Enzyme for catalyzing biosynthesis of tripdiolide

Abstract

The invention provides a catalytic tripdiolide biosynthase and application of the catalytic tripdiolide biosynthase to catalysis of C-2 site hydroxylation of an abietane type diterpenoid compound, the enzyme is cytochrome P450 oxidase CYP71BE272, and the invention further relates to polynucleotide CYP71BE272 for encoding the enzyme, and the polynucleotide CYP71BE272 is used for encoding the tripdiolide biosynthase and application of the catalytic tripdiolide biosynthase to catalysis of C-2 site hydroxylation of the abietane type diterpenoid compound. Catalytic experiments prove that the enzyme has the function of catalyzing hydroxylation of a triptolide C2 site to form triptolide. The tripdiolide biosynthesis can be realized by utilizing a saccharomyces cerevisiae system and by virtue of simple compound enrichment and separation, the invention provides a green and efficient method for obtaining tripdiolide, and the method has important significance for relieving the current scarce market demand and further development and utilization of the compound.

Description

Technical Field

[0001] The present invention relates to a biosynthetic enzyme of abietane-type diterpene natural product triptolide, a preparation method of triptolide, and a gene encoding the biosynthetic enzyme, and belongs to the field of medicinal plant genetic engineering. Background Art

[0002] Tripdiolide and triptolide are the main active ingredients of Tripterygium wilfordii (Tripterygium wilfordii Hook.f.), a plant of the Celastraceae family. They exhibit significant anti-inflammatory, anti-tumor, and immunosuppressive pharmacological activities and are the main active ingredients of Tripterygium wilfordii polyglycosides and Tripterygium wilfordii total terpenoids. They are commonly used clinically to treat refractory immunological disorders such as rheumatoid arthritis, chronic nephritis, and lupus erythematosus. As a secondary metabolite, triptolide is present in only one part per hundred thousand of the source plant, and its extraction still relies on plant extraction and isolation. However, Tripterygium wilfordii is a perennial plant with a long growth cycle, and obtaining the required triptolide can result in significant damage to plant and land resources.

[0003] Based on the elucidated biosynthetic pathway for triptolide, obtaining triptolide through biosynthesis is in line with the concept of green environmental protection. From a chemical structure perspective, triptolide can be formed by hydroxylation of triptolide at the C-2 position. While triptolide monomer is readily available in the market, triptolide itself is unavailable due to its extremely low yield. Therefore, exploring the C-2 hydroxylase involved in triptolide biosynthesis could enable the biosynthesis of triptolide from triptolide, enabling cost-effective acquisition of scarce compound resources. Summary of the Invention

[0004] In a first aspect, the present invention provides an isolated cytochrome P450 oxidase that participates in the biosynthesis of the abietane-type diterpenoid compound triptolide. The enzyme (hereinafter referred to as CYP71BE272) is isolated from Tripterygium wilfordii and catalyzes the formation of the C-2 hydroxyl group in triptolide. The enzyme has the amino acid sequence set forth in SEQ ID NO: 2, or a functionally equivalent peptide comprising the amino acid sequence set forth in SEQ ID NO: 2 with one or more amino acids substituted, deleted, or added.

[0005] In a second aspect, the present invention provides a polynucleotide encoding the enzyme of the present invention (or a gene encoding the Tripterygium wilfordii cytochrome P450 oxidase, hereinafter referred to as CYP71BE272). The polynucleotide preferably has the nucleotide sequence of SEQ ID NO:1 and its degenerate sequences. A degenerate sequence refers to a sequence resulting from the replacement of one or more codons in the nucleotide sequence of SEQ ID NO:1 with degenerate codons encoding the same amino acid. Due to codon degeneracy, a degenerate sequence with as little as approximately 74% homology to the nucleotide sequence of SEQ ID NO:1 can also encode the amino acid sequence of the enzyme of SEQ ID NO:2. This polynucleotide also includes nucleotide sequences that hybridize to the nucleotide sequence from nucleotides 1 to 1521 of SEQ ID NO:1 under moderately stringent conditions, and more preferably under highly stringent conditions. This polynucleotide also includes nucleotide sequences that are at least 70%, preferably at least 80%, more preferably at least 90%, and most preferably at least 95% homologous to the nucleotide sequence of SEQ ID NO:1. Also included are variants of the open reading frame sequence in SEQ ID NO: 1 that encode proteins having the same function as native Tripterygium wilfordii cytochrome P450 oxidase. These variants include (but are not limited to) deletions, insertions, and / or substitutions of several nucleotides (usually 1-90, preferably 1-60, more preferably 1-20, and most preferably 1-10), and additions of several nucleotides (usually within 60, preferably within 30, more preferably within 10, and most preferably within 5) at the 5' and / or 3' ends.

[0006] The third aspect of the present invention provides an expression vector comprising the polynucleotide according to the second aspect of the present invention. The expression vector may be an expression vector selected from the pESC series and pCAMBIA1300.

