Aspergillus oryzae C02 and application thereof

Abstract

The application relates to a strain of aspergillus oryzae (A. oryzae) C02 and application thereof, and belongs to the technical field of microorganisms. Aspergillus oryzae The aspergillus oryzae C02 disclosed by the application has been preserved in the Guangdong Provincial Microbial Culture Collection Center, and the preservation number is GDMCC NO.66457. The strain is obtained by being separated, purified and screened from a soil sample collected in the garden of the Guangzhou South China National Botanical Garden. Tests show that the bacteriostatic active substance produced by fermentation of the strain has good bacteriostatic effects on pseudomonas putida, escherichia coli, staphylococcus aureus, burkholderia cepacia, candida albicans and propionibacterium acnes. The bacteriostatic active substance has the characteristics of high-temperature resistance and excellent preservative effect, can be used as a bacteriostatic and preservative raw material, and can be applied to the fields of food, health products or daily chemical products, and has wide application prospects and important transformation research value.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of microbial technology, in particular to a strain of Aspergillus oryzae C02 and its application. BACKGROUND

[0002] Cosmetics usually contain nutrients such as oils, proteins, polysaccharides, and various moisturizing factors. These components not only provide good use performance to the product, but also provide a favorable environment for the growth and reproduction of microorganisms. In order to ensure that the product does not deteriorate due to microbial contamination within the specified shelf life, and to protect the safety of consumers and the stability of the product, preservatives are usually added to the formula to inhibit the proliferation of microorganisms.

[0003] However, the widely used chemical preservatives generally have defects in safety and compatibility. For example, phenoxyethanol has broad-spectrum antibacterial properties, but has been confirmed to be associated with skin adverse reactions such as contact allergy, eczema, and urticaria; the safety of methylisothiazolinone (MIT) and methylchloroisothiazolinone (CMIT) is widely questioned due to their potential cytotoxicity and neurotoxicity; traditional preservatives such as benzyl alcohol, sodium benzoate, and potassium sorbate may cause skin irritation or allergic dermatitis, and their antibacterial activity is limited by the pH value of the system, making the application conditions more demanding. In addition, some preservatives also have strong odor, affect the stability of the formula, and other problems, limiting their application in high-end or sensitive skin products.

[0004] In recent years, plant antibacterial ingredients of natural origin have attracted attention due to their "green" and "mild" labels, but most natural preservatives still have problems such as obvious color and odor, phototoxicity risk, narrow antibacterial spectrum, high cost, and may affect the sensory properties and material state of the final product. Therefore, it is necessary to develop a safe, efficient, and stable natural antibacterial ingredient to reduce the amount of preservatives used in the development and design of cosmetic formulations or replace the use of preservatives to achieve high antibacterial effect. SUMMARY

[0005] The purpose of the present application is to overcome the deficiencies of the prior art and provide an Aspergillus oryzae C02 strain producing high antibacterial activity substances. The strain is isolated, purified, and screened from soil samples collected from the Guangzhou South China National Botanical Garden, and has been preserved in the Guangdong Provincial Microbial Culture Collection Center with the preservation number GDMCC NO.66457.

[0006] In a first aspect, the present application provides an Aspergillus oryzae strain (Aspergillus oryzae C02), which has been preserved in the Guangdong Provincial Microbial Culture Collection Center on June 4, 2025, with the preservation number GDMCC NO.66457 and the preservation address being No. 59 Building, 5th Floor, 100 Middle Liangma Street, Guangzhou. Aspergillus oryzae

[0007] ​In a second aspect, the present application provides an application of the Aspergillus oryzae C02 in the first aspect in preparation of bacteriostatic active substances.

