A method for creating a polyploid fish by knocking out rnf212b gene

Abstract

This invention discloses a method for knocking out rnf212b The method of creating polyploid fish through genetic engineering falls under the field of animal genetics and breeding. This involves using the CRISPR / Cas9 system to genetically engineer zebrafish. rnf212b Genes are edited and obtained through genotyping and selective breeding. rnf212b Homozygous knockout individuals, utilizing rnf212b By knocking out the characteristic of homozygous diploid females to produce non-reducing eggs, 100% genetically controllable triploid offspring can be obtained. This invention provides more gene editing targets for the artificial creation of polyploid fish, which is beneficial to improving gene editing efficiency and accelerating the sustainable development of aquaculture.

Description

Technical Field

[0001] This invention belongs to the field of animal genetics and breeding, and relates to a method for creating polyploid fish through gene editing. Background Technology

[0002] Polyploid fish, compared to diploid fish, possess advantages such as faster growth, larger size, and stronger resistance to adverse conditions, demonstrating excellent industrial and application value. Furthermore, the sterility of triploid fish can effectively control the germplasm resources of farmed fish, preventing overbreeding and protecting natural germplasm resources from contamination. Therefore, the creation of polyploid fish is of great significance to the sustainable development of aquaculture.

[0003] The artificial creation of polyploid fish has always been a research hotspot. Currently, the mainstream methods for creating polyploid fish include artificial induction and distant hybridization. Artificial induction of polyploidy includes temperature shock, hydrostatic treatment, and chemical treatment. Temperature shock and hydrostatic treatment both inhibit spindle formation to double the chromosome number, while chemical treatment uses reagents such as colchicine to achieve chromosome doubling. Distant hybridization involves crossing two different fish species; the hybrid offspring have the ability to produce unreduced gametes. Although there are many methods for inducing polyploidy, they all suffer from low induction rates, high embryonic malformation rates, and low larval survival rates, which severely restricts the large-scale production and application of polyploid fish.

[0004] Existing research indicates that polyploidy is closely related to abnormalities occurring during prophase I of meiosis. RNF212B is a key E3 ubiquitin ligase in meiotic recombination, involved in regulating the location and number of crossing over chromosomes, and crucial for the proper pairing and segregation of homologous chromosomes. [1, 2] Through the analysis of rnf212b Gene editing could potentially induce defects in prophase of meiosis, thus providing a possibility for creating artificial polyploids.

[0005] References:

[0006] RNF212B E3 ligase is essential for crossover designation and maturation during male and female meiosis in the mouse. Proc Natl Acad Sci US A 2024, 121(25): e2320995121.

[0007] 2. Ito M, Yun Y, Kulkarni DS, Lee S, Sandhu S, Nuñez B, Hu L, Lee K,Lim N, Hirota RM, Prendergast R, Huang C, Huang I, Hunter N. Distinct and interdependent functions of three RING proteins regulate recombination during mammalian meiosis. Proc Natl Acad Sci USA 2025, 122(2): e2412961121. Summary of the Invention

[0008] The purpose of this invention is to provide a method for knocking out rnf212b The method of creating polyploid fish through gene editing aims to provide more candidate genes and methods for the artificial creation of polyploid fish.

[0009] To achieve the above objectives, the present invention employs the following technical solution:

[0010] A method by knocking out rnf212b The method for genetically creating polyploid fish includes the following steps:

[0011] 1) Using the CRISPR / Cas9 system to study wild-type diploid fish rnf212bGenes were edited, and F0 generation gene knockout mutants of diploid fish were obtained through genotyping identification.

[0012] 2) The F0 generation gene knockout mutant was crossed with wild-type diploid fish. Upon reaching sexual maturity, the F1 generation gene knockout heterozygous mutant was obtained through genotyping. rnf212b + / - );

[0013] 3) Gene knockout heterozygous mutants of sexually mature F1 generation ( rnf212b + / - Self-fertilization was carried out, and at sexual maturity, F2 generation homozygous gene knockout mutants were obtained through genotyping. rnf212b - / - );

[0014] 4) Gene knockout homozygous mutants in female F2 generation ( rnf212b - / - A cross was formed between a male diploid wild-type and a female diploid. Upon reaching sexual maturity, genotyping and ploidy analysis confirmed that all sexually mature offspring were gene knockout heterozygous triploids. rnf212b + / - / - The surviving offspring of this triploid were all male and male-sterile.