[0007] In a fourth aspect, the present invention provides a recombinant host bacterium comprising the polynucleotide described in the second aspect of the present invention or the expression vector described in the third aspect of the present invention, wherein the host bacterium is selected from bacteria, yeast cells, fungal cells, insect cells, mammalian cells and plant cells, preferably yeast or bacteria, such as BY series yeast or GV3101 Agrobacterium.

[0008] The full-length polynucleotide sequence encoding the CYP71BE272 enzyme of the present invention, or fragments thereof, can generally be obtained by PCR amplification, recombinant methods, or synthetic methods. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed herein and amplified using a commercially available cDNA library or a cDNA library prepared according to conventional methods known to those skilled in the art as a template. Long sequences often require two or more PCR amplifications, followed by splicing the fragments amplified in the correct order. Once the relevant sequence is obtained, recombinant methods can be used to obtain it in large quantities. This typically involves cloning into a vector, transfecting into cells, and then isolating the relevant sequence from the proliferated host cells using conventional methods. Furthermore, mutants can be introduced into the protein sequences of the present invention by chemical synthesis. In addition to recombinant production, fragments of the proteins of the present invention can also be produced by direct peptide synthesis using solid-phase techniques (Stewart et al., Solid-Phase Pedtide Synthesis, J. Am. Chem. Soc. 1963, 85:2149-2154). In vitro protein synthesis can be performed manually or automatically. For example, peptides can be automatically synthesized using an Applied Biosystems Model 431A Peptide Synthesizer (Foster City, CA).Fragments of the proteins of the invention can be chemically synthesized separately and then chemically linked to produce the full-length molecule.

[0009] The present invention constructs the cloned CYP71BE272 gene into an expression vector, and catalytic experiments confirm that the gene completes the hydroxylation of the C-2 position of the abietane-type diterpenoid triptolide.

[0010] Therefore, in a fifth aspect, the present invention provides the use of CYP71BE272, or its encoding gene CYP71BE272, or an expression vector comprising the gene CYP71BE272, and a host bacteria comprising the expression vector in the biosynthesis of diterpenoid compounds, especially in catalyzing the formation of the C-2 hydroxyl group of the abietane-type diterpenoid triptolide.

[0011] In a sixth aspect, the present invention provides an application of an enzyme comprising the present invention, or a gene encoding the enzyme, or an expression vector comprising the gene encoding the enzyme, or a host bacterium comprising the gene encoding the enzyme or the expression vector in the biosynthesis of triptolide. Specifically, a method for fermenting a yeast strain comprising the gene encoding the enzyme to enrich the target compound in large quantities and obtain pure triptolide by preparation and separation is provided, or a method for directly using the enzyme of the present invention to biosynthesize triptolide in vitro is provided. Agrobacterium is further used to verify that the bacteria comprising the gene encoding the enzyme of the present invention can biosynthesize triptolide in tobacco. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is the agarose gel electrophoresis diagram of the CYP71BE272 gene (L1: nucleic acid molecular weight size marker; L2: CYP71BE272 gene band).

[0013] Figure 2 This is the functional characterization of CYP71BE272 in Saccharomyces cerevisiae. EV is an empty vector.

[0014] Figure 3 This is the functional characterization of the tobacco transient expression system CYP71BE272. EV is the empty vector, and Tripdiolide is triptolide.

[0015] Figure 4 This is for the in vitro enzymatic activity characterization of CYP71BE272, and EV is an empty vector.

[0016] Figure 5 Triptolide 1 H NMR spectrum.

[0017] Figure 6 Triptolide 13 C NMR spectrum. DETAILED DESCRIPTION

[0018] The present invention is further described below with reference to specific examples. These examples are intended to illustrate the present invention only and are not intended to limit the scope of the invention. Unless otherwise specified in the following examples, conventional experimental methods or methods recommended by the manufacturer are generally used. In addition, any methods and materials similar or equivalent to those described herein can be applied to the methods of the present invention. The preferred embodiments and materials described herein are merely exemplary for demonstrating gene function in the present invention.

[0019] The Tripterygium wilfordii suspension cells used in the following examples have been published in the document “Full-length cloning and expression analysis of Tripterygium wilfordii 4-(5'-diphosphocytidine)-2-C-methyl-D-erythritol kinase gene. Chinese Journal of Traditional Chinese Medicine, 2015, 40(21)” and are available to the public from relevant laboratories of the China Academy of Chinese Medical Sciences.

