Application of bacillus velezensis TCS001 in prevention and treatment of plant viruses

Abstract

The invention provides application of bacillus velezensis TCS001, and / or a lipopeptide fermentation product of the bacillus velezensis TCS001, and / or a fermentation liquid of the bacillus velezensis TCS001, and / or a bacterial suspension of the bacillus velezensis TCS001, and / or a fermentation filtrate of the bacillus velezensis TCS001 in biological prevention and treatment of tomato yellow leaf curl virus and tobacco mosaic virus. The preservation number of the bacillus velezensis TCS001 is CGMCC (China General Microbiological Culture Collection Center) No.8921. The invention also provides an application of the plant growth regulator in promoting crop traits, wherein the traits comprise one or more of plant height, leaf surface area, chlorophyll content, root length, root dry weight and root fresh weight.

Description

Technical Field

[0001] The present invention relates to the field of plant virus prevention and control, and relates to the application of lipopeptide fermentation products, a fermentation metabolite of Bacillus velez TSC001 and its fermentation metabolite after optimized fermentation conditions, in directly preventing and controlling tomato yellow leaf curl virus and tobacco mosaic virus disease. The present invention also relates to the application of lipopeptide fermentation products, a fermentation metabolite of Bacillus velez TSC001 and its fermentation metabolite after optimized fermentation conditions, in inducing plant autoimmunity to prevent and control tomato yellow leaf curl virus disease and tobacco mosaic virus disease. Background Art

[0002] Plant viral diseases are called "plant cancer". They are highly hidden, spread rapidly, and are highly destructive, posing a huge threat to agricultural production and food security.

[0003] The Tomato yellow leaf curl virus (TYLCV) genome consists of a single-stranded circular DNA containing an intergenic region (IR) and six known open reading frames (ORFs). TYLCV infects plants such as tomatoes, tobacco, and peppers. It is efficiently transmitted by the whitefly (Bemisia tabaci), making it extremely difficult to control. The viral disease caused by TYLCV causes symptoms such as yellowing and curling of leaves, stunted growth, and fruit deformities, resulting in significant economic losses to the tomato industry and other sectors, posing a serious threat to global agricultural production.

[0004] Tobacco mosaic virus (TMV) was the first virus discovered and characterized. It is a single-stranded, positive-sense RNA virus with a full-length genome of 6,395 nucleotides, containing four open reading frames (ORFs). TMV is often spread in the field through mechanical damage. Its virion coat protein, composed of layers of helical wrappings encapsulating the nucleic acid, creates an extremely stable structure. The virions are highly infectious and have a long survival time, posing a serious threat to tobacco and other cash crops.

[0005] Tomato yellow leaf curl virus and tobacco mosaic virus exhibit high levels of infectiousness and environmental adaptability, enabling widespread distribution and rapid spread under diverse climatic conditions. Currently, traditional physical, agricultural, and chemical control methods face numerous challenges in preventing and controlling plant viral diseases, including poor effectiveness, high economic costs, and environmental unfriendliness. Therefore, the use of biological control methods to effectively control these diseases has become a hot topic with significant research and market potential.

[0006] Bacillus velezensis is a novel biocontrol bacterium. Spanish researchers Ruiz-García et al. first isolated two strains, CR-14b and CR-502T, in 2005. These strains are capable of producing large quantities of lipopeptides and exhibit strong antibacterial activity. Bacillus velezensis is widely distributed and can survive adverse conditions such as drought and salinity. However, few related products exist, suggesting promising development prospects.

[0007] After searching, it was found that patent CN201910297167.1 discloses the use of Bacillus Velez subtilis SNB55 with a preservation number of CGMCC NO.17315 in preventing and controlling tobacco mosaic virus disease and tomato yellow leaf curl virus disease; patent CN201811371200.2 discloses the use of Bacillus Velez subtilis with a preservation number of CCTCC NO.M2018004 in preventing and controlling tobacco mosaic virus and / or potato virus Y; patent CN202411403970 discloses Bacillus Velez subtilis Bv-6 with a preservation number of CCTCC No: M20191106 in preventing and controlling plant viral diseases caused by tobacco mosaic virus and turnip mosaic virus.

[0008] Bacillus velezensis TCS001 was isolated from Bohai Sea mud. The original strain was marine Bacillus sp. CT2628. After mutagenesis and stabilization, it was identified and named Bacillus velezensis TCS001. It has been deposited with the China General Microbiology Center (CGMCC) under the accession number CGMCC No. 8921 and was first published in Patent ZL201410168402.2. When grown on NA medium, individual colonies of Bacillus velezensis TCS001 are nearly round, light yellow, and opaque. Initially, the surface is smooth with neat edges, but later, the surface becomes wrinkled, with slightly irregular edges and a central bulge, which diffuses in a cloud-like pattern. Gram staining showed that Bacillus Velez TCS001 is Gram-positive and rod-shaped. It showed limited inhibitory activity against cucumber gray mold, cucumber vine blight, rapeseed sclerotinia, cucumber brown spot, cotton wilt, and banana leaf spot, with the highest inhibition rate against cucumber gray mold, reaching 87.66%. However, there are no reports on the application of Bacillus Velez TCS001 in controlling plant viruses. Summary of the Invention

[0009] The technical problem to be solved by the present invention is to study whether Bacillus Velez TCS001 has a preventive and control effect on tomato yellow leaf curl virus and tobacco mosaic virus, and to study whether Bacillus Velez TCS001 can activate the plant's own immune ability and improve the plant's resistance to viral diseases.

[0010] A technical solution provided by the present invention is the use of Bacillus Velez TCS001, and / or Bacillus Velez TCS001 lipopeptide fermentation products, and / or Bacillus Velez TCS001 fermentation broth, and / or Bacillus Velez TCS001 bacterial suspension, and / or Bacillus Velez TCS001 fermentation filtrate for biological control of tomato yellow leaf curl virus and tobacco mosaic virus. The Bacillus Velez TCS001 is deposited with CGMCC No. 8921.

