Low-immunogenicity iPSC cell based on B2M gene knockout and HLA-E fusion protein knockin as well as preparation method and application of low-immunogenicity iPSC cell

Abstract

The invention discloses a low-immunogenicity iPSC cell based on B2M gene knockout and HLA-E fusion protein knockin as well as a preparation method and application of the low-immunogenicity iPSC cell. According to the invention, a double-stranded DNA template containing HLA-E fusion protein is knocked into a B2M gene knockout site in a targeted manner, and meanwhile, a B2M signal peptide coding sequence is reserved. The double-stranded DNA template of the HLA-E fusion protein sequentially comprises a B2M left homologous arm, a CW3 enhancer, a G4S joint, a B2M non-signal peptide, a G4S joint, an HLA-E non-signal peptide, a bGH polyadenylic acid signal and a B2M right homologous arm from upstream to downstream. The sequence of a left homologous arm of the B2M is SEQ ID NO: 12; the sequence of the CW3 enhancer is SEQ ID NO: 13; the sequences of the two discontinuous G4S joints are both SEQ ID NO: 14; the sequence of the B2M signal-free peptide is SEQ ID NO: 15; the sequence of the HLA-E non-signal peptide is SEQ ID NO: 16; the sequence of a bGH polyadenylic acid signal is SEQ ID NO: 17; and the sequence of the right homologous arm of the B2M is SEQ ID NO: 18. The left homologous arm and the right homologous arm are used for determining the position of a double-stranded DNA template, the DNA of the left homologous arm is homologous with the 5'end sequence of a targeted DNA incision through fixed-point knock-in, and the DNA of the right homologous arm is homologous with the 3 'end sequence of the DNA incision.

Description

Technical Field

[0001] The present invention relates to the intersection of genetic engineering and cell biology technologies, and in particular to a low-immunogenic iPSC cell based on B2M gene knockout and HLA-E fusion protein knock-in, as well as a preparation method and application thereof. Background Art

[0002] Cell therapy is an innovative medical approach that uses in vitro culture of normal cells or induced differentiation of stem cells to generate large numbers of healthy, functional cells for tissue and organ repair. Stem cells have become a focal point in regenerative medicine due to their unique self-renewal and multipotential differentiation abilities, potentially transforming into cells of various tissues and organs within the human body. Induced pluripotent stem cells (iPSCs) are derived from mature somatic cells through the induction and reprogramming of specific factors. They possess multipotential differentiation and continuous self-renewal properties similar to embryonic stem cells. The generation of iPSCs is relatively simple and stable, and avoids the use of embryonic or oocyte cells. This not only offers ethical advantages but also expands the source of stem cells, making it possible for more patients to access the stem cells they need. Currently, iPSC-based cell therapy has shown great potential and growing application value in the treatment of a variety of diseases, including macular degeneration, heart failure, Parkinson's disease, and spinal cord injury.

[0003] Although many advances have been made in the field of iPSC research, there is still no good solution to its immune rejection problem. Autologous cell therapy can avoid the problem of immune rejection, but it has the problems of high cost and long preparation cycle, and the treatment effect may be affected by individual differences. Allogeneic cell therapy can reduce the immunogenicity of allogeneic cells through immunosuppressive drugs, HLA matching and gene editing. However, long-term use of immunosuppressive drugs has side effects. The establishment and maintenance costs of HLA-matched iPSC libraries are high, and they can provide matches for specific populations, but they cannot cover most people.

[0004] The human major histocompatibility complex (MHC), also known as human leukocyte antigens (HLA), is the primary cause of immune rejection. The HLA system consists of multiple gene groups, divided into class I, class II, and class III genes. Class I MHC genes are expressed on the surface of nearly all cells in the body. If transplanted cells express class I MHC molecules that differ from those of the host, they activate CD8+ T cells, leading to their elimination. Class II MHC genes are primarily expressed on antigen-presenting cells. When CD4+ T cells recognize non-self class II MHC molecules, immune rejection is triggered. Although class III genes are not directly involved in immune recognition, they play a role in inflammatory responses. In recent years, gene editing techniques, such as knocking out key genes such as B2M and CIITA, have successfully reduced the expression of MHC-I and MHC-II on the cell surface or the expression of their genes. This helps cells evade specific recognition by T and B cells, thereby enhancing their immune tolerance or immune escape capabilities.

[0005] In addition, HLA molecules are the main inhibitory ligands of natural killer (NK) cells, but MHC-I negative cells are more susceptible to NK cell attack. Therefore, in order to create universal donor cells that can circumvent the immune system response, existing methods need to be improved. Studies have reported that by destroying the expression of MHC-I and MHC-II class genes and making cells express non-classical HLA-I class molecules such as HLA-E / G, or expressing immunosuppressive checkpoint proteins such as PD-L1, CTLA4-Ig, CD47, and CD24, the killing effect of NK cells can be effectively evaded. 7 . However, problems with existing gene insertion methods include but are not limited to: low insertion efficiency, randomness of insertion positions, complexity of the multi-step editing process, and the increased risk of mutation during multiple cell passages. In addition, when introducing artificial promoters or specific genomic regions into stem cells, the promoter or inserted gene may lose its activity during cell amplification, passage, reprogramming, differentiation or dedifferentiation, resulting in silencing of the introduced gene expression. Therefore, in order to ensure that genetically engineered immune cells can respond continuously and effectively in therapeutic applications while ensuring safety, it is particularly important to identify the best genome editing methods, integration sites, promoters and other key factors. Summary of the Invention

[0006] In view of the defects of the prior art, the purpose of the present invention is to provide a low-immunogenic iPSC cell based on B2M gene knockout and HLA-E fusion protein knock-in, as well as a preparation method and application thereof.

[0007] In a first aspect, the present invention provides a double-stranded DNA template for targeted knock-in of an HLA-E fusion protein at a B2M gene knockout site, wherein the double-stranded DNA template comprises, from upstream to downstream, a B2M left homology arm, a CW3 enhancer, a G4S linker, a B2M signal peptide, a G4S linker, an HLA-E signal peptide, a bGH polyadenylation signal, and a B2M right homology arm; wherein the sequence of the B2M left homology arm is SEQ ID NO: 12; the sequence of the CW3 enhancer is SEQ ID NO: 13; the sequences of the two discontinuous G4S linkers are both SEQ ID NO: 14; the sequence of the B2M signal peptide is SEQ ID NO: 15; the sequence of the HLA-E signal peptide is SEQ ID NO: 16; the sequence of the bGH polyadenylation signal is SEQ ID NO: 17; and the sequence of the B2M right homology arm is SEQ ID NO: 18; The left homology arm and the right homology arm are used to determine the position of the double-stranded DNA template. The left homology arm DNA is homologous to the 5' end sequence of the DNA nick targeted by the site-directed knock-in, and the right homology arm is homologous to the 3' end sequence of the DNA nick.

[0008] In a second aspect, the present invention provides a method for preparing low-immunogenic iPSC cells based on B2M gene knockout and HLA-E fusion protein knockin, wherein the preparation method uses CRISPR-Cas9 technology to knock out the B2M gene and knock in the HLA-E fusion protein in iPSC cells, wherein the double-stranded DNA template used for targeted knock-in of the HLA-E fusion protein is as described above; the sgRNA binds to the exon region 1 and the exon region 2 of the B2M gene, and the required sgRNA sequence is designed based on the PAM sequence, i.e., the 20 bases in front of NGG.

