OD... 600 The value is 0.4-0.6. Transfer the bacterial culture to a 50mL centrifuge tube, centrifuge at 3000rpm for 5min at room temperature, and discard the supernatant.

[0056] Add 30 mL of sterile water, gently suspend the cells, centrifuge at 3000 rpm for 5 min, and discard the supernatant.

[0057] Add 1.5 mL of 1×TE / LiAc solution (10 mM Tris-HCl, 1 mM EDTA, 100 mM LiAc, pH 7.5), gently suspend the cells, and transfer them to a 1.5 mL centrifuge tube to obtain competent yeast cells.

[0058] (3) Co-transformation

[0059] Take 100 μL of competent yeast cells and add 10 μL of plasmid containing the AD fusion protein (approximately 1 μg), 10 μL of VvSTSp:LacZ reporter vector (approximately 1 μg), and 5 μL of denatured SS-DNA (10 mg / mL), then gently mix. Add 600 μL of PEG / LiAc solution (40% PEG3350, 100 mM LiAc, 10 mM Tris-HCl, 1 mM EDTA, pH 7.5), mix thoroughly, and incubate at 30°C for 30 min, inverting the container to mix every 10 min. Add 70 μL of DMSO, mix gently, heat shock at 42°C for 15 min, then incubate on ice for 2 min. Centrifuge at 12000 rpm for 10 s at room temperature, discard the supernatant, and add 500 μL of sterile water to gently resuspend the cells.

[0060] (4) Coating screening

[0061] The transformed yeast cell suspension was evenly spread on SD / -Ura-Leu medium plates and gently spread with a sterile spreader to ensure even distribution of cells.

[0062] Place the plate upside down in a 30°C incubator and incubate for 3 days until transformant colonies grow.

[0063] (5) Blue-white screening

[0064] Use a sterile toothpick to pick up transformant colonies from an SD / -Ura-Leu medium plate and spot them onto a default medium plate containing X-gal. Spot each colony at one location and mark it.

[0065] Place the plate in a 30℃ incubator and continue culturing for 1-2 days, then observe the changes in colony color.

[0066] Blue colonies indicate that the VvERF113 protein can bind to the promoter of the VvSTS gene, activating the expression of the LacZ reporter gene; white colonies indicate that no binding occurs or the binding does not activate reporter gene expression.

[0067] Experimental results are as follows Figure 4 As shown in Figure A, yeast one-hybrid experiments showed that VvERF113 can directly bind to the promoters of multiple VvSTS genes.

[0068] 2. Transient expression experiment of tobacco

[0069] (1) The VvERF113 gene and the VvSTS promoter-driven luciferase (LUC) reporter gene were constructed into the pCAMBIA plant expression vector, respectively. The constructed plant expression vectors were then transformed into Agrobacterium EHA105.

[0070] (2) Agrobacterium (EHA105) was resuspended in an infiltration buffer (OD600 = 1.5) containing 10 mM MES, 10 mM MgCl2, and 100 μM acetylsylgenone. After 2 hours of dark incubation, it was injected into tobacco leaves to ensure that Agrobacterium could effectively enter the leaf cells. After 1 day of dark treatment, it was transferred to light and cultured for 2 days, followed by spraying with 2.5 mM luciferase substrate for color development. The luciferase activity of VvERF113 co-expressed and VvSTS promoter-LUC reporter gene expressed alone was compared to determine whether VvERF113 inhibited the expression of the VvSTS gene.

[0071] Experimental results are as follows Figure 4 As shown in Figure B, transient expression experiments in tobacco leaves indicate that VvERF113 can inhibit the activity of the VvSTSpro:LUC reporter gene, which means that VvERF113 directly inhibits the transcription of VvSTS.

[0072] In summary, these findings indicate that VvERF113 negatively regulates resveratrol synthesis in plants by directly binding to the promoter of the VvSTS gene and inhibiting VvSTS gene expression.

[0073] Example 3

[0074] This embodiment further investigates the effect of overexpression of VvERF113 on the cold resistance of grapes. In this embodiment, an experiment was conducted to transform non-embryonic callus of the 'Thompson Seedless' variety, generating callus and transgenic plants overexpressing VvERF113 (VvERF113OE) (see A and B in 5).