[0008] In a third aspect, the present application provides a method for fermenting the Aspergillus oryzae C02 in the first aspect to produce bacteriostatic active substances, comprising the following steps:

[0009] S1, seed liquid culture: the frozen strain C02 is activated, and after activation, the culture medium block containing the colony is picked and added to the PDB liquid culture medium for culture to obtain a seed liquid;

[0010] S2, solid fermentation: the seed liquid is uniformly coated on the solid fermentation medium for light-proof fermentation;

[0011] S3, after the fermentation is completed, the solid fermentation medium covered with mycelium is crushed, an equal volume of ethyl acetate is added for ultrasonic-assisted extraction, and then the extraction is carried out at room temperature, followed by suction filtration to obtain an extract and a solid part;

[0012] S4, the extract is collected for concentration treatment to obtain the bacteriostatic active substances.

[0013] Preferably, in the step S1, the culture temperature is 25-30℃, the culture rotation speed is 180-220rpm, and the culture time is 12-18h.

[0014] Preferably, in the step S2, the fermentation temperature is 25-30℃, and the fermentation time is 4-6 days.

[0015] Preferably, in the step S3, the ultrasonic power is 200-600w, the ultrasonic time is 15-50min, and the extraction at room temperature is carried out for 1-3h.

[0016] Preferably, in the step S3, the solid part is added with an equal volume of ethyl acetate for extraction at room temperature for 1-3h, followed by suction filtration, and the extraction is repeated for 2-3 times to obtain the extract.

[0017] Preferably, in the step S4, the extract is concentrated to completely remove the solvent.

[0018] In a fourth aspect, the present application provides an application of the bacteriostatic active substances prepared by the method in the third aspect in preparation of food, health products or daily chemical products.

[0019] Compared with the prior art, the present application has the following beneficial effects:

[0020] The inventors of the present application isolated, purified and screened the Aspergillus oryzae C02 from the soil samples collected in the Guangzhou South China National Botanical Garden.

[0021] 1. The bacteriostatic test results show that the bacteriostatic active substance produced by fermentation of the isolated Aspergillus oryzae C02 has a broad-spectrum bacteriostatic effect on Pseudomonas putida, Escherichia coli, Staphylococcus aureus, Burkholderia cepacia, Candida albicans and Propionibacterium acnes. The diameters of the bacteriostatic circles of the above six indicator bacteria are all greater than 15 mm.

[0022] 2. The minimum bacteriostatic concentration test results show that the minimum bacteriostatic concentration (MIC) of the bacteriostatic active substance produced by fermentation of the strain C02 on Staphylococcus aureus and Candida albicans is 25 μg / mL or less, on Pseudomonas putida and Escherichia coli is 50 μg / mL or less, on Burkholderia cepacia is 100 μg / mL or less, and on Propionibacterium acnes can reach 12.5 μg / mL or less.

[0023] 3. The heat resistance test results show that after the bacteriostatic active substance produced by fermentation of the strain C02 is treated at 80℃ and 60℃ for 40 min, it still has excellent bacteriostatic performance on Staphylococcus aureus, Candida albicans and Propionibacterium acnes, indicating that the prepared bacteriostatic active substance has high temperature resistance.

[0024] 4. The preservative test results show that after 6 hours of action, the viable bacterial counts of the bacterial group and the fungal group show a downward trend; after 7 days of action, the viable bacterial counts of each group are not higher than 90 CFU / mL; after 14 to 28 days of action, the viable bacterial counts of the bacterial group and the fungal group are both 0, indicating that the tested substance passes the test and has excellent preservative effect. It shows that the bacteriostatic active substance produced by fermentation of Aspergillus oryzae C02 can be used as a bacteriostatic and preservative raw material, and has excellent preservative performance when applied to the preparation of food, health products or daily chemical products, and has broad application prospects and important transformation research value.