[0009] Further preferably, the preparation method comprises the following specific steps: S1. Design sgRNA sequence; S2. Prepare an RNP complex, wherein the RNP complex is composed of Cas9 protein and the sgRNA described in step S1; S3. Preparing a plasmid containing an HLA-E fusion protein, wherein the plasmid includes the aforementioned double-stranded DNA template for targeted knock-in of the HLA-E fusion protein at the B2M gene knockout site; S4. Directly introduce the RNP complex in step S2 and the plasmid containing the HLA-E fusion protein in step S3 into iPSC cells to knock out the B2M gene, retain the B2M signal peptide coding sequence, and simultaneously achieve knock-in of the HLA-E fusion protein, thereby obtaining low immunogenic iPSC cells based on B2M gene knockout and HLA-E fusion protein knock-in.

[0010] S5. The low immunogenicity iPSC cells prepared in step S4 are screened for successfully transfected positive low immunogenicity iPSC cells using a monoclonal cell picking method based on fluorescent antibody labeling, and the successfully transfected positive low immunogenicity iPSC cells are identified for pluripotency.

[0011] More preferably, in step S4, electrotransfection is performed using an electroporator.

[0012] More preferably, the electrotransfection parameters are: iPSC cells 1×10 4 -3×10 4 , Cas9 protein 30-50 pmol, sgRNA 50-100 pmol, and plasmid containing HLA-E fusion protein 1-3 ug.

[0013] Further preferably, in step S5, when fluorescently labeled monoclonal cells are directly picked under a fluorescence microscope for pluripotency identification, PBS is added to disperse the cells.

[0014] In a third aspect, the present invention provides a low immunogenic iPSC cell based on B2M gene knockout and HLA-E fusion protein knock-in, which is prepared according to the above-mentioned method for preparing low immunogenic iPSC cells based on B2M gene knockout and HLA-E fusion protein knock-in.

[0015] The fourth aspect of the present invention provides the use of low-immunogenic iPSC cells based on B2M gene knockout and HLA-E fusion protein knock-in in the preparation of low-immunogenic universal cells and the preparation of products that inhibit immune rejection reactions.

[0016] Compared with the prior art, the present invention has the following beneficial effects: 1. The present invention provides a method for preparing low-immunogenic iPSC cells based on B2M gene knockout and HLA-E fusion protein knock-in. The double-stranded DNA template used for targeted knock-in of the HLA-E fusion protein utilizes an endogenous promoter and signal peptide to drive the expression of the knocked-in HLA-E fusion protein and direct it to the cell membrane, thereby avoiding gene expression interference and cell function changes that may be caused by exogenous promoters.

[0017] 2. The present invention uses immunofluorescence staining combined with live cell culture technology to specifically identify knocked-in HLA-E fusion proteins. Based on the principle of antigen-antibody reaction, fluorescently labeled antibodies directly bind to the target antigen, thereby achieving accurate screening of monoclonal cells. This method does not require the additional introduction of exogenous genes, avoids the gene expression interference and cell function changes that may be caused by exogenous genes, and at the same time improves the accuracy and efficiency of screening, making the screening of monoclonal cells expressing the target gene more direct and efficient.

[0018] 3. The sgRNA for targeted knockout of the B2M gene provided by the present invention binds to exon region 1 and exon region 2 of the B2M gene, and the sgRNA is designed based on the PAM sequence, i.e., the 20 bases in front of NGG. The sgRNA for targeted knockout of the B2M gene provided by the present invention can efficiently knock out the B2M gene, thereby efficiently preparing iPSC cells with low immunogenicity. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Other features, objects and advantages of the present invention will become more apparent upon reading the detailed description of non-limiting embodiments with reference to the following drawings: Figure 1 A diagram showing the structure of a plasmid containing an HLA-E fusion protein provided in an embodiment of the present invention; Figure 2 A schematic diagram of the knockout efficiency of sgRNA (SEQ ID NO: 2) in hiPSC cells after electroporation provided in an embodiment of the present invention; Figure 3 B2M constructed by the embodiment of the present invention KO HLA-E KI - Morphological display of hiPSC monoclonal cells (KO: abbreviation for Knock-Out, meaning knockout; KI: abbreviation for Knock-In, meaning knock-in); Figure 4 B2M provided by the embodiment of the present invention KO HLA-E KI -Schematic diagram of the base editing results of the hiPSC cell monoclone CL30-25 (KO: Knock-Out, meaning knockout; KI: Knock-In, meaning knock-in); Figure 5 B2M provided by the embodiment of the present invention KO HLA-E KI - Schematic diagram of HLA-A / B / C and HLA-E flow cytometry expression results in hiPSC cells (KO: abbreviation for Knock-Out, meaning knockout; KI: abbreviation for Knock-In, meaning knock-in); Figure 6 B2M provided by the first experimental example of the present invention KO HLA-E KI -Schematic diagram of AP staining results of hiPSC cells (KO: abbreviation for Knock-Out, meaning knockout; KI: abbreviation for Knock-In, meaning knock-in); Figure 7 B2M provided by the second experimental example of the present inventionKO HLA-E KI -Schematic diagram of RT-PCR results of hiPSC pluripotency gene expression (KO: abbreviation for Knock-Out, meaning knockout; KI: abbreviation for Knock-In, meaning knock-in); Figure 8 The B2M provided by the third experimental example of the present invention KO HLA-E KI - Schematic diagram of immunofluorescence staining results for pluripotency protein expression in hiPSC cells (KO: abbreviation for Knock-Out, meaning knockout; KI: abbreviation for Knock-In, meaning knock-in); Figure 9 B2M provided by the fourth experimental example of the present invention KO HLA-E KI -Schematic diagram of the results of hiPSC cell anti-NK cell immune response (KO: abbreviation for Knock-Out, meaning knockout; KI: abbreviation for Knock-In, meaning knock-in). DETAILED DESCRIPTION

[0020] The following examples will help those skilled in the art further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that those skilled in the art may make several changes and modifications without departing from the scope of the present invention. These all fall within the scope of protection of the present invention.

[0021] In addition, the technical features involved in the different embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0022] The following examples and experimental examples were performed using conventional instruments and equipment in the art. Experimental methods without specific conditions were generally performed under conventional conditions or according to the manufacturer's recommendations. Unless otherwise specified, all raw materials used were commercially available products with specifications conventional in the art. Sequencing services provided in this invention were provided by GENEWIZ Biotech (Beijing) Co., Ltd.

[0023] The present invention is described in detail below with reference to specific embodiments.

[0024] Example This example provides a low-immunogenic iPSC cell based on B2M gene knockout and HLA-E fusion protein knock-in and a preparation method thereof. The iPSC cell type in this example is preferably hiPSC cell, and the Cas9 protein type is preferably SpCas9 protein. The specific steps of the preparation method are as follows: 1. Design sgRNA sequence (1) Find the target gene information, select the editing region, obtain the gene information on NCBI, enter "species" - Homo, "gene name" - B2M in the Gene interface on the NCBI homepage, click Genebank, download the sequence, and select exon regions 1 and 2.

[0025] (2) Find the PAM sequence, which is the 20 bases before NGG, which is the required sgRNA sequence.

[0026] (3) A total of 10 sgRNAs were designed, and an sgRNA sequence (SEQ ID NO: 11) reported in the literature (Feng L, Chao J, Ye P, Luong Q,Sun G, Liu W, Cui Q, Flores S, Jackson N, Shayento ANH, Sun G, Liu Z, Hu W,Shi Y. Developing Hypoimmunogenic Human iPSC-Derived OligodendrocyteProgenitor Cells as an Off-The-Shelf Cell Therapy for Myelin Disorders. AdvSci (Weinh). 2023 Aug;10(23):e2206910.) was selected as the control group.