[0011] Another technical solution provided by the present invention is the use of Bacillus Velez TCS001, and / or Bacillus Velez TCS001 lipopeptide fermentation products, and / or Bacillus Velez TCS001 fermentation broth, and / or Bacillus Velez TCS001 bacterial suspension, and / or Bacillus Velez TCS001 fermentation filtrate in antagonizing tomato yellow leaf curl virus and tobacco mosaic virus. The Bacillus Velez TCS001 is deposited with CGMCC No. 8921.

[0012] Another technical solution provided by the present invention is the use of Bacillus Velez TCS001, and / or Bacillus Velez TCS001 lipopeptide fermentation products, and / or Bacillus Velez TCS001 fermentation broth, and / or Bacillus Velez TCS001 bacterial suspension, and / or Bacillus Velez TCS001 fermentation filtrate in the preparation of pesticides for preventing and controlling tomato yellow leaf curl virus and tobacco mosaic virus. The Bacillus Velez TCS001 is deposited with CGMCC No. 8921.

[0013] Another technical solution provided by the present invention is the use of Bacillus Velez TCS001, and / or Bacillus Velez TCS001 lipopeptide fermentation products, and / or Bacillus Velez TCS001 fermentation broth, and / or Bacillus Velez TCS001 bacterial suspension, and / or Bacillus Velez TCS001 fermentation filtrate to induce crops to resist tomato yellow leaf curl virus and tobacco mosaic virus. The Bacillus Velez TCS001 is deposited with CGMCC No. 8921.

[0014] Another technical solution provided by the present invention is the use of Bacillus Velez TCS001, and / or Bacillus Velez TCS001 lipopeptide fermentation products, and / or Bacillus Velez TCS001 fermentation broth, and / or Bacillus Velez TCS001 bacterial suspension, and / or Bacillus Velez TCS001 fermentation filtrate in the preparation of a drug for inducing crop resistance to tomato yellow leaf curl virus and tobacco mosaic virus. The Bacillus Velez TCS001 is deposited with CGMCC No. 8921.

[0015] Preferably, the use is to inhibit the replication of tomato yellow leaf curl virus and tobacco mosaic virus.

[0016] Preferably, the inducing crop resistance is promoting the expression of disease resistance genes.

[0017] Preferably, the disease-resistant genes are PR1a, PR1b and PDF1.2.

[0018] Another technical solution provided by the present invention is the use of Bacillus Velez TCS001, and / or Bacillus Velez TCS001 lipopeptide fermentation products, and / or Bacillus Velez TCS001 fermentation broth, and / or Bacillus Velez TCS001 bacterial suspension, and / or Bacillus Velez TCS001 fermentation filtrate in promoting crop growth morphological indicators. Preferably, the growth morphological indicators include one or more of plant height, leaf surface area, chlorophyll content, root length, root dry weight and root fresh weight.

[0019] Preferably, the crop is a Solanaceae plant; Preferably, the Solanaceae plant is Nicotiana benthamiana.

[0020] Beneficial technical effects of the present invention

[0021] The present invention discovers for the first time that Bacillus Velez TCS001, and / or Bacillus Velez TCS001 lipopeptide fermentation products, and / or Bacillus Velez TCS001 fermentation broth, and / or Bacillus Velez TCS001 bacterial suspension, and / or Bacillus Velez TCS001 fermentation filtrate have a significant inhibitory effect on the replication of Tomato Yellow Leaf Curl Virus (TYLCV, DNA virus).

[0022] The present invention discovers for the first time that Bacillus Velez TCS001, and / or Bacillus Velez TCS001 lipopeptide fermentation products, and / or Bacillus Velez TCS001 fermentation broth, and / or Bacillus Velez TCS001 bacterial suspension, and / or Bacillus Velez TCS001 fermentation filtrate have a significant inhibitory effect on the replication of tobacco mosaic virus (TMV, RNA virus).

[0023] The present invention discovers for the first time that Bacillus Velez TCS001, and / or Bacillus Velez TCS001 lipopeptide fermentation products, and / or Bacillus Velez TCS001 fermentation broth, and / or Bacillus Velez TCS001 bacterial suspension, and / or Bacillus Velez TCS001 fermentation filtrate can effectively induce the expression of disease-resistance-related genes in Nicotiana benthamiana to enhance its antiviral ability.

[0024] The present invention discovers for the first time that Bacillus Velez TCS001, and / or Bacillus Velez TCS001 lipopeptide fermentation products, and / or Bacillus Velez TCS001 fermentation broth, and / or Bacillus Velez TCS001 bacterial suspension, and / or Bacillus Velez TCS001 fermentation filtrate can significantly improve and enhance the growth morphological indicators of Nicotiana benthamiana.

[0025] The present invention provides use of Bacillus Velez TCS001, and / or a lipopeptide fermentation product of Bacillus Velez TCS001, and / or a fermentation broth of Bacillus Velez TCS001, and / or a bacterial suspension of Bacillus Velez TCS001, and / or a fermentation filtrate of Bacillus Velez TCS001 for inducing Nicotiana benthamiana to resist infection by tomato yellow leaf curl virus and tobacco mosaic virus. The Bacillus Velez TCS001 has a deposit number of CGMCC No. 8921, and provides a new biological agent for preventing and treating tomato yellow leaf curl virus and tobacco mosaic virus disease.

[0026] The present invention first discovered that the Bacillus Velez TCS001 suspension concentrate has an inhibitory effect on the replication of tomato yellow leaf curl virus (DNA virus), among which the effect is most significant when the Bacillus Velez TCS001 suspension concentrate is diluted 100 times.

[0027] The present invention first discovered that the Bacillus Velez TCS001 suspension concentrate can improve and enhance the growth morphological indicators of Nicotiana benthamiana, among which the effect is most significant when the Bacillus Velez TCS001 suspension concentrate is diluted 100 times.