[0025] Biological material preservation

[0026] A strain of Aspergillus oryzae C02, classified and named as Aspergillus oryzae, has been preserved in the Guangdong Microbial Culture Collection Center on June 4, 2025, with the preservation number GDMCC NO.66457 and the preservation address at No. 59 Building, 5th Floor, 100 Middle Field Road, Guangzhou. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 is a colony morphology diagram of Aspergillus oryzae C02;

[0028] Figure 2 is a phylogenetic tree of Aspergillus oryzae C02;

[0029] Figure 3Figure of partial antibacterial effect of antibacterial active substance of Aspergillus oryzae C02 in Example 4; wherein, S represents Staphylococcus aureus, E represents Escherichia coli, and H represents Burkholderia cepacia. DETAILED DESCRIPTION

[0030] In order to better illustrate the purposes, technical solutions and advantages of the present application, the present application will be further described below in combination with specific examples.

[0031] Other materials, reagents, etc. used in the examples can be obtained from commercial channels if not otherwise specified.

[0032] Culture medium involved in the present application:

[0033] PDA culture medium: 20 g / L glucose, 12 g / L potato infusion powder, 10 g / L yeast infusion powder, 20 g / L agar, distilled water, and natural pH.

[0034] PDB liquid culture medium: 20 g / L glucose, 12 g / L potato infusion powder, 10 g / L yeast infusion powder, distilled water, and natural pH.

[0035] Solid fermentation culture medium: PDA culture medium.

[0036] The above culture media all need to undergo a sterilization step, and the sterilization condition is 121℃ for 20 min.

[0037] Example 1: Isolation, purification and screening of strains

[0038] Soil samples were collected from the area of South China Botanical Garden in Guangzhou, Guangdong Province, China. 10 g of the collected soil sample was weighed and added with 90 mL of sterile water, and then cultured at room temperature with 150 rpm shaking for 30 min. After that, 100 μL of the dilution liquid with dilution factor of 10 -4 , 10 -5 , 10 -6 of the dilution liquid were respectively coated on PDA culture medium, and then incubated at 28℃. The single mold colonies were picked up and transferred to new PDA plates every day, and then repeatedly isolated and purified by plate streaking method to obtain purified strains and numbered and recorded. The strains were transferred to PDB liquid culture medium for liquid culture, and then the bacterial liquid was added with sterile glycerol to prepare a strain cryopreservation liquid containing 30% glycerol, which was stored in a refrigerator at -80℃.

[0039] The isolated strains of mold were subjected to antibacterial activity screening. The specific steps were as follows: each mold strain was cultured in PDB liquid culture at 28°C and 200 rpm for overnight, then 1% of the inoculum was uniformly coated on a PDA plate, and the plate was cultured at 28°C for 5 days. After fermentation, the obtained product was collected, crushed, and then extracted with an equal amount of ethyl acetate twice. Each time, the extraction was allowed to stand for 2 h before being filtered. The ethyl acetate extract was concentrated to completely remove the solvent, and then a 10 mg / ml sample was prepared using a methanol solution. The sample was filtered using a 0.2 μm filter membrane to remove bacteria, and a test solution was obtained. The test solution was subjected to agar diffusion antibacterial experiment to determine the antibacterial activity against Escherichia coli and Staphylococcus aureus, which are two common opportunistic pathogens. The preliminary screening experiment showed that mold C02 had obvious antibacterial activity against Escherichia coli and Staphylococcus aureus. Therefore, the strain was subjected to strain identification and subsequent verification experiment.

[0040] Example 2: Strain identification

[0041] Morphological characteristics: after the strain C02 was cultured in PDA medium at 28°C for 3 days, the colony was yellow-green and oval-shaped, the reverse side was light yellow, and the texture was velvety (as shown in Figure 1 ).

[0042] Molecular biology method identification: 18S rRNA identification was performed on the strain. The genomic DNA of the strain C02 was extracted according to the operation instruction of the fungal genomic DNA extraction kit, and used as a template for PCR amplification of 18S rRNA using universal primers (NS1: 5'-GTAGTCATATGCTTGTCTC-3'(SEQ ID.NO 2), FUNG: 5'-ATTCCCCGTTACCCGTTG-3'(SEQ ID NO.3)). The sequencing was performed by Huada Gene Company, and the sequence information (SEQ ID NO.1) obtained by sequencing was subjected to sequence alignment and homology analysis in the NCBI database, and a phylogenetic tree was constructed using MEGA 12 software. The phylogenetic tree is shown in Figure 2 . Aspergillus oryzae The results showed that the strain C02 was clustered in the same branch as Aspergillus oryzae, and the sequence homology was 98.00%. In combination with the morphological characteristics, the strain C02 was determined to be Aspergillus oryzae, and was named Aspergillus oryzae .

