Application of soybean RALF protein in promoting non-leguminous plants infected by rhizobium

Abstract

The invention discloses a method for promoting non-leguminous plants infected by rhizobium through soybean RALF protein and application of the soybean RALF protein. The amino acid of the RALF protein is shown as SEQ ID No: 1, and the related GmRALF9 small peptide sequence of the RALF protein is shown as SEQ ID No: 9; the GmRALF9 small peptide treatment changes the root hair forms of arabidopsis thaliana and rice, specifically, the top end is deformed and expanded; the GmRALF9 small peptide is used for treatment, infection and colonization of arabidopsis thaliana root hair cells by the rhizobium are finally achieved, the method is the first step of symbiotic nodulation, and a new thought and method are provided for research on symbiotic nitrogen fixation of non-leguminous plants.

Description

Technical Field

[0001] The present invention relates to the field of plant-microorganism interaction, and in particular to a method and application of soybean GmRALF9 peptide in achieving rhizobium infection of non-leguminous plants. Background Art

[0002] Legumes can coexist with rhizobia, forming specialized tissues called nodules within their roots. Within the nodules, the nodule cells provide the microorganisms with a carbon source and lipids, sustaining their normal life activities. In turn, the microorganisms convert inorganic nitrogen from the air into organic nitrogen that can be directly absorbed and utilized by the plants, forming a mutually beneficial symbiotic relationship between the two. Therefore, in agricultural production, effectively utilizing biologically fixed nitrogen is a key approach to reducing nitrogen fertilizer use, alleviating environmental pollution, and developing sustainable modern agriculture. Breaking down the barrier between rhizobia and non-legumes to achieve symbiotic nitrogen fixation by rhizobia in non-legumes is a key research goal.

[0003] To enter the root hair cells of legumes, rhizobia need to be recognized by receptors to activate downstream symbiotic signaling. Simultaneously, the plant's innate immune system must be weakened to facilitate entry, thereby coordinating and completing the entire biological process more quickly and accurately. Rapid alkalinization factor (RALF) plays an important role in various life processes, such as cell expansion, signal transduction, root growth, pollen tube development, and biotic and abiotic stresses. Previous studies have shown that in Arabidopsis, RALF is involved in the plant immune suppression response mediated by FERONIA. Therefore, the RALF protein may play a role in the biological process of rhizobia entering plant cells. Summary of the Invention

[0004] The purpose of the present invention is to screen and provide a plant peptide that realizes the infection of rhizobia to non-legumes, mainly focusing on the method and application of soybean GmRALF9 peptide to realize the infection of non-legumes by rhizobia.

[0005] The RALF candidate protein is a protein composed of the amino acids shown in SEQ ID No: 1;

[0006] The use of the RALF protein in at least one of the following ① to ④:

[0007] ① The expression in soybean roots is induced by rhizobia;

[0008] ②Inhibited the plant's innate immune response;

[0009] ③Change the morphology of root hair cells of non-leguminous plants;

[0010] ④ Enable rhizobia to enter the root hairs of non-leguminous plants and initiate symbiotic nodulation.

[0011] Specifically, in the first aspect, the present invention provides an application of the above-mentioned protein, in which the immune response mainly refers to the burst of reactive oxygen species and the activation of MAPK cascade reaction; the change in the morphology of root hair cells of non-legume plants is mainly manifested as the deformation and swelling of the root hair tips of Arabidopsis thaliana (Col-0) and rice (Zhonghua 11); and the entry of rhizobia into the root hair cells of non-legume plants (Arabidopsis thaliana Col-0).

[0012] The present invention also provides a use of soybean GmRALF peptide in promoting rhizobia infection of non-leguminous plants. The nucleotide and amino acid sequence of the GmRALF peptide RALF protein is shown in SEQ ID No: 9 in the sequence listing.

[0013] In the application of soybean RALF protein in achieving rhizobium infection of non-legume plants, the legume plant is wild type soybean (Williams 82), and the non-legume plants are mainly Arabidopsis thaliana (Col-0) and rice (Zhonghua 11).

[0014] The present invention used qPCR to analyze the transcriptional expression of related RALF genes during rhizobium infection of soybeans and found that the expression of GmRALF9, GmRALF13, and GmRALF5 was induced by rhizobia; GmRALF9 could inhibit the burst of reactive oxygen species and the MAPK cascade reaction; in addition, the artificially synthesized GmRALF9 small peptide could cause the root hair tips of Arabidopsis and rice to deform and swell; in Arabidopsis, GmRALF9 helped rhizobia successfully enter the root hair cells and show signs of extension, and initiated symbiotic nodulation. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The gene expression levels of GmRALF5, GmRALF9, and GmRALF13 in wild-type soybean (W82) after treatment with Bradyrhizobium sojae (UADA110) for 0 h, 12 h, and 24 h.