[0028] The present invention first discovered that a 100-fold dilution of the Bacillus velezensis TCS001 suspension has an inhibitory effect on the replication of tobacco mosaic virus (RNA virus). BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0030] Figure 1:The control effect of Bacillus Velez TCS001 fermentation broth, Bacillus Velez TCS001 suspension, Bacillus Velez TCS001 fermentation filtrate, and 5% amino oligosaccharide aqueous solution (5% AO) on Tomato Yellow Leaf Curl Virus in Nicotiana benthamiana. Figure 2 :Effects of Bacillus Velez TCS001 fermentation broth, Bacillus Velez TCS001 bacterial suspension, Bacillus Velez TCS001 fermentation filtrate, and 5% amino oligosaccharide aqueous solution (5% AO) treatment on the expression of Tomato Yellow Leaf Curl Virus CP in Nicotiana benthamiana; Figure 3 Effects of Bacillus Velez TCS001 fermentation broth, Bacillus Velez TCS001 bacterial suspension, Bacillus Velez TCS001 fermentation filtrate, and 5% amino oligosaccharide aqueous solution (5% AO) on plant height, leaf surface area, and chlorophyll content of Nicotiana benthamiana. Figure 4 Effects of Bacillus Velez TCS001 fermentation broth, Bacillus Velez TCS001 bacterial suspension, Bacillus Velez TCS001 fermentation filtrate, and 5% amino oligosaccharide aqueous solution (5% AO) on root length, root dry weight, and root fresh weight of Nicotiana benthamiana. Figure 5 :The effect of Bacillus velezensis TCS001 fermentation broth on the expression of PR1a, PR1b and PDF1.2 in Nicotiana benthamiana; Figure 6 : The control effect of Bacillus Velez TCS001 suspension concentrate diluted 25, 50, 100, 200, 400 and 500 times and 5% amino oligosaccharide aqueous solution (5% AO) on tomato yellow leaf curl virus in Nicotiana benthamiana was investigated. Figure 7 :The effects of Bacillus Velez TCS001 suspension concentrate diluted 25, 50, 100, 200, 400 and 500 times and 5% amino oligosaccharide aqueous solution (5% AO) on the expression of TPLV-1 in Nicotiana benthamiana. Figure 8 : Effects of Bacillus Velez TCS001 suspension concentrate diluted 25, 50, 100, 200, 400 and 500 times and 5% amino oligosaccharide aqueous solution (5% AO) on plant height, leaf surface area and chlorophyll content of Nicotiana benthamiana. Figure 9 :The effects of Bacillus Velez TCS001 suspension concentrate diluted 25, 50, 100, 200, 400 and 500 times and 5% amino oligosaccharide aqueous solution (5% AO) on the root length, root dry weight and root fresh weight of Nicotiana benthamiana. Figure 10: The control effect of tobacco mosaic virus disease on Nicotiana benthamiana treated with 100-fold diluted suspension concentrate of Bacillus Velez TCS001; Figure 11 : Effects of Bacillus Velez TCS001 suspension concentrate diluted 100-fold on the accumulation of tobacco mosaic virus CP at the mRNA and protein levels in Nicotiana benthamiana. DETAILED DESCRIPTION

[0031] Example 1 Determination of the protective efficacy of Bacillus Velez TCS001 fermentation broth, Bacillus Velez TCS001 bacterial suspension, and Bacillus Velez TCS001 fermentation filtrate against Tomato Yellow Leaf Curl Virus.

[0032] Seeds of Nicotiana benthamiana were surface-sterilized, sown in seedling pots, transplanted within 2-3 weeks after germination, and cultured in a greenhouse (25±1°C, light / dark culture: 16 / 8 hours).

[0033] LB solid medium: yeast powder 5.0 g / L, tryptone 10.0 g / L, NaCl 10.0 g / L, agar powder 18 g / L, pH 7.0-7.2, sterilized at 121°C for 20 min.

[0034] LB liquid medium: yeast powder 5.0 g / L, tryptone 10.0 g / L, NaCl 10.0 g / L, pH 7.0-7.2, sterilized at 121°C for 20 min.

[0035] MLB medium (seed solution): 7.0 g tryptone, 2.0 g yeast powder, 2.0 g glucose, 6.0 g NaCl, 0.06 g KCl, 0.5 g MgCl2·6H2O, 1000 mL distilled water, pH 7.0-7.2.

[0036] Spore-forming fermentation medium for Bacillus velez TCS001: soluble peanut meal 28.9 g / L, glucose 30 g / L, soluble starch 30 g / L, FePO4 0.02 g / L, KCl 0.06 g / L, NaCl 6 g / L, MgCl2·6H2O 0.5 g / L, K2HPO4 3 g / L, KH2PO4 1.5 g / L, CaCO3 0.5 g / L, MnSO4 0.05 g / L, pH 7.0 (refer to the submitted invention patent: A culture medium and culture process for industrial production of Bacillus velez TCS001 fermentation broth, application number: CN202311517533.2).

[0037] Activation of Bacillus Velez TCS001 strain: Take 100 μL of Bacillus Velez TCS001 bacterial solution from the thawed glycerol tube and spread it on LB solid plate. After incubation at 28°C in the dark for 24 hours, streak the plate three times and incubate it in the dark at 28°C for 48 hours before use.

[0038] Preparation of Bacillus velezensis TCS001 seed solution: Pick 2-3 single colonies of Bacillus velezensis TCS001 with a sterile inoculating loop and transfer them to 150 / 250 mL of MLB liquid medium. Incubate in a constant temperature shaker at 27°C and 145 rpm for 16 hours to obtain the seed solution.

[0039] It is known in the art that plant fungal diseases can be tested against Bacillus Velez TCS001 to demonstrate the effectiveness of Bacillus Velez TCS001, but viruses cannot be tested against them. The effectiveness can only be seen by spraying Bacillus Velez TCS001 fermentation liquid, Bacillus Velez TCS001 bacterial suspension, or Bacillus Velez TCS001 fermentation filtrate.

[0040] Preparation of Bacillus Velez TCS001 fermentation broth: Bacillus Velez TCS001 seed liquid was inoculated at a volume fraction of 1% (volume fraction) into spore-forming fermentation medium containing 77.5 mL of liquid / 250 mL. The culture was incubated in a constant temperature shaker at 28°C and 173 rpm for 72 h to obtain the fermentation broth. The viable cell count was determined by the dilution spread plate method to be 7.0 × 10 9 CFU / mL, diluted 10-fold before use. The fermentation broth of Bacillus Velez TCS001 mainly includes the Bacillus Velez TCS001 strain and lipopeptide fermentation products.