[0027] (4) The designed 10 sgRNA sequences and the control group sgRNA sequence are as follows: SEQ ID NO: 1:CTCGCGCTACTCTCTCTTTC; SEQ ID NO: 2: ACTCTCTCTTTCTGGCCTGG; SEQ ID NO: 3:TCACGTCATCCAGCAGAGAA; SEQ ID NO: 4:GAAGTTGACTTACTGAAGAA; SEQ ID NO: 5:TGGAGAGAGAATTGAAAAAG; SEQ ID NO: 6: TTCAGACTTGTCTTTCAGCA; SEQ ID NO: 7:ACTTGTCTTTCAGCAAGGAC; SEQ ID NO: 8:TTTGACTTTCCATTCTCTGC; SEQ ID NO: 9:ACCCAGACACATAGCAATTC; SEQ ID NO: 10:TGGGCTGTGACAAAGTCACA; SEQ ID NO: 11 (control group): CGTGAGTAAACCTGAATCTT.

[0028] 2. Synthesize the sgRNA in step 1, and then connect the sgRNA to the Cas9 protein plasmid vector (with mCherry marker) (the plasmid vector was purchased from Fenghui Bio) The steps are as follows: (1) Synthesis of sgRNA: Primers were synthesized using the solid-phase phosphoramidite triester method. The synthesized primers were purified by PAGE, specifically: the synthesized primers were denatured at 95°C, and then the primer samples were loaded into a polyacrylamide gel containing 7M urea and subjected to denaturing polyacrylamide gel electrophoresis (PAGE) at 600V for 2 hours; after the electrophoresis was completed, the target primer band was cut from the gel and the purified primer was recovered by elution. sgRNA annealing was performed as follows: a) Flash the primers and prepare a 100 μM stock solution in DEPC water.

[0029] b) Prepare the working solution (10 μM): Take 10 μl of the stock solution and 90 μl of DEPC water.

[0030] c) Reaction system (20 μl), see Table 1 for details.

[0031] Table 1. B2M-sgRNA annealing reaction system d) Place in a 95°C water bath for 5 minutes, turn off the switch, and allow the water bath to cool naturally. When connecting, take 2 μl of the 20 μl sample for connection.

[0032] (2) Cas9 protein plasmid transformation a) Thaw 100 μl of DH5α competent cells and the desired plasmid on ice.

[0033] b) Pipette 0.5 μl of target plasmid into 30 μl of competent cell suspension (performed in a clean bench) and incubate on ice for 30 minutes.

[0034] c) Heat shock in a 42°C water bath for 90 seconds, then immediately place on ice for 3 minutes.

[0035] d) Add 500 μl of LB medium (without antibiotics) preheated at 37°C in a clean bench, and then fix it to a shaker at 37°C and 250 rpm for 1 hour.

[0036] e) Divide the transformed bacterial suspension equally into four 50-ml centrifuge tubes containing 15 ml of Amp and LB medium (amphenicol concentration: 100 μg / ml) and culture overnight on a shaking platform for 12 hours.

[0037] f) After overnight culture, if the bacterial solution is turbid, a medium-volume extraction can be performed.

[0038] (3) Cas9 protein plasmid extraction (using the plasmid extraction kit (OMEGA endotoxin-free plasmid extraction) for plasmid extraction) a) Transfer 30 ml of overnight culture to a 50 ml centrifuge tube.

[0039] b) Centrifuge at 4000 x g for 10 minutes at room temperature.

[0040] c) Aspirate the supernatant culture medium. (Wipe away the liquid on the tube wall with a clean paper towel.) d) Add 2.5 mL of Solution I / RNase A and vortex or pipette up and down to completely resuspend the cells. Shake vigorously to remove any clumps. (Note: RNase A must be added to Solution I before use.) e) Add 2.5 ml of Solution II, invert, and gently swirl the tube 10 times to obtain a clear lysate. Incubate at room temperature for 3 minutes, mixing occasionally. (Note: Avoid vigorous mixing, as this can shear chromosomal DNA and reduce plasmid purity; do not allow the lysis reaction to proceed for more than 5 minutes; keep Solution II tightly capped when not in use to prevent acidification by CO2 in the air.) f) Add 1.25 ml of pre-chilled N3 Buffer and gently invert the tube several times to mix until a white, flocculent precipitate forms. Allow to incubate at room temperature for 2 minutes. (The solution must be thoroughly mixed. If the mixture remains viscous and brown, continue mixing until the solution is completely neutralized. Complete neutralization is crucial for achieving high yields.) g) Prepare a filter syringe, pull out the plunger, and place the syringe upright on a suitable test tube rack. Place a centrifuge tube at the lower outlet of the syringe, with the syringe opening facing upward. Immediately pour the lysate into the syringe of the filter. Allow the cell lysate to remain in the syringe for 2 minutes. At this point, white flocs will float on the surface of the lysate. The cell lysate may have flowed out of the filter syringe. Collect the lysate in a new 15mL test tube. Carefully and gently insert the syringe plunger into the syringe, slowly pushing the plunger to allow the lysate to flow into the centrifuge tube. (Alternatively, instead of filtering the precipitated impurities with the filter syringe, you can centrifuge at 4°C, 15,000 x g for 10 minutes to remove the precipitated impurities.) h) Add 0.1 volume of ETR Solution to the filtered lysate, mix thoroughly by inverting the tube 10 times, and then place on ice for 10 minutes. (Note: The lysate may appear cloudy after adding the ETR Solution, but will gradually become clear after being placed on ice.) i) Place the lysate in a 42°C water bath for 5 minutes. The lysate will become turbid again. Centrifuge at 4000 x g for 5 minutes at 25°C. The ETR solution will form a blue color at the bottom of the tube.

[0041] j) Transfer the supernatant to another new 15 mL test tube, add 0.5 times the volume of anhydrous ethanol, gently invert the test tube seven times, and let it stand at room temperature for 2 minutes.

[0042] k) Place the HiBind® DNA Midi binding column into a 15 mL collection tube, transfer 3.5 mL of the mixture obtained in step ⑩ to the HiBind® DNA Midi binding column, centrifuge at 5,000 x g for 3 minutes at room temperature, and discard the filtrate.

[0043] l) Repeat step j) until all the mixed solution obtained in step k) is bound to the HiBind® DNA Midi binding column.

[0044] m) Place the HiBind® DNA Midi Binding Column into the same collection tube, add 3 mL of HBC Buffer to the HiBind® DNA Midi Binding Column, centrifuge at 4000 x g for 3 minutes at room temperature, and discard the filtrate. (Note: HBC Buffer must be diluted with isopropanol according to the instructions before use.) n) Place the HiBind® DNA Midi Binding Column into the same collection tube, add 3.5 mL of DNA Wash Buffer (diluted with anhydrous ethanol), centrifuge at 4,000 x g for 3 minutes at room temperature, and discard the filtrate. (Note: Concentrated DNA Wash Buffer must be diluted with ethanol according to the instructions before use. If the DNA Wash Buffer has been refrigerated before use, it must be removed and brought to room temperature.) o) Repeat step n), insert the HiBind® DNA Midi binding column into the same collection tube, add 3.5 mL DNA Wash Buffer (diluted with anhydrous ethanol), centrifuge at 4,000 x g for 3 minutes at room temperature, and discard the filtrate.

