Saccharomyces boulardii BHS09, fungicide and application of saccharomyces boulardii BHS09 in agriculture
By providing the boulardii yeast BHS09 bacterial agent, the problems of single function and poor environmental adaptability of existing agricultural microbial strains have been solved, and the multifunctional effects of strong phosphorus and potassium solubilization, plant growth promotion and pathogen inhibition have been achieved.
Patent Information
- Application Number
- CN202510986745.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-17
- Publication Date
- 2025-10-10
AI Technical Summary
Existing agricultural microbial strains have single functions, poor environmental adaptability, and are difficult to meet complex needs. Traditional phosphate-solubilizing bacteria are ineffective in soils with a pH greater than 7.5, and their IAA synthesis efficiency is low, resulting in unstable field effects.
Provided is a strain of Saccharomyces boulardii BHS09, which has the functions of solubilizing phosphate and potassium, synthesizing IAA, and inhibiting plant pathogens. The bacterial agent is prepared by shaking culture in YPD medium and is used for plant growth promotion and disease prevention.
Strain BHS09 performs well in multiple functions, with strong phosphate solubilization ability, high potassium solubilization rate, and high IAA content. It significantly promotes plant growth and inhibits multiple pathogens, thereby improving the plant's stress resistance and growth performance.
Smart Images

Figure CN120758370A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a strain of Saccharomyces boulardii, a bacterial agent and applications thereof in agriculture. Background Art
[0002] With the increasing demand for sustainable agricultural development around the world, the application value of microbial resources in soil remediation, plant growth promotion, and green pest and disease control has become increasingly prominent. The excessive use of traditional chemical fertilizers and pesticides has led to problems such as soil compaction, eutrophication of water bodies, and pesticide residues, prompting countries to lean towards biological control technologies. In this context, the research and development of composite microbial agents that have the functions of solubilizing phosphorus and potassium, promoting plant growth, and antagonizing pathogens has become the focus of the industry. Plant growth is closely related to microorganisms, among which the most studied and applied are plant growth-promoting bacteria, such as Azospirillum ( Azospirillum ), Bacillus ( Bacillus ), Pseudomonas ( Pseudomonas ) and Rhizobium ( Rhizobium These bacteria promote plant growth through direct and indirect effects. Direct effects include nitrogen fixation, phosphorus and potassium solubilization, increased mineral availability, siderophore secretion, and plant hormone synthesis. Indirect effects include the synthesis of antimicrobial substances, competition for nutrients and space, induction of plant systemic resistance, and the synthesis of 1-aminocyclopropane-1-carboxylic acid deaminase, which reduces the synthesis of the stress hormone ethylene, and the synthesis of antioxidant enzymes, which enhance plant stress resistance.
[0003] Patent 202410241003.8 discloses a Candida species, XHZG06-95A3, that has the ability to increase environmental pH and solubilize phosphate, reducing the acidity of acidified soils and increasing their available phosphorus content. It also adapts to a wide range of environmental temperatures and pH levels. Currently, single-functional strains in agricultural microorganisms struggle to meet complex requirements. For example, phosphate-solubilizing bacteria often lack pathogen antagonism; poor environmental adaptability leads to unstable field results, with traditional potassium-solubilizing bacteria failing in soils with a pH greater than 7.5; and low IAA synthesis efficiency. Against this backdrop, the discovery of complex microbial strains with multiple functions has become an industry focus, providing innovative solutions for the industrial application of agricultural microbial preparations. Henri Boulard discovered that locals in Southeast Asia (Vietnam, among others) chewed lychee and mangosteen peels to control cholera. He first isolated this unique yeast strain in 1923, later named: Saccharomyces boulardii This strain is not pathogenic and only colonizes the digestive tract of humans and animals. It can promote the proliferation and maturation of intestinal epithelial cells, make the villi longer and the crypts deeper, thereby improving the digestion and absorption capacity of nutrients; and promote the production of immunoglobulin (IgA) in the intestinal mucosa, building the first line of defense against pathogens. But Saccharomyces boulardii ( Saccharomyces boulardii) is a complex agricultural microbial strain with multiple functions but no reports have been published. Summary of the Invention
[0004] To address the above problems, the present invention proposes a strain of Saccharomyces boulardii BHS09, a microbial agent, and its application in agriculture. Strain BHS09 has the functions of solubilizing phosphate and potassium, synthesizing IAA, promoting plant growth, and inhibiting plant pathogens, thus solving the problem of single function of existing strains.
