Application of rice TTS1 gene in plant salt tolerance regulation

Abstract

The invention discloses an application of a rice TTS1 gene in plant salt tolerance regulation or any one of the following applications: cultivating a plant with enhanced salt tolerance; preparing a product for regulating the salt tolerance of the plants; and preparing and cultivating a plant product with enhanced salt tolerance. The invention discovers and verifies that TTS1 is a gene for positively regulating and controlling the salt tolerance of rice in the seedling stage, and provides a new target for analyzing a rice salt-tolerant molecular mechanism. The TTS1 overexpression can significantly improve the tolerance of rice to high-concentration NaCl (200mM) treatment in the seedling stage, is suitable for improving the salt tolerance character of existing rice varieties, and has important theoretical and practical significance for cultivating high-salt-tolerance varieties of plants.

Description

Technical Field

[0001] The present invention relates to the field of plant genetic engineering, and in particular to application of rice TTS1 gene in regulating plant salt tolerance. Background Art

[0002] Soil salinization is a major ecological issue facing global agricultural production, severely restricting the improvement of crop yield and quality on marginal lands. Rice, a staple food crop in my country, is extremely sensitive to salt stress, often resulting in stunted growth and reduced yield. Therefore, identifying valuable salt-tolerance genes in rice and using them for genetic improvement of salt-tolerant varieties is of great research and application significance. Significant differences in salt tolerance exist among natural rice germplasm. Uncovering the underlying gene regulatory networks and improving varieties through molecular breeding approaches is a key focus of current rice salt tolerance research. Plant responses to salt stress typically involve two phases: an osmotic response in the early stages of stress and ionic stress caused by ion toxicity in the later stages of stress. Plants primarily cope with salt stress through mechanisms such as regulating the accumulation of osmotic regulators, maintaining cellular turgor and ion homeostasis, enhancing antioxidant capacity, and modulating hormone signaling pathways.

[0003] Osmotic stress tolerance mainly depends on the accumulation of organic osmotic regulating substances such as proline and betaine, and the inorganic ion Ca 2+ , K + The dynamic regulation of the cell water and turgor pressure is to maintain the state of the cell water. The alleviation of salt ion toxicity depends on the exclusion or isolation of Na + , such as by limiting Na + Transport in the root system, transfer of Na + Sequestered in vacuoles, or enhanced K + absorption and selective transport, thereby maintaining Na + / K + Balance. Furthermore, plants enhance their antioxidant capacity to resist oxidative damage caused by the accumulation of reactive oxygen species (ROS), primarily through enzymatic systems such as SOD and CAT, as well as non-enzymatic systems such as vitamin E and ascorbic acid. Furthermore, a growing body of research indicates that cell wall integrity plays a crucial role in plant salt tolerance. Cell wall receptor proteins can sense external salt stress signals and regulate downstream response pathways. Changes in cell wall structural components such as cellulose and hemicellulose, as well as the formation of Casparian strips in the endodermis, also contribute to plant adaptation to salt stress.

[0004] In summary, analyzing the key regulatory factors of rice salt tolerance at the molecular level and conducting functional verification and gene utilization on this basis are of great value for constructing salt-tolerant molecular design breeding strategies. Summary of the Invention

[0005] To address the shortcomings of the existing technology, the present invention proposes the application of the rice TTS1 gene in regulating plant salt tolerance. By constructing a chromosome segment substitution line (CSSL) population, the present invention screened and located TTS1 (Tolerance to Salt 1), a gene that positively regulates salt tolerance in rice seedlings. Functional validation using RNA interference and overexpression systematically elucidates the key role of TTS1 in regulating rice salt tolerance and enables the transformation and application of this gene in different genetic backgrounds.

[0006] The present invention provides the use of the rice TTS1 gene in any of the following:

[0007] (1) Regulating plant salt tolerance;

[0008] (2) Cultivating plants with enhanced salt tolerance;

[0009] (3) Preparation of products for regulating plant salt tolerance;

[0010] (4) preparing and cultivating plant products with enhanced salt tolerance;

[0011] The amino acid sequence encoded by the TTS1 gene is shown in SEQ ID NO.2.

[0012] In some embodiments, the regulation in (1) is specifically any one of the following:

[0013] (i) reducing plant salt tolerance by inhibiting or reducing the activity or expression level of the protein encoded by the TTS1 gene;

[0014] (ii) Reduce plant salt tolerance by knocking out, inhibiting or silencing the expression of the TTS1 gene.