[0041] Prepare a Bacillus Velez TCS001 bacterial suspension: Centrifuge the Bacillus Velez TCS001 fermentation broth at 4°C and 8000 rpm for 10 minutes. Discard the supernatant, retaining only the bacterial cells at the bottom. Add 0.9% saline to the centrifuge tube and vortex to resuspend the cells. This will create a Bacillus Velez TCS001 bacterial suspension and set aside. The Bacillus Velez TCS001 fermentation broth primarily contains the Bacillus Velez TCS001 strain.

[0042] Preparation of Bacillus Velez TCS001 fermentation filtrate: Centrifuge the Bacillus Velez TCS001 fermentation broth at 4°C and 8000 rpm for 10 minutes. Filter the fermentation supernatant three times through a 0.22 μm filter membrane to prepare the Bacillus Velez TCS001 fermentation filtrate, which is then set aside. The Bacillus Velez TCS001 fermentation broth primarily contains lipopeptide fermentation products of Bacillus Velez TCS001.

[0043] Preparation of Agrobacterium culture containing Tomato Yellow Leaf Curl Virus infectious clones: Activate Agrobacterium containing Tomato Yellow Leaf Curl Virus infectious clones on LB plates containing kanamycin and rifampicin resistance, culture at 28°C for 48-72 hours, select well-grown single colonies and transfer them to liquid LB medium containing kanamycin and rifampicin resistance, and culture at 28°C, 200 rpm, shaking for 12-16 hours until the bacterial concentration reaches OD 600 =0.6-10.

[0044] Transfer the Agrobacterium culture containing the Tomato Yellow Leaf Curl Virus infectious clone to an EP tube, centrifuge at 3000 rpm for 8 minutes at room temperature, discard the supernatant, and resuspend the cell pellet in infiltration buffer (1 M MgCl2, 10 mM MES, pH = 5.6, and 100 mMacetosyringone) to adjust the OD 600 =0.05, and place it in the dark at room temperature for 2-3 hours before use.

[0045] 0.1% Tween water was used as a blank control; 5% amino oligosaccharide solution diluted 300 times with 0.1% Tween water was used as a positive chemical control; the treatment groups included Bacillus Velez TCS001 fermentation broth, Bacillus Velez TCS001 bacterial suspension, and Bacillus Velez TCS001 fermentation filtrate, respectively; the control and treatment groups were sprayed once every 48 hours, using the spray induction method for a total of 3 times, with an application rate of 20 mL / pot, 6 replicates per treatment, a total of 120 mL, and tomato yellow leaf curl virus was inoculated 24 hours after the last treatment. After 18 days of culture in an artificial climate chamber (25±1℃, light / dark culture: 16 / 8 hours), the disease situation was investigated, plant symptoms were observed, and the accumulation of tomato yellow leaf curl virus CP was analyzed.

[0046] Total DNA from leaves was extracted using the TPS method. DNA concentration and purity were determined using an ultramicroplate spectrophotometer. The extracted DNA samples were used for real-time fluorescence quantitative PCR amplification of TYLCV. CPThe primers used were q-TYLCV F: CCCTCAAAGCTCTATGGCAATCGG, q-TYLCV R: CAGTGACGTCTGTGGAACCCTC. The internal control was 25S RNA, and the primers used were q-25S-rRNA-F: ATAACCGCATCAGGTCTCCA, q-25S-rRNA-R: CCGAAGTTACGGATCCATTT. The total reaction volume was 20 µL, consisting of 10 µL 2× SuperReal PreMix Plus, 2 µL DNA template, 1.2 µL each of forward and reverse primers, 50× ROX Reference Dye, and 6.4 µL ddH2O. The reaction conditions were as follows: first stage: initial denaturation at 95°C (5 minutes); second stage: denaturation at 95°C (30 seconds), annealing at 55°C (30 seconds), and extension at 72°C (45 seconds), for 35 cycles. Three biological replicates were set for each sample, and three technical replicates were set for each biological replicate. The data were collected and analyzed using Bio-RadiQ5 software. ⁻ΔΔCt Tomato yellow leaf curl virus CP The relative expression level.

[0047] Experimental results like Figure 1 As shown in the figure, plant phenotypes showed that the systemic leaves of Nicotiana benthamiana treated with the control (CK) showed yellowing and twisting, indicating severe disease. Compared with the control (CK), Nicotiana benthamiana treated with the Bacillus Velez TCS001 bacterial suspension and fermentation filtrate showed reduced symptoms. Furthermore, Nicotiana benthamiana treated with the Bacillus Velez TCS001 fermentation broth and 5% amino oligosaccharide aqueous solution (5% AO) showed improved growth, indicating that treatment with the Bacillus Velez TCS001 fermentation broth is effective in controlling Tomato Yellow Leaf Curl Virus.

[0048] The results of real-time fluorescence quantitative PCR are shown as follows ( Figure 2 ), compared with the control group (CK), the relative expression level of Tomato Yellow Leaf Curl Virus CP did not change significantly after treatment with Bacillus Velez TCS001 suspension. After treatment with Bacillus Velez TCS001 fermentation filtrate, the relative expression level of Tomato Yellow Leaf Curl Virus CP decreased slightly. After treatment with Bacillus Velez TCS001 fermentation broth and 5% amino oligosaccharide aqueous solution (5% AO), the relative expression levels of Tomato Yellow Leaf Curl Virus CP decreased by about 40%, indicating that Bacillus Velez TCS001 fermentation broth can significantly inhibit the replication of Tomato Yellow Leaf Curl Virus CP after treatment of Nicotiana benthamiana, and has a good control effect.

[0049] Example 2 Determination of the Growth Morphological Indexes of Nicotiana benthamiana Using Bacillus Velez TCS001 Fermentation Broth, Bacillus Velez TCS001 Bacterial Suspension, and Bacillus Velez TCS001 Fermentation Filtrate Nicotiana benthamiana was planted and cultured as in Example 1.

[0050] The preparation of LB solid medium, LB liquid medium, MLB medium and spore-forming fermentation medium of Bacillus velezensis TCS001 was as described in Example 1.