[0005] The technical solution of the present invention is achieved as follows: The present application provides a strain of Saccharomyces boulardii BHS09, which is classified and named Saccharomyces boulardii , deposited in the Guangdong Microbiological Culture Collection Center on June 18, 2025, with the deposit number GDMCC No. 66542, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.
[0006] In a second aspect, a bacterial agent contains the above-mentioned Saccharomyces boulardii BHS09.
[0007] Furthermore, the preparation method of the above-mentioned bacterial agent is to inoculate the above-mentioned Saccharomyces boulardii BHS09 into YPD medium and culture with shaking at 100-200 r / min and 25-35° C. for 18-30 hours.
[0008] In a third aspect, the use of the above-mentioned Saccharomyces boulardii BHS09 or the above-mentioned bacterial agent comprises at least one of the following: (1) Phosphate solubilization; (2) Potassium removal; (3) Synthesis of IAA; (4) Promote plant growth; (5) Inhibit the growth of plant pathogens.
[0009] Preferably, the above-mentioned phosphorus includes inorganic phosphorus and / or organic phosphorus; Preferably, the plant is wheat; Preferably, the above-mentioned plant pathogens are at least one of Rhizoctonia solani, Fusarium spp., Curvularia zeae, Fusarium moniliforme, Pseudofusarium graminearum, Fusarium graminearum, Phytophthora nicotianae and Fusarium oxysporum (flat plate confrontation has an inhibitory effect on the pathogens Curvularia zeae, Fusarium moniliforme, Pseudofusarium graminearum and Fusarium oxysporum; volatile gases have an inhibitory effect on Rhizoctonia solani, Pseudofusarium graminearum, Curvularia zeae, Fusarium moniliforme, Pseudofusarium graminearum, Fusarium graminearum, Phytophthora nicotianae and Fusarium oxysporum).
[0010] In a fourth aspect, the product prepared from the above-mentioned Saccharomyces boulardii BHS09 or the above-mentioned bacterial agent has at least one of the following functions: a. Phosphate solubilization; b. Potassium solution; c. Synthetic IAA; d. Promote plant growth; e. Inhibit the growth of plant pathogens.
[0011] Preferably, the above-mentioned phosphorus includes inorganic phosphorus and / or organic phosphorus; Preferably, the plant is wheat; Preferably, the above-mentioned plant pathogens are at least one of Rhizoctonia solani, Fusarium spp., Curvularia zeae, Fusarium moniliforme, Pseudofusarium graminearum, Fusarium graminearum, Phytophthora nicotianae and Fusarium oxysporum (flat plate confrontation has an inhibitory effect on the pathogens Curvularia zeae, Fusarium moniliforme, Pseudofusarium graminearum and Fusarium oxysporum; volatile gases have an inhibitory effect on Rhizoctonia solani, Pseudofusarium graminearum, Curvularia zeae, Fusarium moniliforme, Pseudofusarium graminearum, Fusarium graminearum, Phytophthora nicotianae and Fusarium oxysporum).
[0012] In a fifth aspect, the present application also provides a method for promoting plant growth, wherein the above-mentioned bacterial agent is watered on the root system of the plant.
[0013] Preferably, the OD of the above-mentioned bacterial agent is 600 The value is 0.6-1.2.
[0014] Preferably, the above plant is wheat.
[0015] The present invention has the following beneficial effects: 1. This application provides a strain of Saccharomyces boulardii BHS09, which is classified as Saccharomyces boulardii Strain BHS09, deposited under GDMCC No. 66542, has a strong ability to solubilize both inorganic and organic phosphorus. After 8 days of culture on solid Ca₃(PO₄)₂ and calcium phytate plates, the ratios of the solubilization zone (D) to the colony diameter (d) (D / d) were 1.30 and 4.38, respectively. After 8 days of shaking culture, the phosphorus content in the fermentation broth reached 320 mg / L and 280 mg / L, respectively, and the pH values were 4.3 and 4.4, respectively. It also has a strong potassium solubilization capacity. After 7 days of shaking culture in potassium-deficient medium, the potassium solubilization rate of strain BHS09 was 46.83%. It also has the ability to produce high levels of IAA. After 3 days of shaking culture in King's liquid medium containing L-tryptophan, the IAA content in the culture supernatant of strain BHS09 reached as high as 24 mg / L.