[0015] Among them, the rnf212b Gene knockout methods include the following steps:

[0016] 1) According to the CRISPR / Cas9 knockout principle, in rnf212b Knockout target sites are designed on the ORF sequence of the gene;

[0017] 2) In rnf212b Upstream and downstream primers containing knockout target sites were designed on the gene sequence. PCR amplification was performed using cDNA as a template, followed by in vitro transcription and purification to obtain gRNA.

[0018] 3) Using a linearized Cas9 plasmid as a template, Cas9 mRNA was obtained through in vitro transcription and purification;

[0019] 4) Microinject gRNA and Cas9 mRNA into the fertilized eggs of wild-type diploid fish, hatch and cultivate the fertilized eggs, and perform gene mutation detection on the juvenile fish to obtain F0 generation gene knockout mutants.

[0020] Preferably, the knockout target site sequence is shown in SEQ ID NO: 2.

[0021] More preferably, the upstream primer sequence is shown in SEQ ID NO: 3, and the downstream primer sequence is shown in SEQ ID NO: 4.

[0022] Preferably, the injection concentration of the gRNA is 100 ng / μL, the injection concentration of the Cas9 mRNA is 100 ng / μL, the injection dose is 2.5 nL, and the injection site is the animal pole.

[0023] The present invention also provides a reagent for creating polyploid fish, the reagent comprising a Cas9 gene-editing protein or its expression vector, and a method for guiding the specific binding of the Cas9 gene-editing protein. rnf212b The gRNA of a gene or its expression vector.

[0024] The beneficial effects of this invention are:

[0025] This invention is aimed at rnf212b Genes were edited using the CRISPR / Cas9 system, successfully producing genetically controllable triploid zebrafish. As a vertebrate, zebrafish exhibits high conservation of its genes, developmental mechanisms, and organ systems compared to other fish, making it an extremely important model species for studying fish gene function. Therefore, the results of this gene-editing research in zebrafish have significant reference value for creating polyploid fish in other species and understanding their gene functions. This invention provides more gene-editing targets for the artificial creation of polyploid fish, which is beneficial for improving gene-editing efficiency and accelerating the sustainable development of aquaculture.

[0026] The polyploid fish obtained by this invention exhibited significant changes in fertility, indicating that artificial control... rnf212b Gene mutations can enable precise control of fish fertility, which helps to avoid the pollution of natural germplasm resources and is of great significance to ensuring ecological security. Attached Figure Description

[0027] Figure 1 for rnf212b - Sequencing peak diagram of target site mutations in F0 generation zebrafish.

[0028] Figure 2 for rnf212b Sequencing peak diagram of heterozygous mutations in F1 generation zebrafish.

[0029] Figure 3 for rnf212b - Schematic diagram of homozygous mutation sites in F2 generation zebrafish. Knockout target site located at... rnf212b In the third exon region of the gene, the homozygous mutant has 5 bases missing at the knockout target site compared to the wild type.

[0030] Figure 4 This is a sequencing peak diagram of homozygous mutation sites in rnf212b-F2 generation zebrafish.

[0031] Figure 5 for rnf212bEmbryo observation diagram of offspring from the mating of homozygous knockout diploid zebrafish females and wild-type males, ploidy peak diagram of hatching offspring and their proportion, and karyotype of triploid offspring chromosomes.

[0032] Figure 6 Wild-type zebrafish (WT_ rnf212b + / + ), rnf212b homozygous knockout zebrafish ( rnf212b - / - ), and its offspring triploids ( rnf212b + / - / - The appearance and ploidy peak diagram of adult fish.