[0016] Figure 2 Treatment with synthetic RALF peptides inhibited the accumulation of reactive oxygen species in soybean leaves and roots under flg22 stimulation (A), chitin stimulation (B), and the MAPK cascade reaction (C).

[0017] Figure 3 To study the effects of treatment with synthetic RALF peptides on the root hair morphology of non-legume plants Arabidopsis thaliana (Col-0) and rice (Zhonghua 11).

[0018] Figure 4Figure 4 shows the infection of Arabidopsis thaliana (Col-0) root hairs by a rhizobium strain carrying a GFP reporter gene under the treatment of synthetic RALF peptide (4A) and laser confocal Z-stack layered scanning analysis (4B). DETAILED DESCRIPTION

[0019] The methods in the following examples are all conventional methods unless otherwise specified.

[0020] Example 1: Related GmRALF genes are strongly induced by rhizobium treatment

[0021] First, the relevant GmRALF gene sequence was found in the database and primers were designed for cloning. The cloning primers are as follows:

[0022] GmRALF9 primers:

[0023] GmRALF9-F: AGCAGGCTTCGAATTCATGGGGAGCTCAACCTTC;

[0024] GmRALF9-R: AAGCTGGGTTCTCGAGACGCCTGCATCGGGTGATAG.

[0025] GmRALF5 primers:

[0026] GmRALF5-F: AGCAGGCTTC GAATTCATGGAGTGTCATTGTGTAAC; GmRALF5-R: AAGCTGGGTTCTCGAGGCTCCTGCACCTGGTGATG.

[0027] GmRALF13 primers:

[0028] GmRALF13-F: AGCAGGCTTC GAATTCATGGCGAAGTCGTGTTCC;

[0029] GmRALF13-R:AAGCTGGGTT CTCGAGCTGGCAGGCATCAGCCCAG.

[0030] GmRALF1 primers:

[0031] GmRALF1-F: AGCAGGCTTCGAATTCATGACACACAGCTGTAAACC;

[0032] GmRALF1-R:AAGCTGGGTTCTCGAGTCTCCCGGCAGCGCGTGATG.

[0033] Using soybean W82 root cDNA as a template, PCR reaction was performed using the above primers (95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 58°C annealing for 15 s, 72°C extension for 15 s, 35 cycles; 72°C complete extension for 5 min); ligated to the cloning vector by homologous recombination and subsequent identification and sequencing were performed.

[0034] The results showed that the gene encoding the GmRALF9 protein was shown in SEQ ID No: 5, and the encoded GmRALF9 protein was shown in SEQ ID No: 1; the gene encoding the GmRALF13 protein was shown in SEQ ID No: 6, and the encoded GmRALF13 protein was shown in SEQ ID No: 2; the gene encoding the GmRALF5 protein was shown in SEQ ID No: 7, and the encoded GmRALF5 protein was shown in SEQ ID No: 3; the gene encoding the GmRALF1 protein was shown in SEQ ID No: 8, and the encoded GmRALF1 protein was shown in SEQ ID No: 4.

[0035] Subsequently, soybean W82 plants (WT) cultured for 5 days were treated with or without Bradyrhizobium sojae (USDA110). Samples were taken 12 and 24 hours after treatment, respectively. RNA was extracted from plants cultured under both conditions and then reverse transcribed into cDNA using a reverse transcription kit. Quantitative primer sequences for GmRALF9, GmRALF13, and GmRALF5 were synthesized:

[0036] GmRALF9-QF:CTGTGTGCAATCTTGGCCGT

[0037] GmRALF9-QR:CATCAGAAACTCGGCGTCGT

[0038] GmRALF5-QF:CTCGTATACGTGGCTCTTCC

[0039] GmRALF5-QR:TGATGTACTTGGTCGTGGCT

[0040] GmRALF13-QF:GGCGAAGTCGTGTTCCTTAG

[0041] GmRALF13-QR:CCAGGCACTCAGCAATGGAT

[0042] GmActin-QF: CCGGTCGTGACCTCACTGATTTCT

[0043] GmActin-QR:CATCAGGCAACTCGTAGCTCTTTCCG

[0044] qPCR was then used for verification (95°C pre-denaturation for 30s, 95°C denaturation for 5s, 60°C annealing / extension for 30s, 40 cycles). The results are as follows: Figure 1 As shown in the results, it was found that the expression of GmRALF9, GmRALF13, and GmRALF5 was induced by rhizobia, indicating that GmRALF9, GmRALF13, and GmRALF5 were involved in the symbiotic signal transduction process and played an important role in responding to rhizobium invasion.