[0016] 2, The strain BHS09 provided by the application also has the ability to inhibit the growth of pathogenic bacteria, and the inhibition rates of the strain BHS09 on the pathogenic bacteria Curvularia inaequalis, Fusarium moniliforme, Pseudocercospora graminicola and Fusarium oxysporum are 11.64%, 54.82%, 46.48% and 51.80% respectively; the inhibition rates of the volatile gas of the strain BHS09 on Rhizoctonia solani, Fusarium pseudograminearum, Curvularia inaequalis, Fusarium moniliforme, Pseudocercospora graminicola, Fusarium graminearum, Phytophthora nicotianae and Fusarium oxysporum are 40.05%-76.02%. In addition, the strain BHS09 significantly promotes the growth of wheat, and after 21 days of inoculation of the strain BHS09, the seedling height of the pot-grown wheat is increased by 25%, the root dry weight is increased by 18%, and the root volume is increased by 40% compared with the control without inoculation. The application provides a strain resource for mining complex microbial strains with multiple functions, and has a wide application prospect. BRIEF DESCRIPTION OF DRAWINGS
[0017] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or the prior art description. Obviously, the drawings in the following description are only some embodiments of the application, and for those skilled in the art, other drawings can also be obtained without creative labor on the basis of these drawings.
[0018] Figure 1 For microscopic observation of Saccharomyces cerevisiae and yeast BHS09 morphology; wherein the left graph is Saccharomyces cerevisiae, and the right graph is yeast BHS09 (both magnifications are 10x40).
[0019] Figure 2 For the construction of the phylogenetic tree based on COX2 The sequence is constructed by using MEGA 11 software.
[0020] Figure 3 For the strain BHS09 PGM2 The sequence is compared with Saccharomyces cerevisiae PGM2
[0021] Figure 4 For the phosphorus dissolution circle formed by the strain BHS09 in the inorganic phosphorus and organic phosphorus medium plates; wherein the left graph is a Ca3(PO4)2plate, and the right graph is a calcium phytate plate.
[0022] Figure 5 For the P content and pH value of the supernatant of the strain BHS09 in the inorganic phosphorus liquid medium shake flask culture process.
[0023] Figure 6 For the P content and pH value of the supernatant of the strain BHS09 in the organic phosphorus liquid medium shake flask culture process.
[0024] Figure 7 The results show that the plate confrontation of Saccharomyces boulardii and the inhibitory effect of volatile gases on several pathogens.
[0025] Figure 8 The Saccharomyces boulardii potted plant promotes wheat growth; the left side is the CK treatment, and the right side is the Saccharomyces boulardii treatment. DETAILED DESCRIPTION
[0026] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0027] Unless otherwise specified, the experimental methods used in the following experimental examples are conventional methods; the materials and reagents used are commercially available reagents and materials unless otherwise specified.
[0028] A strain of Saccharomyces boulardii BHS09, whose taxonomic name is Saccharomyces boulardii The deposit number is GDMCC No. 66542, and it was deposited in the Guangdong Microbial Culture Collection on June 18, 2025. The deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.
[0029] Materials and Methods (1) Strain Saccharomyces boulardii BHS09 was isolated from the wheat rhizosphere in the experimental field of Jingzhong Science and Technology Park, Xuchang City, Henan Province in April 2019 and has been deposited by the Guangdong Microbial Culture Collection Center with the accession number: GDMCC No. 66542.
[0030] (2) Culture medium YPD medium: 10 g yeast extract, 20 g peptone, 20 g glucose, 1 L deionized water. For solid medium, add 20 g agar.