[0033] Figure 7 Wild-type female zebrafish and rnf212b Embryo observation of offspring from mating of triploid male fish. Detailed Implementation

[0034] The technical solution of the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and not for limiting the scope of protection of the present invention. Various modifications or equivalent substitutions made by those skilled in the art based on the following embodiments should also be considered to fall within the scope of protection of the present invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions or reference books such as *Molecular Cloning: A Laboratory Manual* (New York: Cold Spring Harbor Laboratory, 2017), or according to the methods recommended in the manufacturer's operating manual. Materials in the embodiments that do not specify their source are all commonly used materials in the art and can be obtained commercially.

[0035] The embodiments involved rnf212b Ploid detection and chromosome karyotype analysis in knockout zebrafish are routine procedures in this field, and the specific methods are as follows:

[0036] 1. rnf212b ploidy detection of knockout mutants

[0037] For analysis rnf212b The ploidy composition of the offspring of the mutant was determined using a ploidy analyzer to detect the ploidy of the hatching offspring of the knockout mutant. The specific procedure is as follows:

[0038] 1) Using a clean pipette, transfer the hatched larvae into sterile EP tubes, one larva per tube. Add 500 μL of 1×PBS buffer (NaCl 137mM, KCl 2.7mM, Na2HPO4 4.3mM, KH2PO4 1.4mM) to the sample tube. Place the grinding pestle into the EP tube containing the sample and grind thoroughly by rotating it left and right. Place the resulting cell suspension on ice for later use.

[0039] 2) Ploidy determination was performed using the relative cellular DNA content method. Before ploidy determination, ploidy was assessed using wild-type hatched juvenile fish at the same developmental stage. Before loading the samples, 100 μL of DAPI dye was added to the cell suspension obtained from grinding, the solution was mixed, and stained in the dark for 5 minutes. The ploidy analyzer was used for sample detection, comparing the peak value of the wild-type sample with that of the target sample to determine the ploidy of the fish being tested.

[0040] To obtain a large offspring population for use as parent fish in polyploid zebrafish breeding, the mutant line was bred multiple times, and the offspring population was raised to sexual maturity (3 months of age). Plurality testing was performed on surviving adult fish. The sample processing method was the same as for the instrumental testing method for exocrine juveniles. The sample type was the caudal fin of adult fish. The ploidy calibration sample was the caudal fin of sexually mature wild-type adult fish; 0.3 cm of caudal fin was sufficient for instrumental testing.

[0041] 2. Chromosomal karyotype analysis of offspring embryos

[0042] The specific steps for preparing embryonic chromosomes of mutant offspring and analyzing their karyotypes are as follows:

[0043] 1) When the embryo develops to the point where pigment begins to accumulate in the eyes, select 10-15 embryos as a parallel group and prepare a total of 3 parallel treatment groups for statistical analysis. Before processing the samples, carefully remove the egg membrane with a syringe to avoid damaging the embryo.

[0044] 2) Use a clean pipette to transfer the embryos into a culture dish containing 0.1% colchicine solution and soak at room temperature for 45 minutes;

[0045] 3) Use a syringe to remove the colchicine solution from the culture dish, add 0.8% sodium citrate solution to immerse the embryo, and allow it to immerse in hypotonic solution for 20 minutes, changing the hypotonic solution once during this period;

[0046] 4) After the hypotonic treatment, fix the embryos with pre-cooled Carno fixative (methanol: glacial acetic acid = 3:1) for 15 minutes each time, for a total of 3 fixation sessions;

[0047] 5) After fixation, transfer the embryos to a 2.0 mL EP tube containing fresh fixative and store at -20°C overnight;

[0048] 6) The next day, discard the fixative in the tube, add 1-2 drops of 50% glacial acetic acid to dissociate the sample, tear the embryo into pieces with a syringe to prepare a single-cell suspension, add an appropriate amount of freshly prepared Carno fixative, prepare the chromosome phase by dropping the slide, fix the slide by heat, and let it dry naturally at room temperature.