[0051] The activation of Bacillus velez TCS001 strain, the preparation of Bacillus velez TCS001 seed solution, the preparation of Bacillus velez TCS001 fermentation liquid, the preparation of Bacillus velez TCS001 bacterial suspension, the preparation of Bacillus velez TCS001 fermentation filtrate and the spraying on Nicotiana benthamiana are as in Example 1.

[0052] The preparation of Agrobacterium culture containing the infectious clone of Tomato Yellow Leaf Curl Virus, inoculation of Tomato Yellow Leaf Curl Virus, investigation of disease incidence and calculation of Tomato Yellow Leaf Curl Virus CP replication are as in Example 1.

[0053] The blank control was treated with 0.1% Tween water; the positive chemical control was treated with 5% amino oligosaccharide solution diluted 300 times with 0.1% Tween water; the treatment groups included Bacillus velez TCS001 fermentation broth, Bacillus velez TCS001 bacterial suspension and Bacillus velez TCS001 fermentation filtrate, and the treatment method and treatment amount were the same as in Example 1.

[0054] Determination of plant height, chlorophyll content, leaf surface area, root length, root fresh weight and dry weight: At least 10 Nicotiana benthamiana plants were selected from each group. The plant height and root length of each Nicotiana benthamiana plant were measured three times with a ruler, and the average values ​​were taken as the plant height and root length of each group; at least 10 Nicotiana benthamiana plants were selected from each group. The chlorophyll content of 6 leaves from the top to the bottom was measured using a chlorophyll meter (Top Yunnong, TYS-B E02), and the average values ​​were taken as the chlorophyll content of each group; at least 10 Nicotiana benthamiana plants were selected from each group. The surface area of ​​6 leaves from the top to the bottom was measured using an intelligent leaf area meter (Top Yunnong, YMJ-CHA3), and the average values ​​were taken as the leaf surface area of ​​each group; the underground part of the tobacco, i.e. the roots, were dried with paper towels and then weighed using an electronic balance. At least 10 Nicotiana benthamiana plants were selected from each group to measure their fresh weight; the tobacco roots were individually wrapped with newspapers and labeled, and placed in an oven at 65 The tobacco roots were dried at 400 °C for 24 hours to a constant weight. The dry weight of tobacco roots was measured. At least 10 Nicotiana benthamiana plants were selected from each group to measure their dry weight.

[0055] Experimental results like Figure 3As shown, compared with the control group (CK), the height of Nicotiana benthamiana plants sprayed with Bacillus velez TCS001 fermentation liquid, Bacillus velez TCS001 suspension and 5% amino oligosaccharide aqueous solution (5% AO) was significantly increased, but there was no significant difference among the treatment groups; compared with the control group (CK), the chlorophyll content of Nicotiana benthamiana plants sprayed with Bacillus velez TCS001 fermentation liquid, Bacillus velez TCS001 suspension, Bacillus velez TCS001 fermentation filtrate and 5% amino oligosaccharide aqueous solution (5% AO) was significantly increased, among which the chlorophyll content of Nicotiana benthamiana plants sprayed with Bacillus velez TCS001 was significantly increased. The fermentation liquid and 5% amino oligosaccharide aqueous solution (5% AO) had the most significant effect on increasing the chlorophyll content in the leaves of Nicotiana benthamiana plants. Compared with the control group (CK), the leaf area of ​​Nicotiana benthamiana plants sprayed with Bacillus Velez TCS001 fermentation liquid, Bacillus Velez TCS001 bacterial suspension, Bacillus Velez TCS001 fermentation filtrate and 5% amino oligosaccharide aqueous solution (5% AO) was significantly increased, among which the increase in the leaf surface area of ​​Nicotiana benthamiana plants sprayed with Bacillus Velez TCS001 fermentation liquid, Bacillus Velez TCS001 bacterial suspension and 5% amino oligosaccharide aqueous solution (5% AO) was the most significant.

[0056] like Figure 4 As shown, compared with the control group (CK), the roots of Nicotiana benthamiana plants sprayed with Bacillus Velez TCS001 fermentation liquid, Bacillus Velez TCS001 bacterial suspension, Bacillus Velez TCS001 fermentation filtrate and 5% amino oligosaccharide aqueous solution (5% AO) were significantly longer, among which spraying Bacillus Velez TCS001 fermentation liquid and 5% amino oligosaccharide aqueous solution (5% AO) had the most significant effect on promoting the lengthening of the roots of Nicotiana benthamiana plants. Compared with the control group (CK), the root fresh weight of Nicotiana benthamiana plants sprayed with Bacillus Velez TCS001 fermentation broth, Bacillus Velez TCS001 bacterial suspension, Bacillus Velez TCS001 fermentation filtrate and 5% amino oligosaccharide aqueous solution (5% AO) was significantly increased, among which spraying Bacillus Velez TCS001 fermentation broth and 5% amino oligosaccharide aqueous solution (5% AO) had the most significant effect on promoting the root fresh weight of Nicotiana benthamiana plants.

[0057] Compared with the control group (CK), the root dry weight of Nicotiana benthamiana plants sprayed with Bacillus Velez TCS001 fermentation broth, Bacillus Velez TCS001 bacterial suspension, Bacillus Velez TCS001 fermentation filtrate and 5% amino oligosaccharide aqueous solution (5% AO) was significantly increased, among which spraying Bacillus Velez TCS001 fermentation broth and 5% amino oligosaccharide aqueous solution (5% AO) had the most obvious effect on promoting the root dry weight of Nicotiana benthamiana plants.

[0058] Example 3 Effects of Bacillus Velez TCS001 fermentation broth treatment on the expression of resistance genes in Nicotiana benthamiana.

[0059] Nicotiana benthamiana was planted and cultivated as in Example 1.

[0060] The preparation of LB solid medium, LB liquid medium, MLB medium and spore-forming fermentation medium of Bacillus velezensis TCS001 was as described in Example 1.