[0015] In some embodiments, the adjustment is specifically any one of the following:

[0016] (a) improving plant salt tolerance by increasing the activity or expression level of a protein encoded by a TTS1 gene;

[0017] (b) Improving plant salt tolerance by increasing the expression level of the TTS1 gene.

[0018] In some embodiments, the protein encoded by the TTS1 gene can be artificially synthesized, or the encoding gene can be synthesized first and then biologically expressed.

[0019] In some embodiments, the nucleotide sequence of the TTS1 gene is shown as SEQ ID NO.1.

[0020] In some embodiments, the plant is a grass plant;

[0021] Preferably, in one or more embodiments, the grass plant is any one or more of rice (Oryza sativa), wheat (Triticum aestivum), rye (Secale cereale), barley (Hordeum vulgare), corn (Zea mays), sorghum (Sorghum bicolor) and oats (Avena sativa L.); more preferably, the grass plant is rice.

[0022] The present invention also provides a method for regulating plant salt tolerance, which regulates the expression or activity of the TTS1 gene or its encoded protein;

[0023] The amino acid sequence encoded by the TTS1 gene is shown in SEQ ID NO.2.

[0024] In some embodiments, the method is selected from any one of the following:

[0025] (1) downregulating the expression of the TTS1 gene, the expression of the protein encoded by the TTS1 gene, or the activity of the protein encoded by the TTS1 gene, thereby reducing the salt tolerance of plants;

[0026] (2) Upregulating the expression level of the TTS1 gene, the expression level of the protein encoded by the TTS1 gene, or the activity of the protein encoded by the TTS1 gene, thereby improving the salt tolerance of plants.

[0027] In some embodiments, down-regulating the expression or activity of the TTS1 gene or the protein encoded by it in (1) specifically includes: knocking out or silencing the TTS1 gene in the plant, or inhibiting the activity of the TTS1 protein.

[0028] In some embodiments, the up-regulation of the expression level of the TTS1 gene, the expression level of the protein encoded by the TTS1 gene, or the activity of the protein encoded by the TTS1 gene in (2) is specifically any one of the following:

[0029] (a) transferring an expression construct or vector of the TTS1 gene into a plant or plant cell;

[0030] (b) Transforming the expression construct or vector containing the TTS1 gene into plants or plant cells.

[0031] The present invention also provides a plant breeding method, comprising the following steps: introducing a substance that increases or inhibits the expression level of the TTS1 gene, the expression level of the protein encoded by the TTS1 gene, or the activity of the protein encoded by the TTS1 gene into a plant or plant cell to obtain a bred plant; the amino acid sequence encoded by the TTS1 gene is shown in SEQ ID NO.2.

[0032] The present invention also provides a method for screening a regulator for regulating plant salt tolerance, the method comprising: adding a candidate substance to a system containing the TTS1 gene or a protein encoded by it; detecting the system to observe the expression or activity of the TTS1 gene or the protein encoded by it; the amino acid sequence encoded by the TTS1 gene is shown in SEQ ID NO.2.

[0033] In one or more embodiments, the dosage form of the regulator is selected from any one or more of a solution, an emulsion, a suspension, a powder, a foam, a paste, a granule, and an aerosol.

[0034] In one or more embodiments, the regulator also includes other substances that regulate plant traits.

[0035] In one or more embodiments, the other substances that regulate plant traits include osmotic regulators, brassinolide, algae extract, fertilizers with high potassium, nitrogen or phosphorus content, trace elements (such as boron and zinc), triazole fungicides (such as difenoconazole, propiconazole, and tebuconazole), high-potassium foliar fertilizers, plant hormones (such as abscisic acid, ethylene, cytokinins, and polyamines), rare earths, paclobutrazol (PP333), benzoic acid, salicylic acid, and uniconazole.

[0036] In another preferred embodiment, the osmotic regulator is selected from the following group: inorganic regulators, organic regulators, growth regulators or a combination thereof.

[0037] In summary, compared with the prior art, the present invention achieves the following technical effects:

[0038] 1. The present invention discovered and verified that TTS1 is a key gene that positively regulates salt tolerance in rice seedlings, providing a new target for analyzing the molecular mechanism of rice salt tolerance.

[0039] 2. Overexpression of TTS1 can significantly enhance the tolerance of rice seedlings to high-concentration NaCl treatment, which is suitable for improving the salt tolerance of existing rice varieties and has important application potential in the utilization of marginal cultivated land resources such as coastal tidal flats and saline-alkali land. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.