[0020] Hot Start High-Fidelity 2Fidelity 2× Master Mix, BamHI-HF, NotI-HF, SpeI-HF, and SalI-HF restriction endonucleases were purchased from New England Biolabs; Max Master Mix and 2×Rapid Taq Master Mix were purchased from Nanjing Novozymes Biotechnology Co., Ltd.; Rapid Universal Plant RNA Extraction Kit was purchased from Beijing Huayueyang Biotechnology Co., Ltd.; Trans2K Plus II DNA Marker, pEASY-Blunt Simple Cloning Kit, Seamless Cloning and Assembly Kit and Escherichia coli competent cells Trans1-T1 were purchased from Beijing Quanshijin Biotechnology Co., Ltd.; Gene JET Gel Extraction Kit was purchased from Thermo Scientific; pESC-Leu vector was purchased from Agilent; pCAMBIA1300 vector was purchased from Cambia; GV3101 competent cells were purchased from Shanghai Weidi Biotechnology Co., Ltd.; SD-Leu was purchased from Beijing Fanjinuo Technology Co., Ltd.; ZYMO RESEARCH Frozen-EZYeast Transformation II kit was purchased from Zymo Research; and triptolide (CAS: 38748-32-2) standard was purchased from Shanghai Yuanye Biotechnology Co., Ltd.

[0021] Example 1. Cloning of Tripterygium wilfordii CYP71BE272 gene ( Figure 1 )

[0022] according to Super Total RNA Extraction Kit (Promega) was used according to the manual:

[0023] (1) 50 mg of T. wilfordii cell suspension (or T. wilfordii plant sample) was placed in an RNase-free 2 mL Eppendorf tube, frozen in liquid nitrogen, and then pulverized using a hybrid grinder (MM400, Retsch) for 1 min.

[0024] (2) Add 500 μL RNA lysis buffer to the crushed Tripterygium wilfordii sample and gently invert the Eppendorf tube 3-4 times to thoroughly mix the lysed sample;

[0025] (3) Add 500 μL of RNA dilution solution to the Eppendorf tube in step (2), mix thoroughly by pipetting, and centrifuge at 4°C, 13,000 × g for 5 min.

[0026] (4) Transfer the supernatant to a new 2 mL Eppendorf tube free of RNase, add 0.5 volumes of anhydrous ethanol, and invert the tube to mix the sample.

[0027] (5) Transfer the supernatant in the centrifuge tube to a centrifuge column (provided in the kit), centrifuge at 4°C, 13,000 × g, for 1 min, and discard the filtrate (centrifugation can be repeated several times);

[0028] (6) Add 600 μL RNA wash solution to the centrifuge column, centrifuge at 4°C, 13,000 × g for 45 s, and discard the filtrate;

[0029] (7) Add 50 μL of DNase I to the centrifuge column and incubate at room temperature for 15 min;

[0030] (8) Add 600 μL RNA wash solution to the centrifuge column, centrifuge at 4°C, 13,000 × g for 45 s, discard the filtrate, repeat the wash once, and then centrifuge the empty column at 4°C, 13,000 × g for 2 min;

[0031] (9) Add 50 μL of preheated RNase-free water to the centrifuge column, incubate at room temperature for 2 min, and centrifuge at 4°C, 13,000 × g for 1 min to collect the RNA solution;

[0032] (10) After RNA quality was tested using 1.0% agarose gel electrophoresis, the RNA concentration was determined for cDNA reverse transcription synthesis, and the remaining RNA was quickly frozen in liquid nitrogen and stored in a -80°C ultra-low temperature refrigerator;

[0033] cDNA was reverse transcribed and synthesized using the FastQuant RT Kit (with gDNase). 0.5-2.0 μg of total RNA was used to establish a 20 μL reaction system. The reaction was carried out on ice.

[0034] (1) Prepare a mixture according to the following table to remove genomic DNA, mix thoroughly, centrifuge, incubate at 42°C for 3 minutes, and cool the reaction product on ice:

[0035] 5×gDNABuffer 2.0μL

[0036] Total RNA 0.05-2.0 μg

[0037] Sterile water Up to 10μL

[0038] (2) Prepare the reverse transcription reaction mixture according to the following table:

[0039]

[0040] (3) Preparation of the first-strand cDNA reverse transcription reaction system: Add the reverse transcription mixture prepared in step (2) to the reaction solution from which genomic DNA was removed in step (1), mix thoroughly, incubate at 42°C for 15 min, and then at 95°C for 3 min;

[0041] (4) After the reaction is completed, the product is immediately placed on ice to stop the reaction, and the obtained cDNA is stored in a -20℃ refrigerator.

[0042] Full-length gene cloning and PCR product purification:

[0043] According to the full-length cDNA sequence of the CYP450 gene in the transcriptome, specific primers for full-length cloning (F: ATGGATTATCAATTTCCTTCTTTTCCAG (SEQ ID NO: 3), R: TCACTTGTTTTCCTCAACAACAGG (SEQ ID NO: 4)) were designed and used. Hot Start High-Fidelity 2Fidelity 2×Master Mix (extension speed 2-4kb min -1 ) to carry out PCR reaction, the reaction system is as follows:

[0044]

[0045] PCR reaction conditions: 98°C for 30 s; 98°C for 10 s, 56°C for 10 s, 72°C for 60 s, 35 cycles; 72°C for 2 min; hold at 4°C. After the reaction, 3 μL of the reaction product was added to 2 μL of 6× Loading Buffer and electrophoresed on a 1.0% agarose gel (180 V, approximately 10 min). After confirming the correct position of the target band, the DNA was fully separated using 1.5% agarose gel electrophoresis (150 V, approximately 25 min) and the target band was excised.