[0045] p) Place the HiBind® DNA Midi Binding Column into the same collection tube and centrifuge at 4000 x g for 10 minutes at room temperature to dry the column matrix. Further dry the column by leaving it uncovered at room temperature for 10 minutes to dry the alcohol.

[0046] q) Place the HiBind® DNA Midi Binding Column in a clean 15 mL centrifuge tube, add 0.5 mL of RNase-free sterile H2O to the column matrix (the amount added depends on the expected final product concentration), and let it stand at room temperature for 3 minutes.

[0047] r) Centrifuge at 4000 x g for 5 min to elute the DNA.

[0048] s) Add the eluted liquid to the column and pass it through the column again, repeating step ⑱ once.

[0049] t) After elution is complete, measure the DNA concentration. Store the DNA product at -20°C. (Note: Steps r)-t) require sterile operation to prevent contamination.) (4) Cas9 protein pellet extraction and enzyme digestion a) Set up a reaction system (20 μl system) for two reactions, two tubes. See Table 2 for details.

[0050] Table 2. Medium-scale extraction plasmid enzyme digestion reaction system b) After mixing, centrifuge at 12000 rpm for 5 min.

[0051] c) Incubate in a 37°C water bath for 3 h.

[0052] (5) Identify the Cas9 protein plasmid by electrophoresis to verify whether the position of the Cas9 protein plasmid enzyme cut in step (4) is correct a) Prepare nucleic acid gel (50 ml of 1% agarose gel).

[0053] b) Weigh 0.5 g of agarose and add 50 ml of 1x TAE.

[0054] c) Microwave on high for 2 min, then add 5 μl of nucleic acid dye (nucleic acid dye: agarose gel ratio of 1:10,000).

[0055] d) Place the comb in place and pour the agarose gel into the gel casting tank, avoiding bubbles.

[0056] e) After the agarose gel solidifies, leave it at room temperature for 20 minutes. Carefully remove the comb, keeping the sample wells intact.

[0057] f) Place the gel and inner tank into the electrophoresis tank and add 1x TAE electrophoresis buffer to cover the gel by 2 mm.

[0058] g) Sample loading: Add the product from step (4) into the wells in the following order: marker: 5ul, undigested sample: 12ul, digested sample: 20ul (one well apart); 110v, 30min.

[0059] h) When the DNA fragments are completely separated, transfer the gel to a UV lamp and cut out the desired DNA fragments as quickly as possible.

[0060] i) Place the sample in a 1.5 ml EP tube and store at 4°C. Perform gel recovery the next day.

[0061] (6) Rubber recycling a) Separate the DNA fragments using 1% agarose gel electrophoresis. Any type or grade of agarose can be used. This application uses fresh TAE buffer as the running buffer. Note: Do not reuse the running buffer, as the increase in pH will reduce the yield. Fresh TBE buffer can also be used, but will produce lower yields.

[0062] b) Once the desired DNA fragments are completely separated, transfer the gel to a UV lamp and excise the desired DNA fragments as quickly as possible. Note: When excising the gel, remove as much excess gel as possible and do not expose the DNA to UV light for more than 30 seconds.

[0063] c) Transfer the gel slice containing the target fragment to a weighed 1.5 mL centrifuge tube and weigh it to determine its weight. Approximately determine its volume. Assuming a density of 1 g / mL (almost all DNA gels can be approximated to have a density of 1 g / mL), the volume of the gel slice can be calculated as follows: if the gel slice weighs 0.2 g, its volume is 0.2 mL. Add an equal volume of XP2 Binding Buffer and incubate in a 60°C water bath for 7 minutes, or until the gel is completely melted, shaking or vortexing the mixture every 2 minutes.

[0064] d) Place a HiBind® DNA Mini binding column in a 2 mL collection tube (the collection tube must be prepared in advance).

[0065] e) Transfer the entire DNA / gel solution from step 3 to a HiBind® DNA Mini binding column. Centrifuge at 10,000 x g for 1 minute at room temperature. Discard the filtrate from the collection tube and place the column back into a 2 mL collection tube.

[0066] f) If the volume of the DNA / gel solution exceeds 700 μl, transfer only 700 μl to the HiBind® DNA Mini Binding Column at a time. Repeat step 5 for the remaining solution until all the solution has passed through the HiBind® DNA Mini Binding Column. Each HiBind® DNA Mini Binding Column has a maximum adsorption capacity of 25 μg DNA. If a larger yield is expected, divide the sample into an appropriate number of HiBind® DNA Mini Binding Columns.

[0067] g) Discard the filtrate from the collection tube and place the HiBind® DNA Mini Binding Column back into the 2 mL collection tube. Transfer 300 μl of XP2 Binding Buffer to the column and centrifuge at maximum speed (13,000 x g) for 1 minute at room temperature. Discard the filtrate.

[0068] h) Place the HiBind® DNA Mini Binding Column back into the 2 mL collection tube. Transfer 700 μl of SPW Buffer (diluted with anhydrous ethanol) to the HiBind® DNA Mini Binding Column. Centrifuge at 10,000 x g for 1 minute at room temperature and discard the filtrate.

[0069] i) Repeat step ⑧ and place the HiBind® DNA Mini Binding Column back into the 2 mL collection tube. Transfer 700 μl of SPW Buffer (diluted with anhydrous ethanol) to the HiBind® DNA Mini Binding Column and centrifuge at 10,000 x g for 1 min at room temperature. Discard the filtrate.

[0070] j) Place the HiBind® DNA Mini Binding Column back into the 2 mL collection tube and centrifuge at 13,000 x g for 2 minutes at room temperature to remove any residual liquid from the HiBind® DNA Mini Binding Column matrix.

[0071] k) Place the HiBind® DNA Mini Binding Column in a clean 1.5 mL centrifuge tube. Add 30 μL (depending on the desired final product concentration) of HO (preheated to 60°C) to the HiBind® DNA Mini Binding Column matrix. Incubate at room temperature for 5 minutes. Centrifuge at 13,000 x g for 1 minute to elute the DNA. The first elution should remove 80% of the bound DNA. Transfer the recovered liquid to the column and re-elute. Performing a second elution will remove any remaining DNA, but the concentration will be lower.

[0072] (7) Connecting sgRNA to Cas9 protein vector a) Ligation system construction (operate on ice). The ligation reaction system is detailed in Table 3.

[0073] Table 3. sgRNA and Cas9 protein plasmid vector ligation reaction system b) After mixing, control the temperature in a PCR instrument and incubate overnight at 16°C to form a plasmid vector. The plasmid structure contains different sgRNA sequences, Cas9 protein sequences, mCherry fluorescent protein sequences, puromycin resistance sequences, and ampicillin resistance sequences. Different sgRNA sequences: Used to guide the Cas9 protein to specifically recognize and cleave the target DNA sequence. Cas9 protein sequence: Encodes the Cas9 nuclease used for gene editing. mCherry fluorescent protein sequence: Used to mark and screen successfully transfected cells. Puromycin resistance sequence: Used to screen cells expressing mCherry fluorescent protein. Ampicillin resistance sequence: Used to screen E. coli colonies containing this plasmid.

[0074] 3. Transfect Hek293A cells with the plasmid containing sgRNA and Cas9 protein in step 2 (1) Inoculation of cells The cells were seeded one day before transfection, and the initial seeding density of Hek293A cells per well in a 6-well plate was 6 × 10 5 Transfection was performed when the confluence reached 80%.