[0045] Example 2: GmRALF peptide inhibits the release of reactive oxygen species and the MAPK cascade reaction

[0046] The artificially synthesized RALF peptide sequence was selected based on the synthetic sequence in the literature "Stegmann, Martin, et al." Thereceptor kinase FER is a RALF-regulated scaffold controlling plant immune signaling." Science 355.6322(2017):287.", which is a mature RALF peptide to exert its function.

[0047] In order to facilitate the detection of the effects of RALF peptides on related biological processes, GmRALF9 (SEQ ID No: 9), GmRALF13 (SEQ ID No: 10), and GmRALF1 (SEQ ID No: 12) peptides were artificially synthesized, with GmRALF1 serving as a candidate supplementary control.

[0048] The specific implementation operations are as follows:

[0049] Reactive Oxygen Species Burst Assay: Circular leaves of equal size were taken from 2-week-old soybean seedlings using a 5 mm diameter cork punch and placed face-up into a 96-well plate containing 50 μL of ddH2O. The plates were equilibrated overnight at 25°C. The next day, 50 μL of working solution containing a final concentration of 25 μL of L-012, HRP, the corresponding flg22, and different RALF peptides (see Table 1) were added to the 96-well plate. Chemiluminescence intensity of the different treatments was measured using a microplate reader.

[0050] Table 1.

[0051] Reagent name Dosage HRP(500X) 20 μL L-012(1000X) 8μL flg22 Final concentration 1 μmol GmRALF9 / GmRALF13 / GmRALF1 Final concentration 2 μmol <![CDATA[ddH2O]]> Make up to 5ml

[0052] Root reactive oxygen species detection: 1 cm length of soybean root tips at the same location were taken and placed in ddH2O to equilibrate overnight at 25°C; the next day, they were treated with 50 μg / ml Chitin + different concentrations of 2 μmol RALF peptides; they were then stained with 20 μmol H2DCFDA and fluorescence detection was performed under a fluorescence microscope.

[0053] MAPK assay: Circular leaves of the same size were taken from 2-week-old soybean seedlings using a 5 mm diameter cork punch and placed face up in a 96-well plate containing 50 μL ddH2O. The plates were equilibrated at 25°C overnight. The next day, the plates were treated with 1 μmol flg22 and different concentrations of 2 μmol RALF peptides. Proteins were extracted from the treated plant tissues for immunoblotting, and MAPK phosphorylation was detected using the specific antibody α-p44 / p42.

[0054] Results and analysis: GmRALF9 and GmRALF13 can inhibit the reactive oxygen species burst induced by flg22 in soybean leaves ( Figure 2 A) and MAPK phosphorylation ( Figure 2 B); GmRALF9 can inhibit the accumulation of reactive oxygen species induced by chitin in soybean root tips; however, GmRALF1 has no such effect ( Figure 2 Middle A).

[0055] Example 3: GmRALF9 peptide alters the morphology of root hair cells in Arabidopsis and rice

[0056] 1. Seed disinfection

[0057] Arabidopsis: Place an appropriate amount of dried wild-type Arabidopsis Col-0 seeds in a 2 mL centrifuge tube and add 1 mL of Arabidopsis seed disinfectant (75% ethanol, 0.01% Tween 20). Disinfect twice for 5 minutes each. Wash three times with sterile water for 5 minutes each. Finally, add a small amount of sterilized ddH2O to the tube to submerge the seeds. Vernalize at 4°C for 2-3 days before subsequent experiments.

[0058] Rice: Mature seeds of the rice variety Zhonghua 11 were hulled and soaked in 75% ethanol for 1 minute. The seeds were then sterilized in a 3.3% NaClO solution with shaking for 20 minutes, repeated twice. The seeds were rinsed three times with sterile water before use in subsequent experiments.

[0059] 2. Seed germination and cultivation

[0060] Select plump seeds and plant them on 1 / 2MS solid medium (with 2 μmol GmRALF9 and GmRALF1 added respectively), first culture them in the dark for 2 days, and then transfer them to a constant temperature and light incubator (16 h light / 8 h dark) at 23°C (Arabidopsis) or 28°C (rice) for vertical culture.

[0061] 3. Root hair morphology observation

[0062] The root tissues under different treatments were observed under an ordinary optical microscope.