[0046] Use the Thermo Scientific GeneJET Gel Extraction Kit manual to recover and purify the target gene:

[0047] (1) Add Binding Buffer (0.1 g agarose gel plus 100 μL Buffer) in equal amounts according to the mass of agarose gel into a 2 mL Eppendorf tube containing agarose gel and incubate at 60°C to melt the agarose gel mixture;

[0048] (2) Transfer the agarose gel solution to a GeneJET purification column, centrifuge at 12,000 × g for 1 min, and discard the waste liquid;

[0049] (3) Add 700 μL Wash Buffer to the purification column, centrifuge at 12,000 × g for 1 min, and discard the waste liquid;

[0050] (4) Centrifuge the empty column at 12000×g for 2 min to remove residual wash buffer;

[0051] (5) Transfer the purification column to a new 1.5 mL Eppendorf tube, add 20 μL of sterile water preheated at 60°C, let it stand at room temperature for 2 min, and centrifuge at 12,000 × g for 2 min to collect the target fragment. The purified DNA can be used for the next experiment or stored at -20°C.

[0052] Example 2, in vivo functional verification of CYP71BE272 gene in Saccharomyces cerevisiae ( Figure 2 )

[0053] First, the eukaryotic expression vectors of CPR and CYP450 were constructed.

[0054] (1) Construction of pESC-Leu::(TwCPR3+TwCYP450)

[0055] The catalytic function of CYP450 requires electrons from cytochrome P450 oxidoreductase (CPR). Therefore, the tripterygium wilfordii cytochrome P450 oxidoreductase 3 (TwCPR3) was constructed and inserted into the multiple cloning site MCS2 (multiple cloning site) of the Gal1 promoter of the pESC-Leu vector. The resulting pESC-Leu::TwCPR3 vector is a laboratory-stored vector. Double enzyme digestion was performed using the NEB restriction enzymes NotI-HF and SpeI-HF. The reaction system is:

[0056]

[0057] Reaction conditions: 37°C for 4 hours.

[0058] After the reaction, electrophoresis was performed with Trans2K Plus II DNA Marker and undigested pESC-Leu::TwCPR3 vector to determine the size of the target band after digestion. The linear vector band was purified and recovered using 1.5% agarose gel electrophoresis (150V, 25min) and a gel recovery kit.

[0059] Preparation of DNA fragments: Using the plasmid containing the open reading frame (ORF) of the Tripterygium wilfordii CYP71BE272 gene as a template, the specific primers Uni-CYP189-F / R were used to amplify the gene coding region. The primers are shown in Table 1. Amplification was performed using Hot Start High-Fidelity 2× Master Mix. PCR parameters are as described in Example 1. Electrophoresis detected bands at the corresponding positions, and the amplified products were separated by agarose gel electrophoresis and the DNA fragments were purified and recovered.

[0060] Table 1 List of primers for eukaryotic expression vector construction

[0061]

[0062]

[0063] The target fragment CYP71BE272 and the linear vector were connected into a circular shape using seamless splicing (homologous recombination principle). The eukaryotic expression vector pESC-Leu::(CYP71BE272+TwCPR3) was constructed using the Seamless Cloning and Assembly Kit (Quanshijin). The concentrations of the target fragment and vector fragment were determined using a nucleic acid quantifier. A seamless splicing reaction system was prepared by combining the target fragment and vector fragment at a 2:1 molar ratio. An equal volume of 2× Basic Cloning Mix was added, mixed thoroughly, and incubated at 50°C for 30 minutes.

[0064] The seamless splicing reaction system was transferred into 50 μL TransT1 Escherichia coli competent cells and mixed and placed in an ice bath for 30 min, heat-shocked in a 42°C water bath for 45 s, and allowed to stand in an ice bath for 2-3 min. 500 μL LB liquid medium (without antibiotics) was added and the cells were revived at 37°C and 180 rpm for 1-2 h. The cells were centrifuged at 4000 × g for 60 s, and 100 μL of the supernatant was retained to resuspend the cells. The cells were evenly spread on a plate containing 100 mg·L -1 Culture in the dark at 37°C for 12-16 hours on LB solid medium containing ampicillin. Pick colonies from the plate and use a culture medium shaken at 37°C, 250 rpm, in the dark for 1-2 hours as a template. Verify positive clones using Gal10-F / R (Table 1). Sequencing of the culture medium containing the target band will yield the pESC-Leu::(CYP71BE272+TwCPR3) eukaryotic expression vector.

[0065] The constructed vector was transformed into the Saccharomyces cerevisiae strain BY-4741 for functional verification. The specific transformation method is as follows:

[0066] (1) Preparation of yeast competent cells

[0067] Yeast competent cells were prepared using the Zymo Research Frozen-EZ Yeast Transformation Kit II, performed aseptically in a cleanroom:

[0068] 1) Streak the Saccharomyces cerevisiae BY4741 strain onto a YP (1% yeast extract and 2% peptone) and 2% glucose (Glc) solid plate using a loop and incubate inverted at 30°C for 40 h.