[0043] The 18S rRNA sequence of the strain is shown in SEQ ID NO.1:

[0044] CCTATTCCCCGTGTTACGTTGCCACCATGGTAGGCCACTATCCTACCATCGAAAGTTGATAGGGCAGAAATTTGAATGAACCATCGCCGGCGCAAGGCCATGCGATTCGTTAAGTTATTATGAATCACCAAGGAGCCCCGAAGGGCATTGGTTTTTTATCTAATAAATACACCCCTTCCGAAGTCGAGGTTTTTAGCATGTATTAGCTCTAGAATTACCACAGGTATCCATGTAGTAAGGTACTATCAAATAAACGATAACTGATTTAATGAGCCATTCGCAGTTTCACAGTATAAAGTGCTTATACTTAGACATGCATGGCTTAATCTTTGAGACAATTATGTAACTACATG.

[0045] Preparation of bacteriostatic active substance

[0046] The preparation method of the bacteriostatic active substance ① specifically comprises the following steps:

[0047] S1, seed liquid culture: the frozen strain C02 is activated, and after activation, a culture medium block with a colony area of 1 cm 2 is taken into 200 mL PDB liquid culture medium, and cultured at 28°C and 200 rpm for 16 h to obtain a seed liquid;

[0048] S2, solid fermentation: 5% (volume / mass ratio) of the seed liquid is uniformly coated on the solid fermentation medium, and the solid fermentation medium is fermented at 28°C in the dark for 5 days;

[0049] S3, after the fermentation is completed, the solid fermentation medium covered with mycelium is crushed, and an equal volume of ethyl acetate is added, and ultrasonic-assisted extraction is performed at an ultrasonic power of 400 w for 40 min. After ultrasonic-assisted extraction, the extraction liquid and the solid part are obtained by suction filtration after soaking extraction at room temperature for 2 h. The solid part is added with an equal volume of ethyl acetate at room temperature, and static extraction is performed for 2 h, and suction filtration is performed, and the step is repeated for 3 times. The extraction liquids obtained after all the extractions are combined;

[0050] S4, the combined extraction liquid is concentrated to completely remove the solvent to obtain the bacteriostatic active substance.

[0051] Bacteriostatic active substance ②: The difference compared with the preparation steps of bacteriostatic active substance ① is only that the Aspergillus oryzae JAAS-32 with the preservation number of GDMCC No. 63725 (donated by Jiangsu Academy of Agricultural Sciences) is used instead of Aspergillus oryzae C02 in the present application to prepare the bacteriostatic active substance through seed liquid culture, solid fermentation and other steps, and other steps and parameters are consistent with bacteriostatic active substance ①.

[0052] Example 4 Bacteriostatic test

[0053] Test substance: The bacteriostatic active substance ① and bacteriostatic active substance ② prepared in Example 3 are respectively dissolved in methanol to a concentration of 10 mg / mL, filtered with a 0.2 μm filter membrane to remove bacteria, and then obtained as a test solution for bacteriostatic experiment;

[0054] Indicator bacteria: Pseudomonas putida, Escherichia coli, Staphylococcus aureus, Burkholderia cepacia, Candida albicans and Propionibacterium acnes are selected; Pseudomonas putida, Escherichia coli, Staphylococcus aureus, Burkholderia cepacia, Candida albicans and Propionibacterium acnes are respectively inoculated in their suitable culture medium for activation and culture to obtain logarithmic expectation bacteria suspension;

[0055] The specific steps of the bacteriostatic test are as follows:

