Seawater source bacillus velezensis PQ-1 and application thereof
The microbial preparation prepared by seawater-derived Bacillus Velez PQ-1 solves the problem of frequent diseases in the aquaculture industry, achieves broad-spectrum antibacterial and growth-promoting effects, is suitable for different salinity and acid-base environments, and reduces the risk of drug resistance.
Patent Information
- Application Number
- CN202510728312.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-02
- Publication Date
- 2025-10-03
AI Technical Summary
In the existing technology, diseases occur frequently in the aquaculture industry, the use of antibiotics or chemical drugs leads to increased drug resistance, and there is a lack of effective green immune regulators to prevent diseases and promote growth, which affects the sustainable development of the aquaculture industry.
The seawater-derived Bacillus Velez PQ-1 has a broad-spectrum antibacterial effect and salt-alkali resistance, and is used to prepare microbial preparations for the prevention and control of marine organisms and livestock and poultry diseases.
It effectively inhibits common pathogens and is widely applicable to different salinity and acid-base environments. It improves the immunity and growth performance of marine organisms and livestock and poultry, and reduces the risk of drug resistance.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of microbial application, and particularly relates to seawater-derived Bacillus Velez PQ-1 and application thereof. Background Art
[0002] The growing demand for animal protein has fueled the rapid development of aquaculture. Since the 1990s, my country's aquaculture industry has experienced rapid growth. However, the continuous expansion of aquaculture scale, the deterioration of the aquaculture environment, and inadequate aquaculture management have led to the frequent occurrence of various diseases in aquacultured animals. In recent years, the incidence of these diseases has been increasing year by year, with widespread, prolonged outbreaks, severe symptoms, and high mortality rates, resulting in direct economic losses exceeding hundreds of billions of yuan. Diseases have become a major bottleneck hindering the sustainable and healthy development of the aquaculture industry. In practice, most aquaculture practitioners rely on antibiotics or chemical drugs as the primary means of controlling aquatic animal diseases. However, their widespread use has also led to a series of problems, such as a sharp decline in the quality and safety of aquatic products and the aquaculture environment due to their overuse, as well as the emergence of drug-resistant strains, which seriously impact the sustainable and healthy development of the aquaculture industry. Against the backdrop of the "antibiotic reduction" and "antibiotic replacement" initiatives, the development of green, healthy veterinary (fishery) drugs and immunomodulators with equal or even superior disease prevention efficacy is crucial.
[0003] The use of microbial agents for pest control is an important alternative to antibiotics. Compared to chemical agents, the use of pathogenic microorganisms for pest control is safe for humans and aquaculture, does not pollute the environment, does not cause pests to develop drug resistance, and is simple to use, cost-effective, and easy to promote and apply. Bacillus is a type of spore-forming rod with a wide variety of species and distribution, found in soil, water, air, and the intestinal tract of animals. Bacillus can produce antimicrobial substances through assimilation, inhibiting the growth of harmful pathogens or directly killing them (Rengpipat et al. 2000). Due to its strong resistance to stress, rapid reproduction rate, and simple nutritional requirements, Bacillus has been widely studied and utilized in biological pest control. In the aquaculture industry, Bacillus species are widely used as water quality conditioners, feed additives, and microbial control agents. They are pollution-free, residue-free, promote animal growth, and enhance immunity. They effectively improve the growth, survival, and health of aquatic animals and prevent bacterial diseases (Rengpipat, Rukpratanporn, Piyatitivorakul, & Menasaveta 2000; Irianto & Austin 2002; Sharifuzzaman & Austin, 2009). They are a new product developed in recent years. Bacillus species are also widely used as probiotics to improve the survival, growth, and development of marine organisms in aquaculture (Skjermo & Vadstein 1999; ApunMolina, Miranda, Gonzalez, Martinez-Diaz, & RojasContreras, 2009). For example, Dalian University of Technology used a compound preparation containing Bacillus subtilis YB-1 and Bacillus cereus YB-2 to feed Japanese sea cucumbers and found that after 32 days of feeding, the growth performance of sea cucumbers was significantly better than that of the control group without Bacillus. 10 CFU / g of mixed Bacillus can significantly improve the phagocytic ability of sea cucumber coelomocytes, regulate the structure of its intestinal flora, and stimulate the innate immune system, thereby promoting the health of sea cucumbers and enhancing their disease resistance. 3 CFU / mL and 1×10 6Sea cucumbers were immersed in Bacillus mobilis DY-6 at a low CFU / mL, and the results showed that DY-6 significantly promoted sea cucumber growth and increased the activity of nonspecific immune enzymes. Researchers at the Ocean University of China used a Bacillus mobilis 10 strain isolated from coastal soil as a test subject. The strain was sprayed into sea cucumber aquaculture ponds. The results showed that the Bacillus mobilis 10 strain has potential for production applications in water purification for sea cucumber aquaculture, and that the strain can be enriched in sea cucumbers (Tang Wei et al., 2023). To date, most Bacillus spores have been studied from soil (Tang Wei et al., 2023), aquaculture sediments (Yan Fajun et al., 2013; Jiang Bing et al., 2017), and the intestinal tract of sea cucumbers (Zhao Xinyan et al., 2025). Studies on Bacillus mobilis 10 from seawater are limited, and research remains limited, with the strain's functionality still being explored. Summary of the Invention
[0004] The purpose of the present invention is to provide a seawater-derived Bacillus Velezii PQ-1 and application thereof.