[0063] Results and analysis: The growth of Arabidopsis root hairs was significantly inhibited by GmRALF9 treatment, and the apex was enlarged. The growth of rice Zhonghua 11 root hairs was not inhibited by GmRALF9 treatment, but the apex was also enlarged. Figure 3 However, no changes were observed after GmRALF1 treatment. Root hair deformation is a key characteristic of legumes infected with rhizobia and can be used as evidence of rhizobium invasion. The phenotypes observed with GmRALF9 treatment in Arabidopsis and rice suggest that GmRALF9 may play a role in rhizobium infection of root hair cells in these two non-legume plants.

[0064] Example 4: GmRALF9 peptide enables rhizobium infection of Arabidopsis root hair cells

[0065] 1. Disinfection of Arabidopsis seeds

[0066] The method is the same as that described in step 1 of Example 3.

[0067] 2. Cultivation of Arabidopsis thaliana

[0068] Vernalized seeds were spotted on 1 / 2MS solid medium and cultured in a 23°C constant temperature and illumination incubator (16 h light / 8 h dark) for 5 days. Then, seedlings with good growth and consistent status were transferred to nitrogen-deficient 1 / 2MS solid medium (containing 2 μmol of artificially synthesized GmRALF9 (SEQ ID No: 9) and GmRALF1 (SEQ ID No: 12) respectively) and cultured for another 3 days.

[0069] 3. Cultivation of Rhizobia

[0070] To facilitate observation of infection status, Bradyrhizobium.Diazoefficiens strains labeled with GFP reporter gene were used. The specific culture method is as follows:

[0071] Remove the frozen strain from a -80°C freezer and streak onto a TY medium plate containing 50 μg / mL spectinomycin hydrochloride and 25 μg / mL tetracycline. Incubate at 28°C for 7 days. Next, select a single colony and inoculate it into TY liquid medium containing the same antibiotics. Incubate at 28°C, shaking at 200 rpm, to an OD600 of approximately 0.8. Collect the cells at 5400g for 10 minutes and rinse once with sterile water to an OD600 of approximately 0.1.

[0072] TY medium formula: 5g / L tryptone, 3g / L yeast extract, autoclaved at 121°C for 20 minutes. Add 10ml of sterile 1M CaCl2 solution to each liter of sterilized TY liquid medium. For solids, add 15g / L Agar.

[0073] The Bradyrhizobium.Diazoefficiens-GFP strain is described in: Ledermann R, Bartsch I, Remus-Emsermann MN, et al. Stable Fluorescent and Enzymatic Tagging of Bradyrhizobium diazoefficiens to Analyze Host-Plant Infection and Colonization[J]. Molecular plant-microbe interactions: MPMI, 2015, 28(9). DOI: 10.1094 / MPMI-03-15-0054-TA. It is available to the public from China Agricultural University.

[0074] 4. Rhizobium treatment

[0075] After 3 days of treatment with different RALFs, the seedlings were immersed in the bacterial solution with adjusted OD for 10 minutes, then the bacterial solution was poured out and the seedlings were air-dried on a clean bench for 10 minutes; and the seedlings were cultured in an incubator for 3-5 days.

[0076] 5. Fluorescence observation: The treated root tissue was washed three times with sterile water, and then the infection was observed under a laser confocal microscope.

[0077] Results and analysis: GFP signal was detected inside the top of the root hair cells of the seedlings treated with GmRALF9, indicating that the rhizobia successfully entered the cells; while no GFP signal was detected in the root hair cells of the seedlings treated with GmRALF1 ( Figure 4 A). And the 3D layered scanning results also showed that the GFP signal was located inside the root hair ( Figure 4B). The above results indicate that GmRALF9 treatment successfully achieved rhizobium infection of root hair cells of non-legume plants (Arabidopsis thaliana).

[0078] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various variations or modifications within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A soybean GmRALF peptide for promoting rhizobium infection of non-leguminous plants, characterized in that: The amino acid sequence of the GmRALF peptide is shown in SEQ ID No: 9 in the sequence listing.

2. The use according to claim 1, characterized in that The non-legume plant is Arabidopsis thaliana or rice.

3. Use of a soybean RALF protein or a gene encoding the same in at least one of the following: ① Expression in legumes is induced by rhizobia; ②Inhibited the plant's innate immune response; ③Change the morphology of root hair cells of non-leguminous plants; ④ Enable rhizobia to enter the root hairs of non-leguminous plants and initiate symbiotic nodulation. The amino acid sequence of the RALF protein is shown in SEQ ID No:

1.

4. The use according to claim 3, characterized in that The legume plant is soybean, and the non-legume plant is Arabidopsis thaliana or rice.

5. The use according to claim 3, characterized in that The nucleotide sequence of the coding gene is SEQ ID No: 5.

Images