[0056] The test adopts double-layer agar diffusion method, 10 mL of sterilized 1% water agar culture medium is poured into a sterile plate, and then the Oxford cup is placed after it is solidified; 200 μL of indicator bacteria solution is added into 20 mL of nutrient agar culture medium at about 50°C, and mixed, wherein the final concentration of the indicator bacteria is 4 x 10 7 CFU / mL, and the mixed nutrient agar culture medium containing the indicator bacteria is poured into a sterile plate; after the nutrient agar culture medium is completely solidified, the Oxford cup is taken out, 100 μL of test substance is added in the sample hole, and an equal amount of methanol is used instead of the test substance in the blank control group; Pseudomonas putida, Escherichia coli, Staphylococcus aureus and Burkholderia cepacia are placed in a 36°C static incubator for 24 h, Propionibacterium acnes is placed in a 36°C anaerobic incubator for 24 h, Candida albicans is placed in a 28°C static incubator for 72 h, and the diameter of the bacteriostatic ring is measured; 3 parallel experiments are set for each indicator bacteria, and 3 directions are measured for each bacteriostatic ring, and the data is presented as an average value.

[0057] The test results are as follows: Figure 3The diameters of the bacteriostatic circle of the active substance ① against Pseudomonas putida, Escherichia coli, Staphylococcus aureus, Burkholderia cepacia, Candida albicans and Propionibacterium acnes are 18.90 mm, 19.54 mm, 20.13 mm, 15.06 mm, 20.78 mm and 23.57 mm respectively, as shown in the table 1 and the experimental results in the figure, which indicates that the active substance prepared by the fermentation of Aspergillus oryzae C02 has good bacteriostatic effect.

[0058] It can be known from the bacteriostatic effect of the active substance ① and the active substance ② against Pseudomonas putida, Escherichia coli, Staphylococcus aureus, Burkholderia cepacia, Candida albicans and Propionibacterium acnes in the table 1 that not all Aspergillus oryzae with bacteriostatic function has the bacteriostatic effect on the above-mentioned six kinds of bacteria, and the Aspergillus oryzae C02 separated and obtained in the application can ferment to produce the active substance with broad-spectrum bacteriostatic performance.

[0059] Table 1 Bacteriostatic test data

[0060]

[0061] Note: unit (mm), "-" represents no obvious bacteriostatic activity.

[0062] Example 5 Minimum bacteriostatic concentration (MIC) detection

[0063] Indicating bacteria: the logarithmic phase of Pseudomonas putida, Escherichia coli, Staphylococcus aureus, Burkholderia cepacia, Candida albicans and Propionibacterium acnes are selected; the indicating bacteria are respectively diluted to 1×10 7 CFU / mL concentration for use;

[0064] Test substance: the active substance ① prepared in the example 3 is first configured to a solution with a concentration of 25 mg / mL by using DMSO, then filtered and sterilized by using a 0.2 μm filter membrane, and then diluted to the test solution with a concentration of 250, 200, 100, 50, 25, 12.5 μg / mL by using nutrient broth medium for minimum bacteriostatic concentration (MIC) detection;

[0065] Experimental group: 100 μL of test substances with concentrations of 250, 200, 100, 50, 25, and 12.5 μg / mL, respectively, were added to the first to seventh rows of a 96-well plate, and 100 μL of the indicator bacteria was added to each well, which was then mixed gently; blank control group: DMSO was added to each well of the eighth row of the 96-well plate according to the amount of DMSO in each concentration of the test substance, and the nutrient broth medium was added to make up to 100 μL, and then 100 μL of the indicator bacteria was added and mixed gently; three parallel holes were set for each indicator bacteria in each group; Pseudomonas putida, Escherichia coli, Staphylococcus aureus, Burkholderia cepacia, and Candida albicans were cultured in a 30°C, 120 rpm shaker for 36 h, and Propionibacterium acnes was cultured in an anaerobic bag in a 30°C, 120 rpm shaker for 36 h, and whether each well was turbid was observed, and the results were recorded, and the data were presented as the average value;