[0049] 7) Wright-Giemsa staining, microscopic observation and photography, and counting of embryonic chromosome phases.

[0050] Example 1: Zebrafish rnf212b gene knockout

[0051] 1. Design of CRISPR / Cas9 knockout target sites

[0052] Zebrafish were obtained from the NCBI database (Gene ID: 108179942). rnf212b The gene's nucleic acid sequence (SEQ ID NO.1), referencing basic target site design principles, was used in zebrafish. rnf212b Target sites were designed in the third exon region of the gene. The knockout target site sequence of this invention is GAGCTTGTTCAGACTCGACT (SEQ ID NO.2). Primers were designed around the knockout target site. rnf212b -F / R amplification of fragments containing target site sequences, wherein the upstream primer rnf212b The -F sequence is TATTATTAGTTAGAGAACAAGTGTA (SEQ ID NO.3), and the downstream primer is... rnf212b The -R sequence is TGTAGCACTGGTCACGGACT (SEQ ID NO.4).

[0053] Enzyme-containing PCR premix from Shanghai Yisheng Biotechnology Co., Ltd. was used for PCR. rnf212b PCR amplification of the gene target site fragment was performed using the following reaction mixture (total volume 20 µL) in a centrifuge tube: 10.0 µL of 2×Hieff® PCR MasterMix; 7.0 µL of PCR-Grade Water; and upstream primer. rnf212b -F (10 μM) 1.0 µL; downstream primer rnf212b -R (10 μM) 1.0 µL; Genomic DNA template 1.0 µL.

[0054] The PCR amplification program was set as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 26 s, 35 amplification cycles; 72℃ final extension for 10 min.

[0055] The amplified product was sent to Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. for Sanger sequencing. The sequence information of the amplified product was compared with the sequence in NCBI, and the results were found to be the same, indicating that the target site was available and subsequent steps could be carried out.

[0056] 2. Preparation of gRNA

[0057] First, according to containing rnf212bThe upstream primer and its matching downstream primer (SEQ ID NO.3 and SEQ ID NO.4) of the gRNA targeting the gene site sequence were prepared in the following reaction system (total volume 50 μL) in sterile PCR tubes: PCR-Grade Water 32.0 µL; 10x PCR Bufer 5.0 µL; dNTP Mixture 5.0 µL; rTaq 0.5 µL; upstream primer gRNA-F (10 mmol / L) 2.5 µL; downstream primer gRNA-R (10 mmol / L) 2.5 µL; cDNA template 2.5 µL.

[0058] The PCR amplification reaction conditions were as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 52 s, 30 amplification cycles; and a final extension at 72℃ for 10 min.

[0059] The amplified gRNA fragments were washed and recovered using the AxyPrep PCR Cleaning Kit from AXYGEN. After obtaining the purified gRNA, in vitro transcription was performed using the Ambion T7 Kit. The specific steps were as follows:

[0060] 1) Prepare the following reaction mixture (total volume 20.0 μL) in a sterile EP tube: 2.5 mmol / L NTP 4.0 µL; 10x Reaction Buffer 2.0 µL; Linear Template DNA 5.0 µL; T7 Enzyme Mix 2.0 µL; DEPC H2O 7.0 µL. After thorough mixing, incubate at 37°C for 1 h.

[0061] 2) Add 1.0 μL TURBODENase to the tube and incubate at 37°C for 15 min to remove excess DNA template. Use Ambion's mirVana... TM The miRNAIsolation Kit recovers gRNA transcribed in vitro.

[0062] 3. Cas9 mRNA preparation

[0063] The pSP6-2sNLS-spCas9 vector was linearized by XbaI digestion (37℃ water bath digestion, treatment time ≥ 4h). 1 μL of the digested product was subjected to agarose gel electrophoresis to confirm complete vector linearization. The digested vector was washed and recovered using the AxyPrep PCR cleaning kit from AXYGEN. Cas9 mRNA was then transcribed in vitro using the purified vector as a template. The transcribed product was purified, and the resulting Cas9 mRNA solution was collected. After concentration determination, it was stored at -80℃ for later use at a concentration of 900 ng / μL.