[0075] In the following experiments, chlorophyll fluorescence and Fv / Fm measurements were performed as follows: Six leaves were randomly selected, and after dark adaptation for 30 min, the maximum photochemical efficiency of PSⅡ and fluorescence imaging were measured using a chlorophyll fluorescence imager (CFImager). ROS measurement was performed as follows: Six leaves were randomly selected, and NBT (0.5 g / L) and DAB (0.5 g / L) staining solutions were vacuum permeated for 3 hours, followed by overnight soaking at room temperature. After decolorization with 95% ethanol, the leaves were photographed. Separately, 0.5 g of the leaves were extracted with acetone, centrifuged, and then a TiCl4 / HCl mixture and ammonia were added. The H2O2 content was measured at 415 nm.

[0076] Non-embryonic callus transformation:

[0077] (1) Agrobacterium infection: Two-week-old non-embryonic callus was infected with Agrobacterium for 15 minutes, so that Agrobacterium had enough time to transfer the exogenous gene to the callus cells.

[0078] (2) Inoculation and culture: The Agrobacterium tumefaciens liquid on the surface of the infected callus was blotted dry with filter paper, and then inoculated into MS solid medium and cultured in the dark at 25°C for 2 days to provide a suitable environment for cell transformation and recovery.

[0079] (3) Screening culture: Two days later, the callus tissue was transferred to X6 medium containing 75 mg / L kanamycin or 5 mg / L hygromycin. The kanamycin or hygromycin was used as a screening pressure to screen out successfully transformed callus tissue, and finally transgenic callus tissue overexpressing VvERF113 was obtained.

[0080] Figure 5 A represents the gene expression analysis of VvERF113 in overexpressing transgenic callus and the identification of positive VvERF113-OE transgenic callus by GFP antibody analysis. Data are presented as mean ± standard deviation; n = 3 biological replicates. Statistical significance was calculated using t-tests (*P < 0.05, **P < 0.01). Among the transgenic callus, VvERF113 overexpression level was the highest in VvERF113-OE#2 transgenic callus.

[0081] Generation of transgenic plants:

[0082] (1) Material preparation: Anther-induced suspension cells were used as starting material.

[0083] (2) Agrobacterium-mediated transformation: The target gene VvERF113 was introduced into suspension cells using the Agrobacterium-mediated method.

[0084] (3) Screening culture: 200 mg / L carbenicillin, 250 mg / L cephalosporin and 5 mg / L hygromycin were added to X6 medium for screening. Carbenicillin and cephalosporin were used to inhibit the growth of Agrobacterium, while hygromycin was used as a screening marker. Only cells that successfully integrated the exogenous gene (including the hygromycin resistance gene) could grow on this medium.

[0085] (4) Plant regeneration and identification: Somatic embryo regenerated plants were selected, and positive seedlings were identified by Western blot and RT-qPCR. Western blot can detect the expression of the target protein, while RT-qPCR is used to detect the transcription level of the target gene, thereby determining whether it is a transgenic plant overexpressing VvERF113.

[0086] Figure 5 B represents the gene expression analysis of VvERF113 in overexpressing transgenic plants and the identification of positive VvERF113-OE transgenic plants by GFP antibody analysis. Data are presented as mean ± standard deviation; n = 3 biological replicates. Statistical significance was calculated using t-tests (*P < 0.05, **P < 0.01). Among them, the VvERF113-OE#4 transgenic plant showed the highest overexpression level of VvERF113.

[0087] After expression analysis, the transgenic callus and transgenic plants with the highest VvERF113 overexpression level were selected for further analysis.

[0088] Wild-type EV-OE and VvERF113-OE transgenic callus tissues were treated at 4℃ for 21 days, and phenotypic changes before and after treatment were observed. The experimental results are as follows: Figure 6 As shown in AH.