[0041] Figure 1Figure 1 shows the phenotypes (A) and survival rate statistics (B) of the parents NIP, 93-11 and the substitution line CSSL-134 before and after salt treatment in Example 1 of the present invention;

[0042] Figure 2 This is a vector map for TTS1 RNAi in Example 2 of the present invention;

[0043] Figure 3 The phenotypes (A) and survival rate statistics (B) of Zhu1, TTS1-RNAi-1 and TTS1-RNAi-2 materials before and after salt treatment are shown in Example 2 of the present invention;

[0044] Figure 4 This is a vector map for TTS1 overexpression in Example 3 of the present invention;

[0045] Figure 5 This is Example 3 of the present invention showing the phenotype and survival rate statistics of 93-11, TTS1-OE1 and TTS1-OE2 materials before and after salt treatment. DETAILED DESCRIPTION

[0046] To help those skilled in the art better understand the present invention, the technical solutions in the embodiments of the present invention are clearly and completely described. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work should fall within the scope of protection of the present invention.

[0047] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. The materials and reagents used are all commercially available unless otherwise specified.

[0048] Example 1 Screening of CSSL population and analysis of salt tolerance phenotype

[0049] This example uses a Chromosome Segment Substitution Line (CSSL) population to analyze salt tolerance in rice seedlings to identify potential major genes for salt tolerance. The CSSL population was constructed using the indica rice variety 93-11 as the recipient and the japonica rice variety Nipponbare (NIP) as the donor.

[0050] Through salt tolerance phenotype identification, it was found that in terms of survival rate after 6 days of 200mM NaCl stress treatment and 7 days of rehydration, CSSL134 and donor NIP in the CSSL group showed significantly higher survival rates than 93-11 ( Figure 1), a positive regulatory gene involved in the regulation of salt tolerance in rice seedlings was obtained through map-based cloning technology, named TTS1 (Tolerance To Salt 1), the nucleotide sequence of which is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2.

[0051] Example 2 Cloning and preliminary functional verification of the rice salt tolerance positive regulatory gene TTS1

[0052] To preliminarily verify the function of TTS1, the present invention constructed its RNA interference (RNAi) vector. The specific method is to use primers CF1267 and CF1268 to amplify the coding region of TTS1 and clone it into the RNAi vector. The nucleotide sequences of primers CF1267 and CF1268 are shown in SEQ ID NO.3-4, and the vector map is shown in Figure 2 As shown. Subsequently, the RNAi vector was introduced into the callus tissue of the salt-tolerant variety Zhu1 through Agrobacterium-mediated genetic transformation, and two independent transgenic lines were obtained, named TTS1-RNAi-1 and TTS1-RNAi-2. The 12-day-old seedlings Zhu1, TTS1-RNAi-1 and TTS1-RNAi-2 were placed in 150mM NaCl solution for 6 days, and then rehydrated for 7 days to calculate the survival rate. The results showed that the survival rates of TTS1-RNAi-1 and TTS1-RNAi-2 were significantly lower than those of Zhu1 ( Figure 3 ), indicating that TTS1 plays a positive regulatory role in the salt tolerance of rice.

[0053] Example 3 Construction and functional verification of TTS1 overexpression strain

[0054] On the basis of confirming that TTS1 has a positive regulatory function, in order to further verify its functional role in rice salt tolerance, this example constructed a TTS1 overexpression vector and introduced it into the sensitive rice variety 93-11. Specifically, primers CP3283 and CP3284 (sequences shown in SEQ ID NOs. 5-6) were used to amplify the promoter and coding region sequences of the TTS1 gene, and primers CP3280 and CP3281 (sequences shown in SEQ ID NOs. 7-8) were used to amplify its 3'UTR sequence. The above elements were cloned into a plant expression vector to construct a complete TTS1 overexpression vector ( Figure 4The vector was introduced into 93-11 callus tissue via Agrobacterium-mediated transformation, generating two independent overexpression lines, designated TTS1-OE1 and TTS1-OE2. Subsequently, 12-day-old 93-11, TTS1-OE1, and TTS1-OE2 plants were treated in 200 mM NaCl solution for 6 days and then rehydrated for 7 days. The survival rate of each material was then measured.