[0075] (2) Preparation of DNA-PEI nucleic acid-transfection reagent complex a) For each well of cells, dilute 1 μg of target DNA in 100 μL of serum-free medium (Opti-MEM:plasmid volume to mass ratio 100:1) and mix thoroughly to prepare DNA diluent. Opti-MEM is recommended as the serum-free diluent.

[0076] b) Immediately add 3 μL of PEI40000 transfection reagent to 100 μL of DNA dilution buffer (transfection reagent volume to plasmid mass ratio 3:1) and mix gently.

[0077] c) Incubate at room temperature for 15 minutes to allow the formation of a DNA-PEI cationic nucleic acid transfection reagent complex.

[0078] (3) Transfected cells No need to change the medium or blow it evenly. Simply add the DNA-PEI nucleic acid-PE1 complex to the cells drop by drop. Shake the culture plate to mix gently. Incubate at 37°C in a 5% CO2 incubator. Change the medium after 6 hours and observe the fluorescence after 48 hours. After 48 hours, the transfected cells will show obvious red fluorescence.

[0079] 4. Use flow cytometry to screen out the mCherry-positive Hek293A cells in step 3 48 hours after transfection, 10,000 positive cells were sorted, and then DNA was extracted and sequenced to analyze the gene editing efficiency.

[0080] Flow cytometry operation: After cell digestion and centrifugation, resuspend the cells in 200ul sterile PSB. Sieve 200ul of cell suspension through a 40um cell sieve into a 1.5ml EP tube or flow cytometry tube. Mix gently and load onto the machine. The receiving solution is 500ul fresh culture medium.

[0081] 5. PCR and Sanger sequencing detection of the knockout efficiency of different sgRNAs selected in step 4 in Hek293A cells (1) Extract DNA from positively expressing cells.

[0082] a) Prepare an appropriate amount of 1x lysis buffer based on the number of samples required, using a ratio of 1:50 proteinase K to 1x mouse tissue lysis buffer.

[0083] b) Add 20 μl of 1x lysis buffer to the cells, vortex, and incubate in a 55°C water bath for 20 min.

[0084] c) After incubation, heat the sample at 95°C or in a boiling water bath for 5 minutes to inactivate proteinase K.

[0085] d) Vortex the lysate thoroughly, centrifuge at 12,000 rpm for 5 minutes, and remove the supernatant for PCR. Alternatively, transfer the supernatant to another sterile EP tube and store at -20°C for at least 3 months.

[0086] (2) PCR experiment a) After 2x TaqPlus MasterMix (DyePlus) is completely thawed, mix by inverting. Prepare the following reaction system on ice (see Table 4).

[0087] Table 4. PCR premix reaction system b) PCR reaction condition settings, see Table 5 Table 5. PCR reaction conditions c) The amplified products were directly detected by agarose gel electrophoresis without adding DNA Loading Buffer.

[0088] d) The target band of electrophoresis was tested for knockout efficiency by Sanger sequencing and analyzed using Synthego to obtain the knockout efficiency of different sequences in Hek293A cells, and screened out sgRNA sequences with high editing efficiency. sgRNAs with different sequences had different knockout efficiencies for the B2M gene, and detailed results are shown in Table 6. Among them, when the sgRNA sequence was SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 10, the average of the two knockout efficiencies was higher, among which SEQ ID NO: 2 had the highest average knockout efficiency of the two times, and SEQ ID NO.2 was more consistent with the position required for insertion of the HLA-E fusion protein. Therefore, in this example, SEQ ID NO: 2 was preferred for subsequent experimental studies.

[0089] Table 6. Knockout efficiency of B2M gene by different sgRNAs 6. The sgRNA (SEQ ID NO: 2) and SpCas9 protein in step 5 are prepared into an RNP complex. In this embodiment, 30-50 pmol of Cas9 protein and 50-100 pmol of sgRNA, preferably 40 pmol of SpCas9 protein and 70 pmol of sgRNA, are used for the subsequent preparation process.

[0090] Here are the steps: SpCas9 protein (40 pmol), sgRNA (70 pmol), and P3 buffer (2.94 μl, P3 buffer purchased from Lonza P3 primary cell transfection kit) were mixed and incubated at 37°C for 10 min to obtain the RNP complex.

[0091] 7. The RNP complex in step 6 and the plasmid containing the HLA-E fusion protein are electroporated into the B2M site of the hiPSC cells to obtain low immunogenic iPSC cells based on B2M gene knockout and HLA-E fusion protein knockin.

[0092] In this example, iPSC cells were 1×10 4 -3×10 4 1-3 μg of plasmid containing HLA-E fusion protein, preferably 2×10 hiPSC cells 4 , 1 ug of plasmid containing HLA-E fusion protein was used for subsequent preparation process.

[0093] In this example, the plasmid containing the HLA-E fusion protein was synthesized by General Biotech. Figure 1As shown, the plasmid contains a double-stranded DNA template for targeted knock-in of an HLA-E fusion protein at the B2M gene knockout site. The double-stranded DNA template includes the B2M left homology arm, the CW3 enhancer, a G4S linker, a B2M signal peptide-free region, a G4S linker, an HLA-E signal peptide-free region, a bGH polyadenylation signal, and a B2M right homology arm. The left and right homology arms are used to determine the position of the double-stranded DNA template. The left homology arm DNA is homologous to the 5' end of the DNA nick targeted for site-specific knock-in, and the right homology arm is homologous to the 3' end of the DNA nick.

[0094] Preferably, SEQ ID NO.12 is the sequence of the left homology arm of B2M, and SEQ ID NO.12 is as follows: Ttaatcttctgggtttccgttttctcgaatgaaaaatgcaggtccgagcagttaactggctggggcaccattagcaagtcacttagcatctctggggccagtctgcaaagcgagggggcagccttaatgtgcctccagcctgaagtcctagaatgagcgcccggtgtcccaagctggggcgcgcaccccagatcggagggcgccgatgtacagacagcaaactcacccagtctagtgcatgccttc ttaaacatcacgagactctaagaaaaggaaactgaaaacgggaaagtccctctctctaacctggcactgcgtcgctggcttggagacaggtgacggtccctgcgggccttgtcctgattggctgggca cgcgtttaatataagtggaggcgtcgcgctggcgggcattcctgaagctgacagcattcgggccgagATGTCTCGCTCCGTGGCCTTAGCTGTGCTCGCGCTACTCTCTCTTTCTGGCCTGGAAGCT; Preferably, SEQ ID NO. 13 is the sequence of the CW3 enhancer, and SEQ ID NO. 13 is as follows: GTCATGGCGCCCCGAACCCTCATCCTG; Preferably, SEQ ID NO. 14 is a sequence of two discontinuous G4S linkers, and SEQ ID NO. 14 is as follows: ggcggcggcggcagcggcggcggcggcagcggcggcggcggcagc; Preferably, SEQ ID NO.15 is the sequence of B2M without signal peptide, and SEQ ID NO.15 is shown as follows: ATCCAGCGTACTCCAAAGATTCAGGTTTACTCACGTCATCCAGCAGAGAATGGAAAGTCAAATTTCCTGAATTGCTATGTGTCTGGGTTTCATCCATCCGACATTGAAGTTGACTTACTGAAGAATGGAGAGAGAATTGAAAAAGTGGAGCATTCAGACTTGTCTTTCAGCAAGGACTGGTCTTTCTATCTCTTGTACTACACTGAATTCACCCCCACTGAAAAAGATGAGTATGCCTGCCGTGTGAACCATGTGACTTTGTCACAGCCCAAGATAGTTAAGTGGGATCGAGACATG; Preferably, SEQ ID NO. 17 is the sequence of the bGH polyadenylation signal, and SEQ ID NO. 17 is as follows: ccgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatggactagtattaattaaatctagaagtcgacagtactaagctt; Preferably, SEQ ID NO. 18 is the sequence of the right homology arm of B2M, and SEQ ID NO. 18 is as follows: ATCCAGCGTGAGTCTCTCCTACCCTCCCGCTCTGGTCCTTCCTCTCCCGCTCTGCACCCTCTGTGGCCCTCGCTGTGCTCTCTCGCTCCGTGACTTCCCTTCTCCAAGTTCTCCTTGGTGGCCCGCCGTGGGGCTAGTCCAGGGCTGGATCTCGGGGAAGCGGCGGGGTGGCCTGGGAGTGGGGAAGGGGGTGCGCACCCGGGACGCGCGCTACTTGCCCCTTTCGGCGGGGAGCAGGGGAGACCT TTGGCCTACGGCGACGGGAGGGTCGGGACAAAGTTTAGGGCGTCGATAAGCGTCAGAGCGCCGAGGTTGGGGGAGGGTTTTCTCTTCCGCTCTTTCGCGGGGCCTCTGGCTCCCCCAGCGCAGCTGGAG TGGGGGACGGGTAGGCTCGTCAAAGGCGCGGCGCTGAGGTTTGTGAACGCGTGGAGGGGCGCTTGGGGTCTGGGGGAGGCGTCGCCCGGGTAAGCCTGTCTGCTGCGGCTCTGCTTCCCTTAGAC.

