Application of CsWRKY71 gene in increasing branches and yield of camelina sativa

Abstract

The invention discloses application of a CsWRKY71 gene in increasing branches and yield of camelina sativa, and belongs to the technical field of plant genetic engineering. The CsWRKY71 gene is introduced into the camelina sativa, the purpose of increasing the number of camelina sativa branches is successfully achieved, the biomass and yield of the camelina sativa are effectively increased, and an effective method is provided for genetic improvement of the camelina sativa. Meanwhile, the method disclosed by the invention is simple to operate and has a relatively good application prospect.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and particularly relates to a method for increasing the branch number of Camelina sativa (L.) Crantz by overexpressing the WRKY transcription factor CsWRKY71 gene, and application of the gene in increasing the biomass and seed yield of Camelina sativa. Background Art

[0002] Camelina is a new cruciferous oilseed crop with a high seed oil content. The oil is rich in unsaturated fatty acids, such as oleic acid, linoleic acid, and linolenic acid. These unsaturated fatty acids have excellent nutritional and health benefits, making them both edible and medicinal. Camelina oil is also widely used in industry as a high-quality raw material for biodiesel. Furthermore, Camelina exhibits strong stress tolerance, including cold and drought resistance, is tolerant to infertility, and requires low investment. However, Camelina has a weak tillering capacity, typically growing primarily from the main stem. Lateral branches begin to develop from the middle and upper parts of the main stem in mid-growth (before flowering). If tillers do occur, they often develop from axillary buds at the base, forming short secondary stems that generally do not contribute significantly to overall yield. Furthermore, Camelina's weak natural branching ability limits the number of pods produced per plant, resulting in low yield per unit area and limiting its potential for commercial cultivation. While traditional breeding methods can optimize plant type to a certain extent, they are time-consuming, inefficient, and difficult to precisely control branching traits. In contrast, genetic engineering techniques can manipulate target genes with greater precision, offering greater targeting and controllability. Therefore, identifying and utilizing key genes that regulate camelina branch number and improving them through genetic engineering have become an effective approach to addressing camelina yield challenges.

[0003] Transcription factors are proteins that bind to specific DNA sequences in gene promoter regions and regulate gene expression. They play a crucial role in plant growth, development, and responses to the external environment. The WRKY transcription factor family is a plant-specific transcription factor with a wide range of functions in regulating plant growth and development, as well as in responses to environmental stresses.

[0004] Based on this background, and following preliminary screening of this gene family, this patent focuses on identifying the WRKY7 gene in camelina and validating its function. Analysis and research of the camelina genome identified the potential WRKY71 gene. Using homologous recombination technology, a vector containing this gene was constructed and introduced into camelina via Agrobacterium-mediated floral dipping, resulting in transgenic camelina plants. Phenotypic observations and relevant indices of the transgenic plants were performed to verify whether this gene could increase branching and, therefore, seed yield. This provides new genetic resources and technical approaches for improving camelina yield, which has important theoretical and practical significance. Summary of the Invention

[0005] Purpose of the invention: The technical problem to be solved by the present invention is to provide a method for increasing the number of branches, biomass and seed yield of camelina, so as to solve the problem of low yield caused by weak branching ability of camelina.

[0006] Technical solution: To solve the above technical problems, the present invention adopts the following technical solution:

[0007] Application of the CsWRKY71 gene in increasing branching and yield of Camelina sativa. The amino acid sequence of the CsWRKY71 gene is shown in SEQ ID NO.1.

[0008] Application of an overexpression vector containing the CsWRKY71 gene in increasing the branching and yield of Camelina sativa, wherein the amino acid sequence of the CsWRKY71 gene is shown in SEQ ID NO.1.

[0009] Wherein, the overexpression vector contains the CaMV35S (short) promoter, and the gene sequence of the CaMV35S (short) promoter is shown in SEQ ID NO.2.

[0010] Furthermore, the overexpression vector is constructed as follows:

[0011] (1) The CaMV35S(short) promoter fragment was ligated to the CsWRKY71 gene coding region to construct a CaMV35S(short)::CsWRKY71 expression cassette;

[0012] (2) The CaMV35S(short)::CsWRKY71 expression cassette was inserted into the pPBV[Exp]-Backbone vector to obtain the pPBV[Exp]-Hygro-CaMV35S(short)::CsWRKY71 recombinant vector.

[0013] The invention discloses an application of a recombinant bacterium containing the CsWRKY71 gene in increasing the branching and yield of camelina. The recombinant bacterium containing the CsWRKY71 gene is obtained by introducing the pPBV[Exp]-Hygro-CaMV35S(short)::CsWRKY71 recombinant vector into Agrobacterium GV3101.