[0069] 2) Pick the activated monoclonal colony from the plate and inoculate it into 20 mL YP + 2% Glc liquid medium, shake and culture at 30°C and 200 rpm until the OD600 Reaching around 0.6-0.8;

[0070] 3) Centrifuge in a Sigma 3-18K low-temperature high-speed centrifuge at 500 × g for 4 min at 4°C and remove the supernatant.

[0071] 4) Add 10 mL of Frozen-EZ solution 1 to resuspend the cells, centrifuge at 500 × g for 4 min at 4°C, and remove the supernatant.

[0072] 5) Add 1 mL of Frozen-EZ solution 2 to resuspend the cells and aliquot 50 μL into sterile 1.5 mL Eppendorf tubes for subsequent plasmid transformation or storage in a -80°C freezer.

[0073] (2) Yeast competent transformation

[0074] 1) Add 0.2-1 μg of recombinant plasmid pESC-Leu::(CYP71BE272+TwCPR3) to 50 μL of competent cells and gently flick to mix.

[0075] 2) Add 500 μL of Frozen-EV Solution 3 and mix thoroughly. Incubate at 30°C for 1-2 hours, inverting and mixing every 30 minutes.

[0076] 3) Take 100 μL of the incubation solution and evenly spread it on a synthetic dropout medium (SD) SD-Leu plate. Incubate the plate in an inverted manner at 30°C for 48-72 hours.

[0077] (3) Positive verification and bacterial fermentation

[0078] Randomly pick single clones and place them in the corresponding liquid culture medium, and culture them at 30°C and 200 rpm with shaking for 24-36 hours;

[0079] Positive verification: Take 1 μL of bacterial culture and perform a PCR reaction on the positive clone to test whether the recombinant plasmid has been successfully transformed into Saccharomyces cerevisiae. Use 2× Rapid Taq Master Mix for PCR verification. The reaction system and reaction procedure are as follows:

[0080]

[0081] PCR reaction conditions: 95°C for 3 min; 35 cycles of 95°C for 15 s, 56°C for 15 s, and 72°C for 30 s; 72°C for 5 min; hold at 4°C. After the reaction, 5 μL of the reaction product was subjected to 1.0% agarose gel electrophoresis (180 V, approximately 10 min) to detect the presence of the target band.

[0082] The positive clone strains were expressed as OD600 0.1 was inoculated into 20 mL of SD-Leu + 2% Glc and cultured at 30°C, 200 rpm for 12-16 hours. After centrifugation at 3000×g, the cells were resuspended in 20 mL of SD-Leu + 2% galactose (Gal), and 100 μM of the substrate triptolide was added. The cells were induced at 30°C, 200 rpm for 2-3 days. Extraction method: Ethyl acetate was added in an equal volume to the culture medium and ultrasonically extracted for 30 minutes twice, with occasional shaking. The ethyl acetate layer was transferred to a 50 mL centrifuge tube and centrifuged at 4000×g for 2 minutes to separate the layers. The ethyl acetate layers were combined and frozen at -20°C for 30 minutes to remove moisture from the extract. The ethyl acetate was recovered by rotary evaporation at 40°C. The inner wall of the rotary evaporator was washed twice with 700 μL of ethyl acetate. The ethyl acetate solution was combined, dried with high-purity nitrogen, and reconstituted with 100 μL of mass spectrometry-grade methanol. After high-speed centrifugation at 15,000×g for 10 minutes, the supernatant was analyzed by Q Executive HF.

[0083] HPLC-MS / MS Q Executive HF detection conditions:

[0084] Mobile phase: phase A (0.1% formic acid-water), phase B (acetonitrile), separation was performed on an ACQUITY UPLCVR HSS T3 column (2.1 mm × 100 mm × 1.8 μm, Waters), column temperature was 30°C, liquid phase gradient was as follows: 0-4 min, 30-34% B; 4-8 min, 34-52% B; 8-9 min, 52-100% B; 9-12 min, 100% B; 12-12.5 min, 100-30% B; and 12.5-16 min, isobaric 30% B. The full scan method in the positive ion mode was used for detection. The mass spectrometry detection conditions were as follows: mass range m / z 100-1000, scan time 0.2s, sheath gas flow rate 45, capillary temperature 320°C, electrospray current 0.4μA. The detection results were analyzed using Xcalibur software. Figure 2 , showing that CYP71BE272 catalyzes the substrate triptolide 2 to generate a new hydroxylation product 1: triptolide.

[0085] Example 3, Functional Verification of CYP71BE272 Tobacco Transient Expression System ( Figure 3 )

[0086] (1) Construction of pCAMBIA1300::CYP71BE272

[0087] CYP71BE272 was constructed into the SalI and SpeI sites in the multiple cloning site of the pCAMBIA1300 vector to form the pCAMBIA1300::CYP71BE272 recombinant plasmid. The specific operation was the same as in Example 1.