[0095] The preparation method of low immunogenic iPSC cells based on B2M gene knockout and HLA-E fusion protein knockin is as follows: (1) hiPSC cell digestion, counting, and preparation of electroporation samples a) Remove hiPSC cells (one well of a 6-well plate) from a 37°C, 5% CO2 cell culture incubator and observe the cell confluence under a microscope and record the result. b) When the cells reach 85% confluence as observed under a microscope, remove the supernatant with a pipette, then wash once with 3 ml of DPBS and discard. c) Add 0.7 ml of accutase digestion solution (STEMCELL Technologies) and incubate in a 37°C, 5% CO2 cell culture incubator for 8 minutes; d) Add 2.3 ml of complete medium containing Y27632 (working concentration 10 μM). Gently pipette the cells into single cells and transfer them to a 15 ml centrifuge tube. Take 20 μl of the cell suspension for counting. e) According to the counting results, take the required amount of cells (2×10 4 hiPSC cells) into a new 1.5 ml centrifuge tube and centrifuge at 200g for 5 min at room temperature; f) After centrifugation, discard the supernatant as much as possible and add 15 μl of prepared P3 buffer. Mix thoroughly and then add the transfection components (i.e., the RNP complex from step 6 and 1 μg of plasmid containing the HLA-E fusion protein). Gently pipette to mix thoroughly and then add the mixture to the corresponding electroporation cup to avoid creating bubbles.

[0096] (2) Electroporation a) Place the electroporation cup with the sample added in (1)f into the corresponding position of the Nucleofector X Unit electroporator, select the electroporation program CA-137, and then click "Start". After completion, transfer the electroporation cup to the biosafety cabinet, add 80 μl of warm electroporation medium to each electroporation cup (add DNaseI in advance when the electroporation material contains plasmid, 20 U / test), mix gently, and incubate in a 37°C, 5% CO2 cell culture incubator for 10 minutes; b) Remove the LN521-coated 24-well plate from the incubator, discard the liquid, add 400 μl of warm electroporation medium, and transfer the cell suspension after incubation into the well plate. After cross-mixing, place the cells back into the 37°C / 5% CO2 cell culture incubator to obtain low immunogenic iPSC cells (B2M) based on B2M gene knockout and HLA-E fusion protein knockin. KO HLA-E KI -hiPSC cells).

[0097] c) Extract B2M after 2 days of culture KOHLA-E KI -hiPSC cell genomic DNA, the knockout efficiency of sgRNA (SEQ ID NO: 2) in hiPSC cells was detected by Sanger sequencing. The knockout efficiency results are shown in Figure 2 , the knockout efficiency was 69.3%, indicating that using RNP-mediated gene editing technology to directly introduce the RNP complex and the plasmid containing HLA-E fusion protein into cells can not only achieve a higher editing efficiency, but also significantly reduce the off-target effect and reduce the potential toxicity to cells.

[0098] 8. Pick the B2M prepared above KO HLA-E KI -hiPSC cells were monocloned and then the successfully transfected positive B2M cells were screened based on the fluorescent antibody-labeled monoclonal cell picking method. KO HLA-E KI -hiPSC cells (1) B2M prepared in step 7 KO HLA-E KI -hiPSC cell plating and culture Count the cells in the cell suspension and accurately remove 1000 cells. Plate them evenly in a 6-well plate. Add 3 ml of TeSR-E8 complete medium containing 1× CloneR to each well. Place the 6-well plate in a cell culture incubator. Change the medium every 4 days, discard the old medium, and replace it with 3 ml of fresh TeSR-E8 complete medium containing 1× CloneR. Continue culturing.

[0099] (2) Preparation for monoclonal selection On the 9th day of cell culture, single clones can be picked (operated under a microscope). The morphological results of single clone cells under the microscope are shown in Figure 3 The monoclonal cells formed independent cell clusters with irregular round shapes and clear edges. Their morphological characteristics were consistent with those of typical monoclonal cells. Before picking, TeSR-E8 complete medium containing 1× Clone R should be prepared in advance and added to a 96-well plate. 200 µL of medium was added to each well and set aside.

[0100] (3) Cell loosening treatment Before fluorescent antibody staining, discard the TeSR-E8 medium from the 6-well plate. Add 1 ml of PBS to each well and gently shake the 6-well plate to evenly cover the cells with PBS. Let the cells soak for 2 minutes to slightly loosen the monoclonal cells for easier manipulation.

[0101] (4) Fluorescent antibody incubation To better stain live cells with fluorescent antibodies without affecting cell status, dilute the fluorescent antibodies in TeSR-E8 complete medium. The specific steps are as follows: Pre-incubate with anti-PE HLA-E antibody (BioLegend) at a 1:500 ratio: 1.2 ml of TeSR-E8 complete medium, add 2.4 µL of fluorescently labeled anti-PE HLA-E antibody, mix thoroughly, and then add 1202.4 µL of the mixture to each well of a 6-well plate. Incubate at room temperature in the dark for 30 minutes.

[0102] The fluorescently labeled antibodies used in this example include, but are not limited to, the following: FITC (fluorescein isothiocyanate), PE (phycoerythrin), PE-Cy5, PE-Cy5.APC (allophycocyanin), Cy5, PE.Cu7 Alexa Fluor 647, and other fluorescent markers with similar excitation and emission wavelength characteristics.

[0103] (5) Further loosening of cells After incubation, remove the antibody-containing medium and add 1 ml of PBS to each well. Gently shake the 6-well plate to evenly cover the cells with PBS. Let the cells soak for 5 minutes to further loosen the monoclonal cells and prepare for subsequent picking.

[0104] (6) Monoclonal cell picking After removing the PBS, add 2 ml of fresh TeSR-E8 complete medium to each well. Under a microscope, use a pipette tip to quickly and accurately pick monoclonal cells expressing fluorescent proteins and transfer them to a pre-prepared 96-well plate. Each well contains 200 µL of TeSR-E8 complete medium containing 1× CloneR and continue culturing.