[0055] The results showed that the survival rates of TTS1-OE1 and TTS1-OE2 were significantly higher than those of the untransformed 93-11 control ( Figure 5 ), indicating that overexpression of TTS1 can significantly improve the salt tolerance of rice seedlings.

[0056] In summary, TTS1 plays a key positive regulatory role in rice salt tolerance at the seedling stage. Functional variation in this gene in natural germplasm can significantly influence rice's response to salt stress. Given the significant effect of TTS1 in enhancing salt tolerance in rice, this provides a theoretical basis and practical avenues for molecular design breeding of salt-tolerant varieties.

[0057] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

[0058] Sequence Listing

[0059] SEQ ID NO.1

[0060]

[0061] SEQ ID NO.2

[0062]

[0063] SEQ ID NO.3

[0064] CCG CTCGAG AGCTCCTTGGCATCTCATC

[0065] SEQ ID NO.4

[0066] CG GGATCC GTCATCTGCCACGCTTGC

[0067] SEQ ID NO.5

[0068] TGCTGATCTAGAGTCGACTTCAAAGCTATCAGAGACCACCC

[0069] SEQ ID NO.6

[0070] CATTAAAGCAGGGCATGCATGCCGAGAGTAAACAGTTGAAC

[0071] SEQ ID NO.7

[0072] ACTCTAGAGGATCAATTCGTTCCTCTATTCAGCTCCTCTGTT

[0073] SEQ ID NO.8

[0074] ATCCTTGTAATCTCCCATGTTTTCTTTTGCAGATTTTTTCCCCT

Claims

1. Use of the rice TTS1 gene in any of the following: (1) Regulating plant salt tolerance; (2) Cultivating plants with enhanced salt tolerance; (3) Preparation of products for regulating plant salt tolerance; (4) preparing and cultivating plant products with enhanced salt tolerance; The amino acid sequence encoded by the TTS1 gene is shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that The regulation mentioned in (1) is specifically any one of the following: (i) reducing plant salt tolerance by inhibiting or reducing the activity or expression level of the protein encoded by the TTS1 gene; (ii) Reduce plant salt tolerance by knocking out, inhibiting or silencing the expression of the TTS1 gene.

3. The use according to claim 1, characterized in that The adjustment is specifically any one of the following: (a) improving plant salt tolerance by increasing the activity or expression level of a protein encoded by a TTS1 gene; (b) Improving plant salt tolerance by increasing the expression level of the TTS1 gene.

4. The use according to claim 1, characterized in that The nucleotide sequence of the TTS1 gene is shown in SEQ ID NO.

1.

5. The use according to any one of claims 1 to 4, characterized in that: The plant is a grass plant; Preferably, the grass plant is any one or more of rice, wheat, rye, barley, corn, sorghum and oats.

6. A method for regulating plant salt tolerance, characterized in that: Regulating the expression or activity of the TTS1 gene or its encoded protein; The amino acid sequence encoded by the TTS1 gene is shown in SEQ ID NO.

2.

7. The method according to claim 6, characterized in that The method is selected from any one of the following: (1) downregulating the expression of the TTS1 gene, the expression of the protein encoded by the TTS1 gene, or the activity of the protein encoded by the TTS1 gene, thereby reducing the salt tolerance of plants; (2) Upregulating the expression level of the TTS1 gene, the expression level of the protein encoded by the TTS1 gene, or the activity of the protein encoded by the TTS1 gene, thereby improving the salt tolerance of plants.

8. The method according to claim 7, characterized in that Down-regulating the expression or activity of the TTS1 gene or the protein encoded by it in (1) specifically includes: knocking out or silencing the TTS1 gene in the plant, or inhibiting the activity of the TTS1 protein.

9. The method according to claim 7, characterized in that In (2), the expression level of the TTS1 gene, the expression level of the protein encoded by the TTS1 gene, or the activity of the protein encoded by the TTS1 gene is specifically any one of the following: (a) transferring an expression construct or vector of the TTS1 gene into a plant or plant cell; (b) Transforming the expression construct or vector containing the TTS1 gene into plants or plant cells.

10. A plant breeding method, characterized in that: The method comprises the following steps: introducing a substance that increases or inhibits the expression level of the TTS1 gene, the expression level of the protein encoded by the TTS1 gene, or the activity of the protein encoded by the TTS1 gene into a plant or plant cell to obtain a selected plant; the amino acid sequence encoded by the TTS1 gene is shown in SEQ ID NO.2.

Images