[0088] Vector Preparation: The reaction system contains 1.5 μg of vector DNA, 1 μL of SpeI endonuclease, 1 μL of SalI endonuclease, and 5 μL of 10× Cutsmart buffer. Add sterile water to a total volume of 50 μL. Incubate at 37°C for 4 hours. Undigested vector and DNA marker are used as controls. Differential vector banding and expression patterns before and after digestion are detected by electrophoresis. Successfully digested products can be recovered using a gel extraction kit to linearize the vector fragment.

[0089] Preparation of DNA fragments: Using the plasmid containing the open reading frame (ORF) of the Tripterygium wilfordii CYP71BE272 gene as a template, the specific primers Uni-CYP189(YC)-F / R were used to amplify the gene coding region. The primers are shown in Table 1. Amplification was performed using Hot Start High-Fidelity 2× Master Mix. PCR parameters are as described in Example 1. Electrophoresis detected bands at the corresponding positions, and the amplified products were separated by agarose gel electrophoresis and the DNA fragments were purified and recovered.

[0090] Seamless splicing method uses The vector pCAMBIA1300::CYP71BE272 was constructed using the Seamless Cloning and Assembly Kit (Qiujin).

[0091] (2) Agrobacterium competent transformation

[0092] 1) Store GV3101 competent cells at -80°C and thaw in an ice-water bath (20-30 min). Add 1 μg of recombinant plasmid pCAMBIA1300::CYP71BE272, mix gently, and place on ice for 10 min.

[0093] 2) Quickly freeze in liquid nitrogen for 5 minutes, immediately place in a 37°C water bath for 5 minutes, and then place in an ice bath for 5 minutes;

[0094] 3) Add 800 μL of LB liquid medium without antibiotics and resuscitate at 28°C and 150 rpm for 2-3 hours;

[0095] 4) Centrifuge at 5000 rpm for 1 min, take about 100 μL of supernatant and gently pipette to resuspend the cells, then apply LB + 50 mg·L -1Kanamycin (Kan) + 20 mg·L -1 Rifampicin (Rif) solid culture medium, placed upside down in a 28°C incubator for 48-72h;

[0096] (3) Positive verification and bacterial fermentation

[0097] Randomly pick single clones and place them in screening liquid culture medium, shake and culture at 28°C and 170 rpm for 24-36 hours;

[0098] Positive verification: Take 1 μL of bacterial solution and perform a PCR reaction on the positive clone to detect whether the recombinant plasmid has been successfully transformed into Agrobacterium. Use 2× Rapid Taq Master Mix for PCR verification. The reaction system and reaction procedure are as follows:

[0099]

[0100] PCR reaction conditions: 95°C for 3 min; 35 cycles of 95°C for 15 s, 56°C for 15 s, and 72°C for 30 s; 72°C for 5 min; hold at 4°C. After the reaction, 5 μL of the reaction product was subjected to 1.0% agarose gel electrophoresis (180 V, approximately 10 min) to detect the presence of the target band.

[0101] 3 to 4 weeks in advance, add a small amount of tobacco seeds (2mL 200mg·L for tobacco seeds) -1 The tobacco leaves were sown in organic soil (nutrient soil and sandy soil in a ratio of 1:1) sterilized at high pressure (121°C for 20 min) and placed in a laboratory artificial climate chamber (25°C, 16h light / 8h dark). The germinated tobacco leaves were divided into individual pots and cultured for 3 to 4 weeks. The specific infection method was as follows: 50 μL of positive bacterial solution was inoculated into 10 mL of LB + 50 mg·L -1 Kan+20mg·L -1 Rif liquid medium, 28 ℃, 170 rpm shaking culture for 16-18h; measure OD 600 Value, according to OD 600 The size determines the amount of bacterial solution used. The final OD value of each bacterial solution after different bacterial solutions (recombinant plasmid solution + P19 protein solution) are resuspended in Buffer 600The concentration of each was 0.6, 2000 rpm, centrifuged for 10 min, and the cells were resuspended in Buffer [10 mM MES (pH 5.6); 10 mM MgCl2, 150 μM AcS (acetosyringone)]. The cells were allowed to stand at 28°C for 3-5 h. The bacterial solution was injected into the tobacco leaves from the back of the leaves with a syringe. After injection, the plants were cultured in the dark for 12 h, and then cultured in an artificial climate chamber under normal light for 3 days. A 100 μM aqueous solution of the substrate triptolide was prepared, and the substrate was injected into the tobacco leaves from the back of the leaves with a syringe. The tobacco leaves were cultured under normal light in an artificial climate chamber for 2 days before sampling. The tobacco leaves were frozen in liquid nitrogen, crushed with a hybrid grinder (MM400, Retsch) for 1 min, and then 1 mL of 80% methanol solution was added to extract the product for Q Executive HF analysis. The detection method is shown in Example 2. The results are shown in Example 2. Figure 3 As shown, compared with the empty control group (EV), the CYP71BE272 group catalyzed the production of triptolide, and its mass spectrometric fragments and retention time were consistent with those of the reference substance triptolide.