[0105] After 8 days of culture, DNA can be extracted from the cells and amplified by PCR. The samples are then sent for sequencing to detect whether they are monoclonal. Monoclonal CL30-25 (30 B2M cells were picked) KO HLA-E KI -hiPSC cells, take the 25th B2M KO HLA-E KI -hiPSC cells) in the B2M site base editing results are as follows Figure 4 As shown, clone CL30-25 is a base +1 mutation, and the efficiency of base +1 mutation is 98%, indicating that the selected B2M KO HLA-E KI -hiPSC cells have exactly the same genotype, excluding mixed clones, confirming that the clone is a single clone and that the B2M allele has achieved double knockout (double knockout means that both alleles corresponding to a chromosome are knocked out).

[0106] Base +1 mutation: An extra base is added at a specific target site in the DNA sequence, resulting in a frameshift mutation in the base sequence after that position.

[0107] The prepared B2M KO HLA-E KI -After hiPSC cell expansion, flow cytometry was performed to detect HLA-A / B / C molecule expression as follows: B2M KO HLA-E KI -hiPSC monoclonal CL30-25 was digested into a single cell suspension and the cell concentration was adjusted to 1×10 6 cells / ml. Then, the single cell suspension was stained with anti-FITC-HLA-A / B / C antibody (1:200) at 4°C for 30 minutes. The stained cell samples were analyzed by flow cytometry to detect B2M KO HLA-E KI -HLA-A / B / C expression of hiPSC cell line monoclonal CL30-25. B2M KO HLA-E KI -HLA-A / B / C expression of hiPSC cell line monoclonal CL30-25 Figure 5 As shown, B2M KO HLA-E KI -The HLA-A / B / C expression rate of hiPSC cells is only 0.36%. KO HLA-E KI -The FITC fluorescence signal of hiPSC cells was extremely weak, almost equivalent to the background, indicating that B2M KO HLA-E KI -hiPSC cell monoclone CL30-25 does not express HLA-A / B / C. B2M KO HLA-E KI The HLA-E expression positivity rate of the hiPSC cell monoclone CL30-25 was 99.8%, indicating that this cell line has high expression and stability in HLA-E expression.

[0108] This experiment proves that B2M KO HLA-E KI -hiPSC cells do not express HLA-I molecules, indicating that the B2M gene has been successfully knocked out. KO HLA-E KI -hiPSC cells expressed HLA-E molecules, indicating the successful insertion and expression of the HLA-E fusion protein.

[0109] Application Examples In this application example, the low immunogenic iPSC cells (B2M KO HLA-E KI -hiPSC cells), can at least be used to prepare universal cells with low immunogenicity and to prepare products that suppress immune rejection reactions.

[0110] Experimental example Through the following experiments, the B2M KO HLA-E KI -The functionality of hiPSC cells was verified.

[0111] First experimental example AP staining (alkaline phosphatase staining) detection of B2M provided in the example KO HLA-E KI -hiPSC pluripotency (1) WT-hiPSC cells and B2M cells provided in the examples were used KO HLA-E KI After hiPSC cells were cultured to a confluence of 60%, the culture medium was discarded and the cells were washed twice with PBS for 5 seconds each time; (2) Fix the cells with 4% neutral formaldehyde fixative at room temperature for 15 minutes; (3) After fixation, rinse with PBS buffer three times, 5 minutes each time; (4) Use AP staining reagent for staining. The AP staining results are as follows Figure 6 As shown, WT-hiPSC cells and B2M KO HLA-E KI -hiPSC cells showed obvious blue-purple after staining, which indicates that there is high AP enzyme activity in the cells. AP activity is an important marker of pluripotent stem cells. The results show that the preparation method provided by the present invention can effectively maintain the pluripotency homeostasis of hiPSC during the gene editing process, and the B2M obtained by the preparation method provided by the present invention KO HLA-E KI -hiPSC cells can express high levels of alkaline phosphatase, indicating that they are in an undifferentiated state and have the characteristics of pluripotent stem cells.

[0112] WT-hiPSC cells: refers to hiPSC cells that have not undergone gene editing; B2M KO HLA-E KI -hiPSC cell line: refers to a cell line in which the B2M gene of hiPSC cells is knocked out and the HLA-E fusion protein is knocked in.

[0113] Second experimental example RT-PCR (reverse transcription polymerase chain reaction) detection of B2M provided in the example KO HLA-E KI -hiPSC cell pluripotency gene expression (1) WT-hiPSC cells and B2M cells provided in the examples were extracted using the TRIzol method. KO HLA-E KI -Total RNA of hiPSC cells; (2) Reverse transcription of the extracted RNA into cDNA; (3) PCR amplification was performed using SOX2, OCT4, NANOG, LIN28A primers and ACTB as an internal control.

[0114] (4) PCR products were analyzed by agarose gel electrophoresis. WT-hiPSC cells and B2M KO HLA-E KI -RT-PCR results of pluripotency gene expression in hiPSC cell lines Figure 7 As shown, SOX2, OCT4, NANOG and LIN28A pluripotency genes were expressed in WT-hiPSC cells and B2M KO HLA-E KI -hiPSC cell lines have clear bands, and compared with the internal reference ACTB band, it can be seen that its expression is normal. The results show that the preparation method provided by the present invention can effectively maintain the stability of hiPSC cell transcription levels during gene editing. This experiment proves that B2M KO HLA-E KI -hiPSC cell lines can express pluripotency markers SOX2, OCT4, NANOG and LIN28A at the transcriptional level, indicating that they are in an undifferentiated state and have the characteristics of pluripotent stem cells.

[0115] WT-hiPSC cells: refers to hiPSC cells that have not undergone gene editing; B2M KO HLA-E KI -hiPSC cell line: refers to a cell line in which the B2M gene of hiPSC cells is knocked out and the HLA-E fusion protein is knocked in.

[0116] The third experimental example Immunofluorescence detection of B2M provided in the embodiment KO HLA-E KI -hiPSC cell pluripotency protein expression (1) First, B2M KO HLA-E KI-hiPSC cells were cultured until the cell confluence reached 60%, the culture medium was discarded, and the cells were washed twice with PBS; (2) Fix the cells with 4% neutral formaldehyde fixative at room temperature for 15 minutes; (3) After fixation, rinse with PBS buffer three times, 5 minutes each time; (4) Permeabilization with Triton™ X-100 for 15 minutes at room temperature; (5) Block with 5% goat serum at room temperature for 30 minutes; (6) Incubate with primary antibodies specific for pluripotency markers, namely anti-SOX2, anti-OCT4, and anti-NANOG antibodies, at 4°C overnight; (7) Incubate with fluorescently labeled secondary antibodies, followed by nuclear staining with DAPI; (8) Finally, the slides were sealed with anti-fluorescence attenuation sealing medium and observed and photographed under a fluorescence microscope. KO HLA-E KI -The immunofluorescence results of pluripotency proteins in hiPSC cell lines are as follows Figure 8 As shown in the figure, the fluorescence signals of SOX2, OCT4 and NANOG proteins can be clearly observed in the cells. These fluorescence signals are mainly concentrated in the cell nucleus, which is highly consistent with the position of the cell nucleus stained by DAPI, indicating that these pluripotency proteins have a high expression level in the cell nucleus. This further confirms that B2M KO HLA-E KI -hiPSC cell lines have good pluripotency, indicating that B2M KO HLA-E KI -hiPSC cell lines also maintain the pluripotent state at the protein expression level.