[0014] A method for increasing camelina branching and yield by overexpressing the CsWRKY71 gene comprises infecting wild-type camelina with a recombinant bacterium containing the CsWRKY71 gene to obtain camelina overexpressing the CsWRKY71 gene, wherein the amino acid sequence of the CsWRKY71 gene is shown in SEQ ID NO.1.

[0015] This patent uses the CsWRKY71 gene sequence of Camelina sativa to clone the CsWRKY71 gene cDNA from leaves. The pPBV plant expression vector is selected, and the CsWRKY71 gene is inserted into the plant expression vector using homologous recombination technology. The vector is identified by enzyme digestion to determine whether it is connected. The constructed recombinant vector is introduced into Agrobacterium GV3101 using the freeze-thaw method, and the bacterial solution is spread on a solid culture medium containing the corresponding antibiotics to screen out transgenic Agrobacterium containing the recombinant vector. The transgenic Agrobacterium is infected with Camelina sativa using the floral immersion method, and the Camelina sativa plants that have been treated with floral immersion are cultured until the seeds mature. The seeds are placed in a culture medium containing the corresponding antibiotics, and resistant transgenic seedlings are screened. After the transgenic seedlings are self-pollinated until the F2 generation seeds are obtained, the number of branches, the number of pods per plant, the seed yield, and other indicators of the transgenic Camelina sativa and wild-type Camelina sativa are regularly observed and recorded. The results showed that the number of branches of transgenic camelina was significantly greater than that of wild-type camelina, proving that the CsWRKY71 gene can effectively increase the branching of camelina.

[0016] Beneficial effects:

[0017] During the floral soaking method, by adding 1 / 2 MS, 5% sucrose, and 0.02% Silwet L-77 penetrant and pre-treating in the dark for 24 hours, the conversion efficiency was significantly increased from approximately 5% reported in the literature to 8.3%.

[0018] The present invention successfully increases the number of branches in Camelina by introducing the CsWRKY71 gene into the plant. This increased number of branches helps improve Camelina biomass and yield, providing an effective method for genetic improvement. Furthermore, the method is relatively simple to operate and has promising application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1This is a diagram showing the results of enzyme digestion verification of the CsWRKY71 gene overexpression vector in the embodiment of the present invention, wherein the left side is the original plasmid and the right side is the plasmid after enzyme digestion;

[0020] Figure 2 This is the PCR verification of the CsWRKY71 gene overexpression plant in the embodiment of the present invention, wherein the upper part uses 35S-F / CsWRKY71-R as primers, and the lower part uses Hygr-F / Hygr-R as primers;

[0021] Figure 3 The following are photos of wild-type and CsWRKY71-overexpressing camelina plants throughout their growth period in the examples of the present invention. In the same flower pot, the left side shows the wild-type (WT) plant and the right side shows the overexpression plant (OE);

[0022] Figure 4 This is a graph showing the expression level analysis of CsWRKY71 overexpressed in camelina in an embodiment of the present invention;

[0023] Figure 5 Graph comparing plant height (a), number of branches per plant (b), and number of pods per plant (c) of wild-type and overexpressing camelina in an embodiment of the present invention;

[0024] Figure 6 Graph comparing the seed yield per plant (a), oil content (b), and oil yield per plant (c) of wild-type and overexpressing camelina in the examples of the present invention. DETAILED DESCRIPTION

[0025] The present invention will be further described in detail below with reference to the examples, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, all technical means of the present invention are conventional means in the art, and the methods used can be referred to classic experimental manuals such as "Molecular Cloning Laboratory Manual (4th Edition)" and "Concise Molecular Biology Laboratory Manual"; all reagents and consumables used can be obtained through commercial means.

[0026] 1. Construction of tissue-specific expression vectors

[0027] 1. Amplification of Camelina CsWRKY71 Gene

[0028] Leaves of camelina with good growth and in the budding stage were selected, and RNA was extracted using a plant total RNA extraction kit. The correct bands were verified by agarose gel electrophoresis, and then reverse transcribed into cDNA. The CsWRKY71 gene was amplified by high-fidelity enzyme using primers CsWRKY71-F1 (5′-ATGGATGATCATGTTGAGCAACAAGA-3′) and CsWRKY71-R1 (5′-TCAAGATTCGTGCTTCAAGAGCATT-3′).

[0029] 2. Promoter Cloning

[0030] The pUp-CaMV35S_short promoter vector required in the present invention is already available in the laboratory. CaMV35S is a strong constitutive promoter commonly used in plants, which can drive high-level gene expression in most dicotyledonous plants (including Camelina serrata of the Cruciferae family).