[0061] The activation of Bacillus velez TCS001 strain, the preparation of Bacillus velez TCS001 seed solution, the preparation of Bacillus velez TCS001 fermentation liquid and the spraying are as in Example 1; The upper leaves of each control group and treatment group were ground into powder in liquid nitrogen, and total RNA was extracted using the TRIZOL method. After the extracted RNA passed the quality and concentration test, cDNA was synthesized according to the instructions of the Tiangen FastQuant cDNA First Strand Synthesis Kit. β-actin The primers used were β-actinF: ATGCCTATGTGGGTGACGAAG, β-actinR: TCTGTTGGCCTTAGGGTTGAG, and three pairs of specific primers were used: PR1a-F: GAGGGCAGCCGTGCA, PR1a-R: CACATTTTTCCACCATTG, PR1b-F: ACTGCAACCTCGTACATTCTC, PR1b-R: TTTCTCATCGACCCACATCTC, and PDF1.2-F: TCCATCATCACCCTTCTCTTCGC, PDF1.2-R: CCATGTTGTGCTCCTTCAAGTCG for the salicylic acid response marker gene, pathogenesis-related protein 1a gene ( pathogenesis-related protein 1a, PR1a ) and pathogenesis-related protein 1b gene ( pathogenesis- related protein1b, PR1b ), and the salicylic acid / ethylene response marker gene - plant defensin 1.2 gene ( plant defensin 1.2, PDF1.2), real-time fluorescence quantitative PCR (RT-qPCR) detection was performed. The total volume of the RT-qPCR reaction system was 20 μL, consisting of: 10 μL of 2× UltraSYBR Mixture, 1 μL of forward and reverse primers, 2 μL of cDNA, and 6 μL of ddH2O. The reaction procedure was: pre-denaturation at 95°C for 10 minutes, followed by 35 cycles, each cycle including denaturation at 95°C for 10 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 50 seconds. Three biological replicates were set for each sample, and three technical replicates were set for each biological replicate. Data were collected and analyzed using Bio-RadiQ5 software, using 2 ⁻ΔΔCt Method: Calculate the base and calculate the relative expression of the target gene.

[0062] Experimental results like Figure 5 As shown in the figure, compared to the control (CK), spraying the fermentation liquid of Bacillus velez TCS001 significantly increased the relative expression levels of the PR1a and PR1b genes in Nicotiana benthamiana by 1.8-fold and 1.9-fold, respectively. Furthermore, the relative expression level of the PDF1.2 gene increased significantly by 2.9-fold. These results indicate that the fermentation liquid of Bacillus velez TCS001 can effectively induce the expression of disease resistance-related genes in Nicotiana benthamiana, thereby enhancing the plant's disease resistance.

[0063] Example 4 The protective efficacy of Bacillus velez TCS001 suspension concentrate diluted at different times (25, 50, 100, 200, 400 and 500 times) against tomato yellow leaf curl virus was determined. Nicotiana benthamiana was planted and cultured as in Example 1.

[0064] The preparation of LB solid medium and LB liquid medium was as in Example 1.

[0065] The preparation of Bacillus velezensis TCS001 fermentation broth is as in Example 1.

[0066] Preparation of a suspension concentrate of Bacillus Velez TCS001. The optimal formulation is 40% Bacillus Velez TCS001 fermentation broth, 3% wetting and dispersing agent SXC, 3% wetting and dispersing agent UNA, 0.15% thickener xanthan gum, 0.2% preservative kasonon, 0.2% preservative sodium benzoate, and water to 100%. The specific formulation screening process refers to the patented invention: A preparation containing Bacillus Velez TCS001 (CN202311517526.2).

[0067] The preparation of Agrobacterium culture containing the infectious clone of Tomato Yellow Leaf Curl Virus, inoculation of Tomato Yellow Leaf Curl Virus, treatment methods for each treatment group, investigation of disease incidence and calculation of Tomato Yellow Leaf Curl Virus CP replication are as in Example 1.

[0068] 0.1% Tween water treatment was used as a blank control, 5% amino oligosaccharide solution was diluted 300 times with 0.1% Tween water and then sprayed as a positive chemical control, and Bacillus Velez TCS001 suspension was diluted 25 times, 50 times, 100 times, 200 times, 400 times and 500 times as the treatment group, and the treatment method and treatment amount were the same as Example 1.

[0069] like Figure 6 As shown in the figure, the systemic leaves of Nicotiana benthamiana treated with the control group (CK) showed symptoms such as yellowing and twisting, indicating severe disease. Compared with the control group (CK), the symptoms of Nicotiana benthamiana treated with 25-fold, 50-fold, 100-fold, 200-fold, 400-fold, and 500-fold dilutions of Bacillus Velez TCS001 SC alleviated the disease. Among them, Nicotiana benthamiana treated with a 100-fold dilution of Bacillus Velez TCS001 SC and 5% amino oligosaccharide aqueous solution (5% AO) showed the best growth, indicating that the 100-fold dilution of Bacillus Velez TCS001 SC is more effective in controlling tomato yellow leaf curl virus.

[0070] The results of real-time fluorescence quantitative PCR are shown as follows ( Figure 7 ), compared with the control group (CK), the relative expression of yellow leaf curl virus CP decreased after the treatment of Nicotiana benthamiana with 25-fold, 50-fold, 100-fold, 200-fold, 400-fold and 500-fold dilutions of Bacillus Velez TCS001 suspension and 5% amino oligosaccharide aqueous solution (5% AO). Among them, the relative expression of yellow leaf curl virus CP decreased by about 45% after the treatment of Nicotiana benthamiana with 100-fold dilution of Bacillus Velez TCS001 suspension. This shows that the Bacillus Velez TCS001 suspension can significantly inhibit the replication of yellow leaf curl virus CP after treatment of Nicotiana benthamiana, and has a good control effect.

[0071] Example 5 Determination of the Effect of Bacillus velez TCS001 Suspension Concentrate at Different Dilution Factors (25, 50, 100, 200, 400 and 500 Times) on the Growth Morphological Indexes of Nicotiana benthamiana Nicotiana benthamiana was planted and cultured as in Example 1.

[0072] The preparation of LB solid medium and LB liquid medium was as in Example 1.