[0066] From the minimum inhibitory concentration (MIC) data in Table 2, it can be seen that the minimum inhibitory concentration (MIC) of the antibacterial active substance prepared by fermenting Aspergillus oryzae C02 isolated from soil on Staphylococcus aureus and Candida albicans is less than 25 μg / mL, the minimum inhibitory concentration (MIC) on Pseudomonas putida and Escherichia coli is less than 50 μg / mL, the minimum inhibitory concentration (MIC) on Burkholderia cepacia is less than 100 μg / mL, and the minimum inhibitory concentration (MIC) on Propionibacterium acnes can reach less than 12.5 μg / mL, indicating that the fermentation product of strain C02 has excellent antibacterial performance on the above indicator bacteria.

[0067] Table 2 Minimum inhibitory concentration (MIC) data

[0068]

[0069] Note: "+" means turbidity, that is, the growth of the indicator bacteria cannot be inhibited, and "-" means clear, that is, the growth of the indicator bacteria can be inhibited.

[0070] Example 6 Heat resistance test

[0071] Test substance: The antibacterial active substance ① prepared in Example 3 was dissolved in methanol to a concentration of 10 mg / mL, filtered with a 0.2 μm filter to remove bacteria, and the resulting solution was used for the heat resistance test;

[0072] The foregoing test substances were treated at 80°C and 60°C, respectively, for 40 min, then cooled to room temperature, and the antibacterial test was performed according to the method of Example 4; the control group used an equal amount of methanol instead of the test substance, and each group had three parallel experiments, and the data were presented as the average value;

[0073] Indicator bacteria: logarithmic phase expected test bacterial suspensions of Staphylococcus aureus, Candida albicans, and Propionibacterium acnes were selected;

[0074] The experimental results show that: after the bacteriostatic active substance ① is treated at 80℃ and 60℃ for 40 minutes respectively, the bacteriostatic test is carried out by the bacteriostatic test procedure described in Example 4, the experimental results show that: the bacteriostatic active substance ① after the above two treatment methods has almost the same bacteriostatic circle diameter as the data in Table 1 of Example 4 on Staphylococcus aureus, Candida albicans and Propionibacterium acnes, the bacteriostatic circle diameters of Staphylococcus aureus are 19.85mm and 19.93mm respectively, the bacteriostatic circle diameters of Candida albicans are 19.86mm and 20.37mm respectively, the bacteriostatic circle diameters of Propionibacterium acnes are 23.05mm and 23.32mm respectively, which shows that the bacteriostatic active substance produced by Aspergillus oryzae C02 fermentation still has excellent bacteriostatic performance after high temperature treatment, and it has the characteristics of high temperature resistance.

[0075] Example 7 Preservative Test

[0076] Test substance: the bacteriostatic active substance ① prepared in Example 3 is dissolved in 1,3-butanediol to a mass fraction of 5%, then filtered with a 0.2μm filter membrane to remove bacteria to obtain a test solution;

[0077] The test substance is added as a natural preservative to cosmetics, and the preservative test is carried out according to the well-known Cosmetic, Toiletry and Fragrance Association (CTFA) and the microbial challenge test method of the United States Pharmacopoeia, and the specific test procedure is as follows:

[0078] First, a certain amount of preservative-free mask liquid is prepared according to the basic formula, and divided into two groups, five portions in each group, and the test substance is added to each group to make the mass fraction of bacteriostatic active substance ① in the mask liquid finally 0.05%; the test bacteria in logarithmic growth phase, Pseudomonas putida, Escherichia coli, Staphylococcus aureus, Burkholderia cepacia and Candida albicans are respectively diluted to 4×10 9 CFU / mL with PBS buffer solution, and then mixed with the bacteria solution, so that the final concentration of bacteria in the mask liquid is 4×10 7 CFU / mL, and the final concentration of fungi in the mask liquid is 4×10 6 CFU / mL, respectively, and then mixed evenly, the bacterial group is placed in a 36℃ incubator for culture, and the fungal group is placed in a 28℃ incubator for culture; according to the colony count test method in Chapter 5 of the Microbiological Test Method in the Cosmetic Safety Technical Specification 2015 edition, the viable bacteria count is determined at 6h, 7d, 14d and 28d after inoculation to judge the preservative efficiency of the cosmetic; the judgment standard is: when each sample is inoculated, the number of surviving bacteria is reduced to not more than 0.1% of the initial concentration at 7d, and then gradually reduced, and no bacteria grow at 28d; then the preservative is effective and passes the test; otherwise, the preservative is ineffective and fails the test.