[0089] like Figure 6 As shown in Figure A, the VvERF113-OE transgenic callus phenotype was consistent with the wild-type at day 0. The VvERF113-OE transgenic callus was brown at day 9, with a higher degree of browning than the wild-type. At day 21, the VvERF113-OE transgenic callus turned a darker brown, indicating more severe damage from low temperatures. Figure 6 As shown in Figure B, the expression level of VvERF113 in VvERF113-OE transgenic callus was higher than that in wild-type. Figure 6 As shown in Figure C, the fresh weight of VvERF113-OE transgenic callus tissue after 20 days of low-temperature treatment was significantly lower than that of the wild type. Figure 6 As shown in the DF, after 20 days of low-temperature treatment, the proline content, H2O2, and MDA content in the VvERF113-OE transgenic callus were significantly higher than those in the wild-type EV-OE. Figure 6 As shown in the GH, after 20 days of low-temperature treatment, the content of white trans (G) and cis (H) resveratrol in the fresh weight of VvERF113-OE transgenic callus was much lower than that of wild-type EV-OE.

[0090] In summary, under cold stress, VvERF113-OE transgenic non-embryonic callus tissue showed increased sensitivity to cold, manifested as reduced fresh weight and increased MDA, proline, and H2O2 content, while resveratrol content as a percentage of fresh weight decreased significantly.

[0091] Wild-type EV-OE and VvERF113-OE transgenic plants were treated at 4℃ for 8 hours, and phenotypic changes before and after treatment were observed. The experimental results are as follows: Figure 6 As shown in IN. Figure 6 As shown in Figure I, after 8 hours of low-temperature treatment, the VvERF113-OE transgenic plants (transgenic plants on the right) showed sensitivity to cold treatment, exhibiting leaf wilting after cold stress, and the degree of wilting was higher than that of the wild type. Figure 6 As shown in Figure J, the chlorophyll loss in the leaves of VvERF113-OE transgenic plants was greater than that in the wild type after 8 hours of low-temperature treatment. Figure 6 As shown in K, after 8 hours of low-temperature treatment, the degree of ROS damage in the leaves of VvERF113-OE transgenic plants was higher than that in wild-type plants. Figure 6 As shown in Figure L, the MDA content of VvERF113-OE transgenic plants was higher than that of wild-type plants after 8 hours of low-temperature treatment. Figure 6 As shown in MN, after 8 hours of low-temperature treatment, the trans (G) and cis (H) resveratrol contents of VvERF113-OE transgenic plants were lower than those of wild type.

[0092] The above experimental results indicate that, compared with the wild type, VvERF113-overexpressing plants showed increased sensitivity to cold, increased chlorophyll loss and leaf damage, and increased MDA accumulation, while resveratrol content was significantly lower than that of the wild-type control group. These findings suggest that VvERF113 inhibits resveratrol biosynthesis and negatively regulates the plant's cold resistance.

[0093] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features. These modifications or substitutions, or combinations of technical features in the above embodiments that do not conflict with each other, can be made in accordance with the manner described in the embodiments. These modifications, substitutions or combinations do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for improving the cold resistance of grapes, characterized in that, include: Any one of the following methods or a combination thereof: (a) Knocking out / silencing the VvERF113 gene in the scion using gene editing technology; (b) Rootstock varieties with downregulated VvERF113 gene expression.

2. The method according to claim 1, characterized in that, The amino acid sequence of the VvERF113 gene in method (a) is shown in SEQ ID NO.

1.

3. The method according to claim 1, characterized in that, In method (a), the VvERF113 gene of the scion was knocked out using CRISPR-Cas9.

4. The method according to claim 1, characterized in that, Also includes: Select grafting-compatible combinations to introduce VvSTS overexpression vectors driven by strong promoters into scions or rootstocks, and treat the scions with grafting or epigenetic regulators to increase chromatin accessibility of the endogenous VvSTS locus; the chromatin accessibility region is located in: VvSTS1 (VIT_16s0100g00900) promoter region -2000bp to transcription start site; VvSTS2 (VIT_16s0100g01000) Intron 1 region.

5. Application of the VvERF113 gene shown in SEQ ID NO.1 in grape cold resistance breeding and improving grape cold resistance.

Citation Information

Patent Citations

  • Gene for improving content of resveratrol in grapes and application thereof

    CN119799722A