[0073] The preparation of the suspension concentrate of Bacillus Velez TCS001 was as in Example 4. The preparation of the Agrobacterium culture solution containing the infectious clone of yellow leaf curl virus, the yellow leaf curl virus inoculation, the treatment methods of each treatment group, the investigation of the disease incidence and the calculation of the yellow leaf curl virus CP replication were as in Example 1.

[0074] Example 2: Determination of Root Length, Fresh Weight and Dry Weight of Nicotiana benthamiana

[0075] Example 2: Determination of plant height, chlorophyll content and leaf surface area of ​​Nicotiana benthamiana.

[0076] 0.1% Tween water was used as a blank control, 5% amino oligosaccharide solution was diluted 300 times with 0.1% Tween water and then sprayed as a positive chemical control, and Bacillus Velezii TCS001 suspension was diluted 25 times, 50 times, 100 times, 200 times, 400 times and 500 times as the treatment group. The treatment method and treatment amount were the same as in Example 1. The experimental results are shown in FIG. Figure 8 As shown, compared with the control group (CK), the height of Nicotiana benthamiana plants increased after being treated with 25-fold, 50-fold, 100-fold, 200-fold, 400-fold, 500-fold dilutions of Bacillus Velez TCS001 suspension concentrate and 5% amino oligosaccharide aqueous solution (5% AO). Among them, the height promotion effect of Nicotiana benthamiana plants was most obvious when the Bacillus Velez TCS001 suspension concentrate was diluted 100-fold. Compared with the control group (CK), treatment with Bacillus Velez TCS001 suspension concentrate diluted 25 times, 50 times, 100 times, 200 times, 400 times, 500 times and 5% amino oligosaccharide aqueous solution (5% AO) of Nicotiana benthamiana significantly increased the chlorophyll content of leaves. Among them, treatment with Bacillus Velez TCS001 suspension concentrate diluted 100 times had the most significant effect on increasing the chlorophyll content of Nicotiana benthamiana leaves. Compared with the control group (CK), the surface area of ​​Nicotiana benthamiana leaves was significantly increased after treatment with 25-fold, 50-fold, 100-fold, 200-fold, 400-fold, and 500-fold dilutions of Bacillus Velez TCS001 suspension and 5% amino oligosaccharide aqueous solution (5% AO). Among them, the increase in the surface area of ​​Nicotiana benthamiana leaves was most obvious when the Bacillus Velez TCS001 suspension was diluted 100-fold.

[0077] like Figure 9 As shown, compared with the control group (CK), the roots of Nicotiana benthamiana plants sprayed with 25-fold, 50-fold, 100-fold, 200-fold, 400-fold, 500-fold dilutions of Bacillus Velez TCS001 suspension and 5% amino oligosaccharide aqueous solution (5% AO) were significantly lengthened, among which the spraying of Bacillus Velez TCS001 suspension diluted 100-fold had the most significant effect on promoting the elongation of the roots of Nicotiana benthamiana plants. Compared with the control group (CK), the root dry weight of Nicotiana benthamiana plants sprayed with Bacillus Velezii TCS001 suspension concentrate diluted 25 times, 50 times, 100 times, 200 times, 400 times, 500 times and 5% amino oligosaccharide aqueous solution (5% AO) was significantly increased, among which the spraying of TCS001 suspension concentrate diluted 100 times had the most significant effect on the root dry weight of Nicotiana benthamiana plants. Compared with the control group (CK), the root fresh weight of Nicotiana benthamiana plants sprayed with 25-fold, 50-fold, 100-fold, 200-fold, 400-fold, 500-fold dilutions of Bacillus Velez-Bélez TCS001 suspension and 5% amino oligosaccharide aqueous solution (5% AO) was significantly increased, among which the root fresh weight of Nicotiana benthamiana plants sprayed with 100-fold dilution of Bacillus Velez-Bélez TCS001 suspension had the most significant effect on promoting the root fresh weight of Nicotiana benthamiana plants.

[0078] Example 6 Determination of the protective effect of Bacillus velezensis TCS001 suspension concentrate diluted 100 times against tobacco mosaic virus.

[0079] Nicotiana benthamiana was planted and cultivated as in Example 1.

[0080] The preparation of LB solid medium and LB liquid medium was as in Example 1.

[0081] The suspension concentrate of Bacillus velezensis TCS001 was prepared as in Example 4.

[0082] Preparation of Agrobacterium containing tobacco mosaic virus infectious clones: Activate Agrobacterium containing tobacco mosaic virus infectious clones on LB plates containing kanamycin and rifampicin resistance, culture at 28°C for 48-72 hours, select well-grown single colonies and transfer them to liquid LB medium containing kanamycin and rifampicin resistance, and culture at 28°C, 200 rpm, shaking for 12-16 hours until the bacterial concentration reaches OD 600 =0.6-10.

[0083] Transfer the bacterial suspension to an EP tube, centrifuge at 3000 rpm for 8 minutes at room temperature, discard the supernatant, and resuspend the bacterial pellet in infiltration buffer (1 M MgCl2, 10 mM MES, pH=5.6, and 100 mM acetosyringone) to adjust the OD 600 =0.05 and place in the dark at room temperature for 2-3 hours. Use a sterile syringe to inject the Agrobacterium solution containing the infectious clone of tobacco mosaic virus into the non-veined area on the back of the leaves of healthy Nicotiana benthamiana plants (four-leaf stage).

[0084] The treatment with 0.1% Tween water was used as the blank control, and 5% amino oligosaccharide solution was diluted 300 times with 0.1% Tween water and then sprayed as the positive chemical control. The suspension concentrate of Bacillus Velez TCS001 was diluted 100 times as the treatment group. The control group and the treatment group were sprayed once every 48 hours. The spray induction method was used for a total of 3 times. The application rate was 20 mL / pot, and there were 10 replicates for each treatment, a total of 120 mL. TMV was inoculated by injection 24 hours after treatment, and the disease incidence was investigated 7 days later.

[0085] A UV flashlight was placed at the same height as the Nicotiana benthamiana plants inoculated with tobacco mosaic virus to take photos.