[0102] Example 4, in vitro enzymatic reaction of CYP71BE272 protein ( Figure 4 )

[0103] The recombinant plasmids pESC-Leu::TwCPR3 and pESC-Leu::(CYP71BE272+TwCPR3) were transformed into BY4741 Saccharomyces cerevisiae competent cells, with pESC-Leu::TwCPR3 serving as a blank control. The transformed bacterial suspension was plated onto SD-Leu + 2% Glc solid medium and incubated inverted in the dark at 30°C for 48-72 hours. A single colony was selected and activated in 5 mL of SD-Leu + 2% Glc liquid medium and incubated at 30°C, 200 rpm, for 24 hours. The colony was then inoculated into 100 mL of the aforementioned liquid medium and incubated at 30°C, 200 rpm, for 24 hours. An equal volume of liquid medium was then replaced and the cells were induced at 30°C, 200 rpm, for 12-16 hours before yeast microsomes were extracted. The specific steps are as follows:

[0104] (1) Centrifuge at 4000 × g for 3 min at room temperature to collect the cells, resuspend them in 10 mL of TEK solution (preparation method see Table 2), and let them stand at room temperature for 5 min;

[0105] (2) Collect the cells by centrifugation at 4000 × g for 3 min at 4°C and resuspend them in 50 mL of 4°C pre-cooled TESB solution.

[0106] (3) Use an ATS high-pressure cell disruptor to disrupt the resuspended bacteria at a pressure greater than 1000 psi for 2 min. The disrupted bacterial solution is collected in a 50 mL centrifuge tube.

[0107] (4) Centrifuge at 12000×g for 15 min at 4°C, collect the supernatant, add 0.15 M sodium chloride (NaCl) and 0.1 g mL -1 Polyethylene glycol 4000 (PEG4000), mix by inversion and place on ice for 15 min;

[0108] (5) Centrifuge at 12000 × g for 15 min at 4°C, collect the precipitate, dissolve it in 1-2 mL of pre-cooled TEG, mix thoroughly, and aliquot into 500 μL portions. Store in a -80°C ultra-low temperature freezer or use directly in microsomal in vitro enzymatic reaction experiments.

[0109] Table 2 Preparation of reagents for microsomal extraction experiment

[0110]

[0111] Prepare the cofactors required for the in vitro enzymatic reaction of microsomes, including 1 M Tris-HCl (pH 7.4), 50 mM reduced nicotinamide adenine dinucleotide phosphate (NADPH), 10 mM flavin adenine dinucleotide (FAD), 10 mM flavin mononucleotide (FMN), 500 mM glucose-6-phosphate (G-6-P), 1 kU glucose-6-phosphate dehydrogenase (G-6-P-DH), and 1 M dithiothreitol (DTT). The final substrate concentration was 100 μM.

[0112] Prepare the microsomal reaction system according to Table 3, add the required cofactors, substrate (triptolide), and the above-mentioned microsomal protein. Mix the reaction solution thoroughly and react at 30°C and 100 rpm for 12 hours.

[0113] Table 3 Preparation of microsome reaction system

[0114]

[0115]

[0116] Extraction of Enzymatic Product: Add 500 μL of an equal volume of ethyl acetate to the reaction solution, vortex for 1 minute, extract twice, combine the extracts, blow to dryness with nitrogen, reconstitute with 100 μL of mass spectrometry-grade methanol, centrifuge at 15,000 × g for 10 minutes, and collect the supernatant for analysis using QExecutive HF; QExecutive HF is the same as in Example 2. CYP71BE272 enzyme can catalyze the substrate triptolide in vitro to produce the product: triptolide ( Figure 4 ).

[0117] Example 5, Biosynthesis and Structural Identification of Triptolide ( Figure 5-6 )

[0118] The above Examples 2-4 provide three methods for biosynthesizing triptolide based on the enzyme of the present invention. After comprehensive comparison of the operation methods, yield and cost, it is believed that the in vivo fermentation of Saccharomyces cerevisiae described in Example 2 is the most efficient method for biosynthesizing triptolide.

[0119] (1) Obtaining catalytic products through large-scale fermentation

[0120] The BY4741 Saccharomyces cerevisiae strain containing the pESC-Leu::(CYP71BE272+TwCPR3) plasmid from Example 2 was inoculated into 500 mL of SD-Leu+2% Glc liquid culture medium and cultured at 30°C and 200 rpm with shaking until the OD 600 After about 10-15 minutes, the cells were collected by centrifugation, resuspended in 300 mL of SD-Leu + 2% Glc liquid culture medium, and evenly dispersed into 15 2-L conical flasks containing 500 mL of SD-Leu + 2% Gal + 100 μM triptolide liquid culture medium. Fermentation was induced at 30°C and 200 rpm for 3 days. 3-4% sterilized HMG2L resin was added to absorb the fermentation product for 2 days.