[0031] 3. Construction of recombinant expression vector

[0032] Using Gateway cloning technology, the CaMV35S(short) promoter fragment was ligated to the CsWRKY71 gene coding region to construct a CaMV35S(short)::CsWRKY71 expression cassette. This expression cassette was then inserted into the binary vector pPBV[Exp]-Backbone, which contains the Hygro resistance selection marker gene. Primers with Gateway linker sequences: pD-PF (5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTGCCACC ATGGATGGCCATGTTGAGCACAA -3′),pD-PR(5′-GGGGACCACTTTGTACAAGAAAGCTGGGT TCAAGATTCGTGCTTCAAGAAC The correctness of the recombinant vector was verified by restriction endonuclease (ApaLI+NheI) digestion and sequencing.

[0033] 2. Agrobacterium-mediated floral dip transformation

[0034] 1. Preparation of Agrobacterium Competent Cells

[0035] Agrobacterium GV3101 was inoculated into YEB liquid medium containing rifampicin (50 μg / mL) and cultured at 28°C with shaking until the OD 600 = approximately 0.8. Chill the bacterial solution on ice for 30 minutes, then centrifuge at 5000 rpm for 10 minutes at 4°C to collect the cells. Resuspend the cells in pre-chilled 10% glycerol and repeat the centrifugation wash three times. Finally, resuspend the cells in an appropriate amount of 10% glycerol to prepare competent cells. Store at -80°C until ready for use.

[0036] 2. Transformation of Agrobacterium with Recombinant Vector

[0037] The recombinant vector pPBV[Exp]-Hygro-CaMV35S(short)::CsWRKY71 was introduced into Agrobacterium tumefaciens GV3101 competent cells using the freeze-thaw transformation method. The specific operation was as follows: ice bath for 30 minutes, liquid nitrogen for 5 minutes, 37°C water bath for 5 minutes, and ice bath for 5 minutes. Immediately after freeze-thaw, 700μL YEB liquid medium was added and cultured with shaking at 28°C for 2-3 hours. The bacterial liquid was spread on YEB solid medium containing rifampicin (20μg / mL) and kanamycin (50μg / mL), cultured at 28°C for 2-3 days, and single colonies were picked for PCR verification.

[0038] 3. Transformation of Camelina by Flower Dipping Method

[0039] The verified single colony of Agrobacterium was inoculated into YEB liquid medium containing rifampicin (20 μg / mL) and kanamycin (50 μg / mL) and cultured with shaking at 28°C until OD 600 = 0.8. Centrifuge at 4°C, 5000 rpm for 10 min to collect the cells, resuspend them in an osmotic medium containing 1 / 2MS, 5% sucrose, and 0.02% Silwet L-77, and adjust the OD 600 Select camelina plants in the budding stage and water them thoroughly the day before treatment. Remove fully opened flowers with tweezers and immerse the entire inflorescence in the Agrobacterium solution for 60 seconds, stirring gently. Wrap the treated plants in a black plastic bag and maintain a relative humidity of >85%. After 24 hours of darkness, incubate under normal light conditions.

[0040] 3. Screening and identification of transgenic plants

[0041] 1. T1 generation seed screening

[0042] Harvest camelina seeds after flower soaking treatment, soak the seeds in 0.1% Hygro solution for 2-3 hours, then rinse with clean water, sow on filter paper containing 0.1% Hygro, select positive seedlings that can grow normally, and transplant them into flower pots for further cultivation.

[0043] 2. Molecular Identification

[0044] Genomic DNA was extracted from positive seedlings, and PCR was used to identify whether the CsWRKY71 gene had integrated into the Camelina genome. Primers were designed: 35S-F (5′-AATCCCACTATCCTTCGC-3′), CsWRKY71-R (5′-CCTCCATTCGGTCACTCT-3′), and Hygr-F (5′-CTTCTGCGGGCGATTTGT-3′), Hygr-R (5′-GCCGTGGTTGGCTTGTATG-3′). The reaction conditions were: pre-denaturation at 95°C for 5 min, followed by 30 cycles of denaturation at 95°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 1 min, followed by extension at 72°C for 10 min.

[0045] 3. F2 generation homozygote screening

[0046] The T1 generation positive plants were self-pollinated to obtain F2 generation seeds. The F2 generation seeds were sown, and the plant genomic DNA was extracted and PCR identification was performed. Homozygous transgenic plants were screened for subsequent phenotypic analysis and functional verification.

[0047] 1. Determination of morphological indicators

[0048] When camelina plants reached maturity, morphological indicators such as the number of branches per plant, plant height, and number of pods per plant were measured for transgenic and wild-type plants. The results showed that although the plant height of the overexpressing camelina plants was lower than that of the wild-type plants, the number of branches per plant was significantly higher than that of the wild-type plants.

[0049] 2. Determination of yield-related indicators

[0050] Mature camelina plants were harvested and yield-related indicators such as seed yield per plant, oil content, and oil yield were calculated. The results showed that although the transgenic plants did not show an increase in plant height or oil content, they did show a significant increase in the number of branches, number of pods per plant, seed yield, and oil yield.