[0005] To achieve the above object, the present invention adopts the following technical solutions: The present invention first provides a strain of Bacillus velezensis PQ-1, which is classified and named Bacillus velezensis PQ-1. It was deposited in the China Center for Type Culture Collection on April 24, 2023, with a preservation address of No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and a preservation number of CCTCC NO: M 2023601.
[0006] Furthermore, the Bacillus Velez PQ-1 has an inhibitory effect on livestock and poultry pathogens and marine biological pathogens.
[0007] Furthermore, the livestock and poultry pathogens include Enterococcus faecalis, Micrococcus luteus and Salmonella typhimurium; the marine biological pathogens include Vibrio harveyi, Vibrio anguillarum, Aeromonas hydrophila from marine fish, Aeromonas hydrophila from freshwater fish and Pseudomonas aeruginosa.
[0008] Furthermore, the salt tolerance range of the Bacillus Velez is 0.5‰~30‰.
[0009] Furthermore, the pH suitable for the growth of the Bacillus Velez subtilis is 6-8.
[0010] The present invention also provides a microbial preparation, which comprises the above-mentioned Bacillus Velezii PQ-1.
[0011] The present invention also provides the use of the above-mentioned Bacillus Velez PQ-1 or the above-mentioned microbial preparation in preventing and treating diseases of marine organisms and livestock and poultry.
[0012] Compared with the prior art, the present invention has the following advantages: The Bacillus Velezii PQ-1 of the present invention has a broad spectrum of inhibitory pathogens, can effectively inhibit common livestock and poultry and marine biological pathogens, has good tolerance to salinity and acidity and alkalinity, and has a wide range of applications. BRIEF DESCRIPTION OF THE DRAWINGS
[0013] Figure 1 This is the colony morphology of Bacillus velezensis PQ-1.
[0014] Figure 2 This is a perspective electron micrograph of Bacillus velezensis PQ-1.
[0015] Figure 3 This is the evolutionary tree of Bacillus velezensis PQ-1.
[0016] Figure 4 This figure shows the antibacterial effect of Bacillus velezensis PQ-1 fermentation supernatant on different pathogenic bacteria.
[0017] Figure 5 This is the tolerance result of Bacillus velezensis PQ-1 to different salinities.
[0018] Figure 6 This is the tolerance result of Bacillus velezensis PQ-1 to different pH values.
[0019] Figure 7 This is the inhibitory effect of the supernatant of Bacillus velezensis on different marine pathogens, where 1-9 are Escherichia coli, freshwater-derived Aeromonas hydrophila, Enterococcus faecalis, Hepatic atrophy, Vibrio harveyi, Vibrio anguillarum, seawater-derived Aeromonas hydrophila, Salmonella typhimurium, and Micrococcus luteus. DETAILED DESCRIPTION
[0020] In order to make the contents of the present invention easier to understand, the technical solutions of the present invention are further described below in conjunction with specific implementation methods, but the present invention is not limited thereto.
[0021] Example 1 Isolation and Screening of Bacillus velezensis PQ-1 Bacillus velezensis PQ-1 was isolated from seawater samples in Ningde, Fujian. The collected seawater samples were evenly spread on TSA solid culture medium plates (15 g / L tryptone, 5 g / L soy peptone, 5 g / L sodium chloride, 15 g / L agar) and incubated in a 28°C incubator for 24 hours. Based on the morphology, color, and other characteristics of the colonies, single colonies were picked and streaked onto TSA culture medium until the morphology and color of the colonies in one culture medium were basically consistent, completing the isolation and purification of the strain. The strain was inoculated onto TSA agar medium (15.0 g tryptone; 5.0 g soy papain hydrolysate; 5.0 g sodium chloride; 15.0 g agar; pH 7.3±0.2, diluted to 1 L with aged seawater). After incubation at 28°C for 24 hours, the colonies were milky white, opaque, and round with a smooth surface and no wrinkles or protrusions. Figure 1 ) The bacteria are rod-shaped, arranged singly or in pairs, and the spores are nearly round ( Figure 2 ), and the strain was named PQ-1.