[0121] (2) Extraction, preparation and separation of catalytic products

[0122] The resin in the fermentation broth was collected by natural sedimentation, and the resin was washed 3-5 times with distilled water, dried at 40℃, and repeatedly extracted with about 8 times the volume of methanol until the extract was colorless. The extracts were combined and concentrated in a vacuum evaporator at 40℃ to recover the methanol. The resin was re-dissolved in 20mL of chromatographic grade methanol and the resin was purified by semi-preparative liquid chromatography (SEP LC-52) and C 18Separation was performed on a semi-preparative column (10 mm × 250 mm × 5.0 μm, Welch) with a detection wavelength of 203 nm. Mobile phase A was 0.1% formic acid-water (v / v), and mobile phase B was acetonitrile. Isocratic elution was performed with 20% mobile phase B. The injection volume was 200 μL. The 23 min fraction was collected, and the target compound peak was determined by mass spectrometry. After nitrogen purge to remove the acetonitrile, the catalytic product powder was obtained by freeze-drying at low temperature.

[0123] (3) High-resolution mass spectrometry and nuclear magnetic resonance identification of catalytic products

[0124] Product NMR identification: 5 mg of product powder was accurately weighed, 200 μL of deuterated chloroform (CDCl3) was added to fully dissolve the powder, and the powder was transferred to a 3 mm inner diameter NMR tube and 800 M 1 H-NMR and 200M 13 C-NMR analysis and data analysis using MestReNova software confirmed that the catalytic product was triptolide after comparison with literature.

[0125] NMR data of triptolide (5.0 mg light yellow powder)

[0126] 1 H-NMR (CDCl3, 800MHz) δ2.24 (1C-2H, s, 2H), 4.61 (2C-1H, d, J = 1.9Hz, 1H), 2.74 (5C-1H, m) ,2.64(6C-1H,m),1.85(6C-1H,J=13.8Hz,d),3.41(7C-1H,d),3.92(11C-1H,J=3.2Hz,d),3 .51(12C-1H,J=3.3,d),3.37(14C-1H,J=5.4Hz,d),2.08(15C-1H,J=13.1Hz,m),0.88(16C- 3H, J=6.9Hz, d), 1.01 (17C-3H, J=7.0Hz, d), 4.76 (19C-2H, br), 1.32 (20C-3H, J=1.0Hz, s);

[0127] 13C-NMR(CDCl3,200MHz)δ36.06(C-1),60.99(C-2),127.08(C-3),162.06(C-4),40.91(C-5),23.44(C-6),59.52(C-7),65.89(C-8),60.11(C-9),38.21(C-10),54.69(C-11),57.61(C-12),66.44(C-13),73.59(C-14),28.31(C-15),17.87(C-16),16.99(C-17),172.85(C-18),70.23(C-19),15.43(C-20)。

Claims

1. An isolated protein, wherein the protein is a polypeptide comprising (1) the amino acid sequence shown in SEQ ID NO: 2; or (2) the amino acid sequence shown in SEQ ID NO: 2 with one or more amino acids substituted, deleted or added and having the same function.

2. A polynucleotide encoding the protein according to claim 1.

3. An expression vector comprising a promoter, the polynucleotide of claim 2, and a transcription terminator, wherein the promoter is operably linked to the polynucleotide, and the polynucleotide is operably linked to the transcription terminator.

4. A recombinant host cell comprising the polynucleotide molecule of claim 2 or the expression vector of claim 3, wherein the cell is selected from the group consisting of bacteria, yeast cells, fungal cells, insect cells, mammalian cells and plant cells. The host cell according to claim 5 , wherein the yeast cell is a Saccharomyces cerevisiae cell. The host cell according to claim 5 , wherein the bacterium is Agrobacterium.

7. Use of the protein according to claim 1, or the polynucleotide according to claim 2, or the expression vector according to claim 3, or the cell according to any one of claims 4 to 6 in catalyzing the hydroxylation of triptolide at the C-2 position.

8. Use of the protein according to claim 1, or the polynucleotide according to claim 2, or the expression vector according to claim 3, or the cell according to any one of claims 4 to 6 in the biosynthesis and preparation and isolation of triptolide.

9. A method for preparing triptolide by biocatalysis, comprising: (1) inserting a gene expression cassette encoding the protein of claim 1 into a eukaryotic expression vector to prepare a recombinant yeast expressing the enzyme; (2) using triptolide as a substrate and adding it to the recombinant yeast obtained in step (1) / or adding it to the protein separated after the recombinant yeast expression in step (1) to prepare a fermentation broth containing the product triptolide; (3) Separate and purify the fermentation liquid obtained in step (2) to obtain the product triptolide.

10. Use of the protein according to claim 1, or the polynucleotide molecule according to claim 2, or the expression vector according to claim 3, or the recombinant bacterium according to any one of claims 4 to 6 in the cultivation and biosynthesis of active ingredients of Tripterygium wilfordii plants.

Images