[0051] 3. Gene Expression Analysis

[0052] Total RNA was extracted from leaves of transgenic and wild-type plants and reverse-transcribed into cDNA. The expression level of the CsWRKY71 gene was analyzed by qRT-PCR using primers designed as qRT-CsWRKY71-F (5′-GAACCGTGACCGCTGAA-3′) and qRT-CsWRKY71-R (5′-TAATTGGCCGGAGGATG-3′). The Camelina sativa PP2A gene was used as an internal reference gene using primers designed as PP2A-F (5′-GTCAACAATCCGCACTACCTACA-3′) and PP2A-R (5′-CAACCACGACGGGAAGAAAC-3′). Three biological replicates and three technical replicates were used for each sample. The results showed that CsWRKY71 gene expression was significantly elevated in transgenic plants.

[0053] In summary, this patent elaborates on the complete implementation process from the cloning and functional verification of the CsWRKY71 gene of camelina, to the construction of tissue-specific expression vectors, Agrobacterium transformation and optimization of the floral dipping method, to the screening and identification of transgenic plants, as well as phenotypic analysis and yield evaluation. Through rigorous experimental design and operation, the precise expression and regulation of the CsWRKY71 gene in camelina were successfully achieved, which significantly increased the number of branches of camelina, effectively improved the yield of camelina, and ensured the stability of seed quality. Compared with traditional methods, the present invention shows significant advantages in transformation efficiency, screening cycle and yield improvement, and has good environmental adaptability and biosafety. These implementation methods provide a practical technical solution for the genetic improvement of camelina, which is expected to play an important role in agricultural production and promote the development of the camelina industry. At the same time, the data of each embodiment provide strong support for the effectiveness and innovation of the technology, fully demonstrating the huge potential of this patent in practical applications.

Claims

1. Application of the CsWRKY71 gene in increasing the branching and yield of camelina, characterized in that: The amino acid sequence of the CsWRKY71 gene is shown in SEQ ID NO.

1.

2. Use of an overexpression vector containing the CsWRKY71 gene in increasing the branching and yield of camelina, characterized in that: The amino acid sequence of the CsWRKY71 gene is shown in SEQ ID NO.

1.

3. The use according to claim 2, characterized in that The overexpression vector contains the CaMV35S (short) promoter, and the gene sequence of the CaMV35S (short) promoter is shown in SEQ ID NO.

2.

4. The use according to claim 2, characterized in that The construction method of the overexpression vector is as follows: (1) The CaMV35S(short) promoter fragment was ligated to the CsWRKY71 gene coding region to construct a CaMV35S(short)::CsWRKY71 expression cassette; (2) The CaMV35S(short)::CsWRKY71 expression cassette was inserted into the pPBV[Exp]-Backbone vector to obtain the pPBV[Exp]-Hygro-CaMV35S(short)::CsWRKY71 recombinant vector.

5. Use of a recombinant bacterium containing the CsWRKY71 gene in increasing the branching and yield of camelina, characterized in that: The recombinant bacteria containing the CsWRKY71 gene are obtained by introducing the pPBV[Exp]-Hygro-CaMV35S(short)::CsWRKY71 recombinant vector into Agrobacterium GV3101.

6. A method for increasing camelina branching and yield by overexpressing the CsWRKY71 gene, characterized in that: The wild-type camelina was infected with the recombinant bacteria containing the CsWRKY71 gene to obtain camelina overexpressing the CsWRKY71 gene. The amino acid sequence of the CsWRKY71 gene is shown in SEQ ID NO.

1.

7. The method for increasing camelina branching and yield by overexpressing the CsWRKY71 gene according to claim 6, characterized in that: Agrobacterium containing the CsWRKY71 gene was inoculated into YEB liquid medium containing rifampicin and kanamycin and cultured until OD 600 =0.8, collect the cells by centrifugation, resuspend the cells in osmotic medium, and adjust the OD 600 to 0.6; select Camelina plants in the budding stage, remove fully opened flowers, immerse the entire inflorescence in Agrobacterium solution for 60 seconds, and stir gently; the treated plants are first treated in the dark for 24 hours, and then cultured under normal light; harvest Camelina seeds after flower immersion treatment, self-pollinate T1 generation positive plants to obtain F2 generation seeds, sow F2 generation seeds, screen homozygous transgenic plants, and obtain Camelina overexpressing the CsWRKY71 gene.

8. The method for increasing camelina branching and yield by overexpressing the CsWRKY71 gene according to claim 7, characterized in that: The osmotic culture medium contains 1 / 2MS, 5% sucrose, and 0.02% Silwet L-77.

Images