[0022] Example 2 Identification of Bacillus velezensis PQ-1 The 16S rDNA sequence of PQ-1 was amplified using universal 16S rDNA primers 27F and 1492R (27F: AGAGTTTGATCCTGGCTCAT; 1492R: ACGGCTACCTTGTTACGACTT). PCR reactions were performed using PQ-1 genomic DNA as the template. Reaction conditions were: denaturation at 94°C for 1 min; annealing at 55°C for 1 min; and extension at 72°C for 1.5 min, for 30 cycles. The amplified sequence was sequenced by a sequencing company to obtain the 16S rDNA sequence of the strain (SEQ ID No. 1). This sequence was then compared with the nucleotide database in GenBank at the National Center for Biotechnology Information (http: / / ncbi.nlm.nih.gov / blast). The results showed that the 16S rDNA sequence of strain W0101 shared 100% similarity with strains including Bacillus amyloliquefaciens (CP054415), Bacillus amyloliquefaciens (MT516332), and Bacillus VELEZENSIS (MT459821). To further confirm its species, genomic DNA from strain PQ-1 was sent to Shanghai Lingen Biotechnology for genome sequencing. The complete genome sequence was obtained and uploaded to the Genbank database (Genbank accession number: SAMN34233684). The complete genome sequence was aligned in the GenBank database, and a phylogenetic tree was constructed using MEGA X software to analyze species homology, further confirming that strain PQ-1 was Bacillus velezensis ( Figure 3 ).
[0023] Example 3 Antibacterial Experiment of Bacillus velezensis PQ-1 Fermentation Supernatant against Different Pathogenic Bacteria A single colony of Bacillus velezensis PQ-1 was inoculated into TSB medium (tryptone (17 g / L), soy peptone (3 g / L), sodium chloride (5 g / L), potassium dihydrogen phosphate (2.5 g / L), glucose (2.5 g / L), pH 7.3 ± 0.2). The culture was shaken at 28°C for 24 h, and the supernatant was aspirated. The supernatant sample was centrifuged at 4000 rpm for 10 min at 4°C, and the supernatant was collected and filtered through a 0.22 μm filter to obtain the fermentation supernatant. The components of the culture medium used are as follows: TSA solid medium: tryptone (15 g / L), soy peptone (5 g / L), sodium chloride (5 g / L), agar (15 g / L).
[0024] LB solid medium: tryptone (10 g / L), yeast extract powder (5 g / L), sodium chloride (10 g / L), agar (15 g / L).
[0025] The prepared culture medium was sterilized by autoclaving at 121°C for 20 min. When the culture medium cooled to about 50°C, the Escherichia coli and Salmonella typhimurium to be tested were added to the LB solid culture medium (OD 600 =1), Aeromonas hydrophila, Enterococcus Faecium, Vibrio harveyi from freshwater, Aeromonas hydrophila, Micrococcus Luteus, Pseudomonas aeruginosa, Streptococcus agalactiae, Pseudomonas plecoglossicida, Vibrio parahaemolyticus, Staphylococcus aureus, Vibrio alginolyticus, and Vibrio anguillarum from seawater were added to TSA medium (OD = 1). 600 =1), shake to mix and pour into a 90 mm culture dish. Wait for the culture medium to cool and solidify for about 15 minutes. Use a punch to punch holes in the solidified solid culture medium, add 100 μL to each well, filter with a 0.22 μm filter membrane, and calculate the OD 600 = 1, dried in a clean bench, and then cultured in a 28°C incubator. The size of the inhibition zone was measured and recorded after 24, 48, and 72 hours of culture.