[0117] This experiment proves that B2M KO HLA-E KI -hiPSC cell lines can express the pluripotency markers SOX2, OCT4, and NANOG at the protein level, indicating that they are in an undifferentiated state and have the characteristics of pluripotent stem cells.

[0118] WT-hiPSC cells: refers to hiPSC cells that have not undergone gene editing; B2M KO HLA-E KI -hiPSC cell line: refers to a cell line in which the B2M gene of hiPSC cells is knocked out and the HLA-E fusion protein is knocked in.

[0119] Fourth Experimental Example B2M provided by the detection embodiment KOHLA-E KI - Anti-NK cell immune response of hiPSC cells Cultured WT-hiPSCs (WT), B2M KO -hiPSC (BKO) and B2M KO HLA-E KI -hiPSC (EKI) cells at 2x10 4 Cells were plated at a high density in a 96-well plate. After 48 hours of culture, PBNK cells were added at an effector-target ratio of 3:1 / 5:1. A control group (CON) without PBNK cells was also established. Supernatant was collected 12 hours later and assayed for LDH activity. Higher LDH values ​​indicate increased cell death. Figure 9 The results showed that WT-hiPSC, B2M KO hiPSCs and B2M KO HLA-E KI -LDH activity values ​​of hiPSC cell lines co-cultured with PBNK cells at different target-effector ratios (1:3 and 1:5). Figure 9 The results showed that when the effector-target ratio was 3:1 and 5:1, B2M KO -hiPSCs have a higher LDH value, which means they are killed by PBNK cells and have a high mortality rate; KO Compared with the hiPSC group, B2M KO HLA-E KI -The LDH value of hiPSCs was significantly reduced, indicating that the constructed B2M KO HLA-E KI -hiPSC cell line successfully escaped NK cell killing.

[0120] This experiment proves that B2M KO HLA-E KI -hiPSC cell lines can effectively escape the killing response of natural killer (NK) cells and exhibit significantly low immunogenicity, providing strong guarantees for the safety and effectiveness of cell therapy.

[0121] CON: refers to WT-hiPSC / B2M KO -hiPSC / B2M KO HLA-E KI -NK cells were not added to hiPSC cells; WT-hiPSC (WT): refers to hiPSC cells that have not undergone gene editing and have been added with NK cells; B2M KO -hiPSC (BKO): refers to reference B2M KO HLA-E KI- Method for preparing hiPSC cells, knocking out the B2M gene of hiPSC cells but not knocking in the HLA-E fusion protein, and KO - Addition of NK cells to hiPSC cells; B2M KO HLA-E KI -hiPSC (EKI): refers to a cell line in which the B2M gene of hiPSC cells is knocked out and the HLA-E fusion protein is knocked in at the same time. KO HLA-E KI -NK cells were added to hiPSC cells.

[0122] The above describes specific embodiments of the present invention. It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art may make various changes or modifications within the scope of the claims, which do not affect the essence of the present invention. The embodiments of this application and the features in the embodiments may be combined with each other in any manner unless there is a conflict.

Claims

1. A double-stranded DNA template for targeted knock-in of an HLA-E fusion protein at a B2M gene knockout site, characterized in that: The double-stranded DNA template includes, from upstream to downstream, a B2M left homology arm, a CW3 enhancer, a G4S linker, a B2M signal peptide-free arm, a G4S linker, an HLA-E signal peptide-free arm, a bGH polyadenylation signal, and a B2M right homology arm; wherein the sequence of the B2M left homology arm is SEQ ID NO: 12; the sequence of the CW3 enhancer is SEQ ID NO: 13; the sequences of the two discontinuous G4S linkers are both SEQ ID NO: 14; the sequence of the B2M signal peptide-free arm is SEQ ID NO: 15; the sequence of the HLA-E signal peptide-free arm is SEQ ID NO: 16; the sequence of the bGH polyadenylation signal is SEQ ID NO: 17; the sequence of the B2M right homology arm is SEQ ID NO:18; The left homology arm and the right homology arm are used to determine the position of the double-stranded DNA template. The left homology arm DNA is homologous to the 5' end sequence of the DNA nick targeted by the site-directed knock-in, and the right homology arm is homologous to the 3' end sequence of the DNA nick.

2. A method for preparing low-immunogenic iPSC cells based on B2M gene knockout and HLA-E fusion protein knock-in, characterized in that: The preparation method uses CRISPR-Cas9 technology to knock out the B2M gene in iPSC cells while retaining the B2M signal peptide coding sequence, and simultaneously knocking in the HLA-E fusion protein, wherein the double-stranded DNA template used for targeted knock-in of the HLA-E fusion protein is as described in claim 1; the sgRNA binds to exon region 1 and exon region 2 of the B2M gene, and the required sgRNA sequence is designed based on the PAM sequence, i.e., the 20 bases in front of NGG.

3. The method for preparing low-immunogenic iPSC cells based on B2M gene knockout and HLA-E fusion protein knock-in according to claim 2, characterized in that: The specific steps of the preparation method are as follows: S1. Design sgRNA sequence; S2. Prepare an RNP complex, wherein the RNP complex is composed of Cas9 protein and the sgRNA described in step S1; S3. Preparing a plasmid containing an HLA-E fusion protein, wherein the plasmid comprises the double-stranded DNA template for targeted knock-in of an HLA-E fusion protein at the B2M gene knockout site according to claim 1; S4. Directly introducing the RNP complex from step S2 and the HLA-E plasmid from step S3 into iPSC cells to knock out the B2M gene and simultaneously knock in the HLA-E fusion protein, thereby obtaining low-immunogenic iPSC cells based on B2M gene knockout and HLA-E fusion protein knock-in; S5. The low immunogenicity iPSC cells prepared in step S4 are screened for successfully transfected positive low immunogenicity iPSC cells using a monoclonal cell picking method based on fluorescent antibody labeling, and the successfully transfected positive low immunogenicity iPSC cells are identified for pluripotency.

4. The method for preparing low-immunogenic iPSC cells based on B2M gene knockout and HLA-E fusion protein knock-in according to claim 3, characterized in that: In step S4, electrotransfection is performed using an electroporator.

5. The method for preparing low immunogenic iPSC cells based on B2M gene knockout and HLA-E fusion protein knock-in according to claim 4, characterized in that: The electroporation parameters are as follows: iPSC cells 1×10 4 -3×10 4 , Cas9 protein 30-50 pmol, sgRNA 50-100 pmol, and plasmid containing HLA-E fusion protein 1-3 ug.

6. The method for preparing low-immunogenic iPSC cells based on B2M gene knockout and HLA-E fusion protein knock-in according to claim 3, characterized in that: In step S5, when fluorescently labeled monoclonal cells are directly picked under a fluorescence microscope for pluripotency identification, PBS is added to disperse the cells.

7. A low immunogenic iPSC cell based on B2M gene knockout and HLA-E fusion protein knock-in, characterized in that: The low immunogenic iPSC cell is prepared according to the method for preparing low immunogenic iPSC cells based on B2M gene knockout and HLA-E fusion protein knockin as described in any one of claims 2 to 6.

8. The low immunogenic iPSC cell based on B2M gene knockout and HLA-E fusion protein knock-in according to claim 7 has at least the following applications: a. Application in the preparation of universal cells with low immunogenicity; b. Application in the preparation of products for suppressing immune rejection reactions.

Images