[0064] 4. In vitro microinjection of zebrafish embryos

[0065] The night before injection, wild-type zebrafish individuals with well-developed glands and obvious secondary sexual characteristics were selected as parents at a female-to-male ratio of 1:2 and placed in a breeding tank with a partition for overnight rearing in the dark. The next morning, the partition was removed, and light stimulation was provided to encourage the male and female parents to chase each other to lay eggs. After the parents laid eggs, fertilized eggs were aspirated onto a microinjection plate using a clean pipette, and microinjected into the 1-cell stage fertilized eggs using a microinjector. Before microinjection, Cas9 mRNA and gRNA were mixed to a final concentration of 100 ng / μL and 100 ng / μL, respectively. The injection volume per fertilized egg was 2.5 nL, and the injection site was the animal pole of the embryo. After injection, the fertilized eggs were placed in aerated water at a constant temperature of 28°C for incubation until the embryos hatched.

[0066] 5. F0 generation knockout efficiency test

[0067] Once the juvenile fish have grown to a suitable size, the tail fin is cut off, and genomic DNA is extracted from the tail fin using the ammonium acetate method. Then, detection primers are used. rnf212b PCR amplification was performed using the -F / R method, with the PCR amplification system and reaction conditions identical to those in step 1. The amplified products were then sent to Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. for Sanger sequencing. Based on the sequencing results, in... rnf212b Individuals exhibiting a bimodal distribution at the knockout target site, with the bimodal distribution extending to the end of the sequence, are considered to have an effective mutation (F0 individuals). Figure 1 ).

[0068] Example 2: Breeding of Polyploid Zebrafish

[0069] 1. Screening of F1 generation positive individuals

[0070] After the F0 generation zebrafish with the effective mutation reached sexual maturity, they were mated with wild-type zebrafish to obtain F1 generation embryos. The F1 generation was then cultured until sexual maturity, and caudal fins were harvested. Genomic DNA was extracted from the caudal fins using the ammonium acetate method as a PCR template, and detection primers were used... rnf212b-F / R was used for PCR amplification, and the amplified product was sent to Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. for Sanger sequencing. According to the detection results, the peak pattern was as follows: rnf212b A bimodal distribution was observed at the target site, compared to the wild type. rnf212b Gene sequence alignment was performed, and individuals with non-triple insertion / deletion mutations were identified as F1 generation individuals. The resulting F1 generation heterozygotes were zebrafish with a 5bp deletion, exhibiting a deletion of 5 CGACT bases at the knockout target site compared to the wild type. Figure 2 ).

[0071] 2. Screening of F2 generation homozygotes

[0072] After the F1 generation of heterozygous zebrafish reached sexual maturity, F1 individuals with the same mutation type were selected for self-crossing to obtain F2 embryos. Genotyping was then performed on the F2 generation individuals after they reached sexual maturity, using the same method as for the F1 generation. Based on the test results, individuals with a single peak in the phenotypic graph were identified as wild-type or homozygous. These individuals were then compared with wild-type individuals in the NCBI database. rnf212b Gene sequence alignment was used to exclude wild-type individuals. The remaining individuals were F2 generation homozygotes, i.e., homozygous zebrafish missing 5bp. Figure 3 and Figure 4 ).

[0073] 3. rnf212b Obtaining heterozygous knockout triploid zebrafish

[0074] The F2 generation contains both male and female individuals. These individuals (…) rnf212b - / - female, rnf212b - / - Males mating with wild-type females revealed... rnf212b - / - Although males can produce embryos with wild-type females, none of the offspring survive. rnf212b - / - Male infertility.