[0026] The results are as follows Figure 4 and Figure 7As shown in the antibacterial experiment, the fermentation supernatant of Bacillus velezensis PQ-1 had an antibacterial effect on Pseudomonas aeruginosa (inhibition zone diameter of 27.33±2.83mm), Vibrio anguillarum (27.00±4.24mm), Streptococcus agalactiae (inhibition zone diameter of 20.67±2.83mm), Enterococcus faecalis (inhibition zone diameter of 19.67±1.41mm), Salmonella typhimurium (inhibition zone diameter of 19.33±2.83mm), Aeromonas hydrophila ( The results showed that the seawater-derived Bacillus Velezii PQ-1 exhibited strong inhibitory activity against Vibrio harveyi (inhibition zone diameter of 17.00±2.45mm), Escherichia coli (inhibition zone diameter of 15.67±1.41mm), and freshwater Aeromonas hydrophila (inhibition zone diameter of 15.67±1.41mm), while weakly inhibiting Micrococcus luteus (inhibition zone diameter of 14.00±2.45mm). The results showed that the seawater-derived Bacillus Velezii PQ-1 had significant inhibitory activity against the aforementioned marine pathogens, demonstrating its broad antimicrobial spectrum. The sustained antibacterial effect lasted for 72 hours, indicating that Bacillus Velezii PQ-1 can maintain its effectiveness for a long time in aquatic environments or within marine organisms.
[0027] Prepare TSB medium (17 g / L tryptone, 3 g / L soy peptone, 5 g / L sodium chloride, 2.5 g / L potassium hydrogen phosphate, 2.5 g / L glucose) and add sodium chloride to measure the salinity using a salinity meter. Set up different salinity gradients and culture the strain at a ratio of 1:100 under these conditions. Then use a spectrophotometer to measure the OD of the strain at different growth times. 600 The optimal salinity range and salinity tolerance limit of the strain were determined by the value of 0.5‰ salinity environment. When the salinity was 5‰, there was no significant difference. When the salinity was 15‰, the strain OD 600 The average value was 1.62. When the salinity was 30‰, the strain OD 600 The mean value is 1.50, indicating that the strain can adapt to the gradient change of salinity from 0.5‰ (freshwater environment) to 30‰ (high-salinity seawater environment), indicating that it has a strong ability to adapt to salinity (euryhaline) and can colonize in different water environments ( Figure 5 ).
[0028] The Bacillus velezensis PQ-1 provided by the present invention is tolerant to low pH. Dilute hydrochloric acid and sodium hydroxide are used to adjust the pH environment in TSB medium. After measuring with a pH meter, the strain is expanded at a ratio of 1:100 under different pH culture conditions. The OD of the strain at different growth times is measured using a spectrophotometer. 600The results at pH values of 5.0, 6.0, 7.0, and 8.0 are as follows: Using a pH environment of 7.0 as the standard control, the OD of the bacterial solution grown 14 hours later was measured using a spectrophotometer. 600 There was no significant difference in OD when the pH was 8.0. 600 The average value is 1.97, and the OD value is 6.0. 600 The average value is 1.72, and the OD value is 5.0. 600 The mean value is 0.69, indicating that Bacillus velezensis PQ-1 survives well in a low pH environment and can tolerate a low pH environment ( Figure 6 ).
[0029] Although the present invention has been described in detail through the above preferred embodiments, it should be understood that the above description should not be considered as limiting the present invention. After reading the above description, various modifications and substitutions of the present invention will be apparent to those skilled in the art. Therefore, the scope of protection of the present invention should be defined by the appended claims.
Claims
1. A strain of Bacillus velezinis PQ-1, characterized in that: The classification name of the Bacillus velezensis is Bacillus velezensis PQ-1, which was deposited in the China Center for Type Culture Collection on April 24, 2023. The deposit address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the deposit number is CCTCC NO: M 2023601.
2. The Bacillus Velez PQ-1 according to claim 1, characterized in that: The Velez Bacillus PQ-1 has an inhibitory effect on livestock and poultry pathogens and marine biological pathogens.
3. The Bacillus Velez PQ-1 according to claim 2, characterized in that: The livestock and poultry pathogens include Enterococcus faecalis, Micrococcus luteus and Salmonella typhimurium; the marine biological pathogens include Vibrio harveyi, Vibrio anguillarum, Aeromonas hydrophila from marine fish, Aeromonas hydrophila from freshwater fish and Pseudomonas aeruginosa.
4. The Bacillus Velez PQ-1 according to claim 1, characterized in that: The salt tolerance range of the Bacillus Velez is 0.5‰~30‰.
5. The Bacillus Velez PQ-1 according to claim 1, characterized in that: The pH suitable for the growth of the Bacillus Velez is 6-8.
6. A microbial preparation, characterized in that: The microbial preparation comprises the Bacillus Velez PQ-1 according to claim 1.
7. Use of the Bacillus Velez PQ-1 according to claim 1 or the microbial preparation according to claim 6 in preventing and treating diseases of marine organisms and livestock and poultry.