[0086] The diseased upper leaves were ground into powder in liquid nitrogen and total RNA was extracted using the TRIZOL method. After the extracted RNA passed the quality and concentration tests, cDNA was synthesized according to the instructions of the Tiangen FastQuant cDNA First Strand Synthesis Kit. β-actin The primers used were β-actinF: ATGCCTATGTGGGTGACGAAG, β-actinR: TCTGTGGCCTTAGGGTTGAG, and a pair of specific primers, TMV CP-F: TGGGCCGACCCAATAGAGTT, TMV CP-R: TCTGATCAATTCTAC. The total volume of the RT-qPCR reaction system was 20 μL and consisted of 10 μL of 2× Ultra SYBR Mixture, 1 μL each of forward and reverse primers, 2 μL of cDNA, and 6 μL of ddH2O. The reaction procedure was as follows: pre-denaturation at 95°C for 10 minutes, followed by 35 cycles of denaturation at 95°C for 1 second, annealing at 55°C for 30 seconds, and extension at 72°C for 50 seconds. Three biological replicates were set for each sample, and three technical replicates were set for each biological replicate. Data were collected and analyzed using Bio-RadiQ5 software, using 2 ⁻ΔΔCt Methods for calculating tobacco mosaic virus CP Relative expression level.

[0087] The diseased upper leaves were ground into powder in liquid nitrogen, and the total protein was extracted using RIPA buffer lysis solution from Beyotime Bio. Protein hybridization was performed using Beyotime Bio Anti-GFP (mouse monoclonal antibody) as the primary antibody and Beyotime Bio horseradish peroxidase-labeled goat anti-mouse as the secondary antibody. Chemiluminescence development was performed using the Beyotime Bio ultrasensitive ECL chemiluminescence kit and photographed to analyze the changes in the accumulation level of tobacco mosaic virus CP protein.

[0088] Experimental results like Figure 10As shown in the figure, under ultraviolet light, the systemic leaves of Nicotiana benthamiana exhibited significant fluorescence. However, the fluorescence of the systemic leaves of Nicotiana benthamiana treated with a 100-fold dilution of the Bacillus Velez TCS001 suspension concentrate was weaker, indicating that the Bacillus Velez TCS001 suspension concentrate was more effective in preventing and controlling tobacco mosaic virus after treatment.

[0089] The results of real-time fluorescence quantitative PCR are shown as follows ( Figure 11 ), after Nicotiana benthamiana was treated with a 100-fold dilution of the Bacillus Velez TCS001 suspension concentrate, the relative expression level of TMV CP decreased by about 60%; protein hybridization results showed that after Nicotiana benthamiana was treated with a 100-fold dilution of the Bacillus Velez TCS001 suspension concentrate, the accumulation of tobacco mosaic virus CP at the protein level also decreased significantly; this indicates that Nicotiana benthamiana treated with the Bacillus Velez TCS001 suspension concentrate can significantly inhibit the replication of tobacco mosaic virus, and has a good control effect.

Claims

1. Bacillus Velez TCS001, and / or a lipopeptide fermentation product of Bacillus Velez TCS001, and / or a fermentation broth of Bacillus Velez TCS001, and / or a bacterial suspension of Bacillus Velez TCS001, and / or a fermentation filtrate of Bacillus Velez TCS001 for biological control of tomato yellow leaf curl virus and tobacco mosaic virus. The Bacillus Velez TCS001 is deposited under CGMCC No. 8921.

2. Use of Bacillus Velez TCS001, and / or a lipopeptide fermentation product of Bacillus Velez TCS001, and / or a fermentation broth of Bacillus Velez TCS001, and / or a bacterial suspension of Bacillus Velez TCS001, and / or a fermentation filtrate of Bacillus Velez TCS001 in antagonizing tomato yellow leaf curl virus and tobacco mosaic virus. The Bacillus Velez TCS001 is deposited under the CGMCC No. 8921.

3. Use of Bacillus Velez TCS001, and / or a lipopeptide fermentation product of Bacillus Velez TCS001, and / or a fermentation broth of Bacillus Velez TCS001, and / or a bacterial suspension of Bacillus Velez TCS001, and / or a fermentation filtrate of Bacillus Velez TCS001 in the preparation of pesticides for preventing and controlling tomato yellow leaf curl virus and tobacco mosaic virus. The Bacillus Velez TCS001 is deposited with CGMCC No. 8921.

4. Use of Bacillus Velez TCS001, and / or Bacillus Velez TCS001 lipopeptide fermentation products, and / or Bacillus Velez TCS001 fermentation broth, and / or Bacillus Velez TCS001 bacterial suspension, and / or Bacillus Velez TCS001 fermentation filtrate for inducing crops to resist tomato yellow leaf curl virus and tobacco mosaic virus. The Bacillus Velez TCS001 is deposited with CGMCC No. 8921.

5. Use of Bacillus Velez TCS001, and / or a lipopeptide fermentation product of Bacillus Velez TCS001, and / or a fermentation broth of Bacillus Velez TCS001, and / or a bacterial suspension of Bacillus Velez TCS001, and / or a fermentation filtrate of Bacillus Velez TCS001 in the preparation of a medicament for inducing crop resistance to tomato yellow leaf curl virus and tobacco mosaic virus. The Bacillus Velez TCS001 is deposited with CGMCC No. 8921.

6. The use according to claim 4 or 5, characterized in that The use is to inhibit the replication of tomato yellow leaf curl virus and tobacco mosaic virus.

7. The use according to claim 4 or 5, characterized in that The inducing crop resistance is to promote the expression of disease resistance genes.

8. The use according to claim 7, characterized in that The disease-resistant genes are PR1a, PR1b and PDF1.

2.

9. Use of Bacillus Velez TCS001, and / or Bacillus Velez TCS001 lipopeptide fermentation products, and / or Bacillus Velez TCS001 fermentation broth, and / or Bacillus Velez TCS001 bacterial suspension, and / or Bacillus Velez TCS001 fermentation filtrate in promoting crop growth morphological indicators. Preferably, the growth morphological indicators include one or more of plant height, leaf surface area, chlorophyll content, root length, root dry weight and root fresh weight.

10. The use according to claim 4, 5 or 9, characterized in that: The crop is a Solanaceae plant; preferably, the Solanaceae plant is Nicotiana benthamiana.

Images