[0079] The results of the preservative test are shown in Table 3 (data are presented as average values). The number of viable bacteria in the bacteria group and the number of viable fungi in the fungi group showed a downward trend at 6 h of action; the number of viable bacteria in each group was not higher than 90 CFU / mL at 7 days of action; the number of viable bacteria in the bacteria group and the number of viable fungi in the fungi group were both 0 at 14 to 28 days of action, indicating that the tested substance passed the test and had excellent preservative effect. It is shown that the bacteriostatic active substance produced by Aspergillus oryzae C02 fermentation can be used as a bacteriostatic preservative raw material, and has excellent preservative performance when applied to the preparation of food, health products or daily chemical products, and has a broad application prospect and important transformation research value.

[0080] Table 3 Preservative test data

[0081] Group 6h 7d 14d 28d Bacterial viable cell count (CFU / mL) 6.34 x 10 5 ]]> 56 0 0 Fungal viable cell count (CFU / mL) 4.13 x 10 5 ]]> 84 0 0

[0082] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present application and not to limit the scope of protection of the present application. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present application.

Claims

1. A strain of Aspergillus oryzae C02, characterized in that, The preservation number is GDMCC NO.66457.

2. Use of Aspergillus oryzae C02 according to claim 1 for the preparation of a bacteriostatic active substance, characterized in that, The bacteriostatic active substance has bacteriostatic effect on Pseudomonas putida, Escherichia coli, Staphylococcus aureus, Burkholderia cepacia, Candida albicans and Propionibacterium acnes.

3. A method for producing a bacteriostatic active substance by fermentation of Aspergillus oryzae C02 according to claim 1, characterized by, The method comprises the following steps: S1, seed liquid culture: the frozen Aspergillus oryzae C02 in claim 1 is activated, and after activation, a culture medium block containing colonies is picked and added to PDB liquid culture medium for culture to obtain a seed liquid; S2, solid state fermentation: the seed liquid is uniformly coated on a solid state fermentation medium for light-avoiding fermentation; S3, after the fermentation is completed, the solid state fermentation medium covered with mycelium is crushed, equal volume of ethyl acetate is added for ultrasonic-assisted extraction, and after extraction at room temperature, the extraction liquid and solid part are obtained by suction filtration; S4, the extraction liquid is collected for concentration treatment to obtain the bacteriostatic active substance.

4. The method of claim 3, wherein, In the step S1, the culture temperature is 25-30 DEG C, the culture rotation speed is 180-220 rpm, and the culture time is 12-18 h.

5. The method of claim 3, wherein, In the step S2, the fermentation temperature is 25-30 DEG C, and the fermentation time is 4-6 days.

6. The method of claim 3, wherein, In the step S3, the ultrasonic power is 200-600 w, the ultrasonic time is 15-50 min, and the extraction time at room temperature is 1-3 h.

7. The method of claim 3, wherein, In the step S3, the solid part is added with equal volume of ethyl acetate for extraction at room temperature for 1-3 h, and after suction filtration, the extraction liquid is combined after repeated extraction for 2-3 times.

8. The method of claim 3, wherein, In the step S4, the extraction liquid is concentrated to completely remove the solvent.

9. Use of the bacteriostatic active substance prepared by the method in any one of claims 3-8 in the preparation of daily-use products.

Images