[0075] by rnf212b - / - When females and wild-type males are used as parents, a large number of embryos can be obtained after reproduction. For example... Figure 5As shown, the embryonic development process of this breeding combination was intermittently observed at three time points: 24 hpf (hours post-fertilization), 48 hpf, and 72 hpf. Some embryos developed relatively quickly, and the surviving normal offspring of this breeding combination were able to grow and develop normally. The ploidy composition of the offspring of this breeding combination was detected by flow cytometry, and it was found that the ploidy peak of these surviving normal juveniles was near triploid (100%). At the same time, the karyotype analysis of the embryonic chromosomes of this breeding combination showed that the normal offspring embryos had a triploid chromosome number (3N=75).

[0076] The above findings confirm that rnf212b - / - An abnormality occurs in the female fish's oocytes during promeiosis, resulting in the formation of non-meiotic eggs. Triploid offspring produced by the fertilization of these non-meiotic eggs with sperm from wild-type males survive normally. Only male individuals are among the surviving triploid offspring obtained from this breeding combination. Figure 6 ).

[0077] Furthermore, this male triploid ( rnf212b + / - / - When mated with wild-type females, it was found that... rnf212b + / - / - Although they can produce embryos with wild-type females, the vast majority of these embryos fail to develop normally through the membranes, and the very few that do emerge die due to severe deformities. rnf212b + / - / - Male infertility ( Figure 7 ).

Claims

1. A method of knocking out rnf212b The method for creating polyploid zebrafish by gene editing is characterized by... Includes the following steps: 1) Using the CRISPR / Cas9 system to study wild-type diploid fish rnf212b Genes were edited, and F0 generation gene knockout mutants of diploid fish were obtained through genotyping identification. 2) The F0 generation gene knockout mutant was crossed with wild-type diploid fish. Upon sexual maturity, the F1 generation gene knockout heterozygous mutant was obtained through genotyping. rnf212b + / - ; 3) Gene knockout heterozygous mutants from sexually mature F1 generation rnf212b + / - Through self-fertilization, and upon reaching sexual maturity, F2 generation homozygous gene knockout mutants were obtained through genotyping. rnf212b - / - ; 4) Gene knockout homozygous mutants in female F2 generation rnf212b - / - When crossed with a male diploid wild-type, and upon reaching sexual maturity, genotyping and ploidy analysis confirmed that all sexually mature offspring were gene knockout heterozygous triploids. rnf212b + / - / - The surviving offspring of this triploid were all male and the males were sterile. In the CRISPR / Cas9 system, the upstream primer sequence of gRNA is shown in SEQ ID NO: 3, and the downstream primer sequence is shown in SEQ ID NO:

4.

2. The method for creating polyploid zebrafish as described in claim 1, characterized in that: The rnf212b Gene knockout methods include the following steps: 1) According to the CRISPR / Cas9 knockout principle, in rnf212b Knockout target sites are designed on the ORF sequence of the gene; 2) In rnf212b Upstream and downstream primers containing knockout target sites were designed on the gene sequence. PCR amplification was performed using cDNA as a template, followed by in vitro transcription and purification to obtain gRNA. 3) Using a linearized Cas9 plasmid as a template, Cas9 mRNA was obtained through in vitro transcription and purification; 4) CRISPR / Cas9 system and Cas9 mRNA were microinjected into the fertilized eggs of wild-type diploid fish, the fertilized eggs were hatched and cultured, and gene mutation detection was performed on the juvenile fish to obtain F0 generation gene knockout mutants.

3. The method for creating polyploid zebrafish as described in claim 2, characterized in that: The knockout target site sequence is shown in SEQ ID NO:

2.

4. The method for creating polyploid zebrafish as described in claim 2, characterized in that: The injection concentration of the gRNA was 100 ng / μL, the injection concentration of the Cas9 mRNA was 100 ng / μL, the injection dose was 2.5 nL, and the injection site was the animal pole.

5. A reagent for creating polyploid zebrafish, characterized in that, The reagents include: Cas9 gene-editing protein or its expression vector, and a guide for the specific binding of the Cas9 gene-editing protein. rnf212b The gRNA of the gene or its expression vector, wherein the upstream primer sequence of the gRNA is shown in SEQ ID NO: 3 and the downstream primer sequence is shown in SEQ ID NO: 4.

Images