[0031] Ca3(PO4)2 medium: 10 g glucose, 0.5 g ammonium sulfate, 0.3 g NaCl, 0.3 g KCl, 0.3 g MgSO4•7H2O, 0.03 g FeSO4•7H2O, 0.03 g MnSO4•4H2O, 210 g Ca3(PO4), 1 L deionized water, pH 7.2. Add 20 g agar to the solid medium.
[0032] Calcium phytate medium: 10 g glucose, 0.2 g ammonium sulfate, 5 g MgCl2•6H2O, 0.1 g KCl, 0.5 g MgSO4•7H2O, 2 g calcium phytate, 1 L deionized water, pH 7.2. Add 20 g agar to the solid medium.
[0033] Potassium-deficient culture medium: sucrose 10 g, Na2HPO4 2 g, (NH4)2SO4 1 g, MgSO4•7H2O 0.5 g, NaCl 0.1 g, yeast powder 0.5 g, potassium feldspar powder 10 g, pH 7.2-7.4, deionized water 1 L.
[0034] King's medium: peptone 20 g, K2HPO4•3H2O 1.5 g, MgSO4 1.5 g, deionized water 1 L.
[0035] PDA medium: 200 g potatoes, 20 g glucose, 18 g agar, and 1 L deionized water.
[0036] Example 1: Identification of Saccharomyces boulardii BHS09 DNA extraction and PCR amplification: The strain was cultured in YPD medium for 24 h, and the cells were collected by centrifugation. The fungal genomic DNA extraction kit was used to efficiently extract genomic DNA from the strain. COX2 Gene primers were used for PCR amplification, and the primer sequences were COX2 -F:GAATGATGTACCACACACCTTATGCA, COX2 -R: TGATACTGCTTCGATCTTAATTGGC. use PGM2 The gene was amplified by PCR using primers with the following sequences: PGM2 -F:CATGGAAGCTATTCCAGAG, PGM2 -R:ACCGTTGGTTCTTCAGTTCC.
[0037] PCR reaction system: 2.5 µL of genomic DNA, 2.5 µL of forward and reverse primers (both at 10 mM concentration), 25 µL of 2×Hieff PCR Master Mix, and ddH2O to 20 µL.
[0038] PCR reaction conditions were as follows: initial denaturation at 98°C for 3 min, 32 cycles of 98°C for 10 s, 60°C for 20 s, and 72°C for 30 s, and a final extension at 72°C for 5 min.
[0039] Strain identification: Microscopic observation revealed that the cell morphology of strain BHS09 was oval, similar to that of Saccharomyces cerevisiae ( Figure 1 ). Extract its DNA and amplify COX2 The PCR product was sequenced to obtain the COX2 Sequence (SEQ ID NO.1). MEGA 11 was used to construct the phylogenetic tree. COX2 The sequence had 100% similarity with three strains of Saccharomyces boulardii and two strains of Saccharomyces cerevisiae ( S. cerevisiae ) has a similarity of 99.51% and 100% ( Figure 2 ), it is difficult to distinguish Saccharomyces boulardii from Saccharomyces cerevisiae from this evolutionary tree.
[0040] In Saccharomyces boulardii, the phosphoglucomutase (PGM) gene 2 ( PGM2 ) has a point mutation (G1278A), which leads to differences in the utilization of galactose between Saccharomyces boulardii and Saccharomyces cerevisiae. PGM2 The gene PCR product was sequenced (SEQ ID NO.2) and compared with the PGM2 Sequence comparison, strain BHS09 PGM2 The base of the gene at 1278 bp is A, which is similar to that of Saccharomyces cerevisiae. PGM2 There are differences in the G of the gene ( Figure 3 ). Combined COX2 sequence sum PGM2 The strain BHS09 was identified as Saccharomyces boulardii ( Saccharomyces boulardii ).
[0041] Example 2: Determination of phosphate solubilization ability of Saccharomyces boulardii BHS09 Inoculate Saccharomyces boulardii onto YPD medium and shake at 120 rpm and 30°C for 24 hours. Spot the bacterial suspension onto solid Ca₃(PO₄)₂ and calcium phytate plates. After incubation at 37°C for 8 days, observe the presence of a clearing zone around the colonies. Measure the phosphate-dissolving zone (D) and colony diameter (d), and calculate D / d.
[0042] 3 mL of the Saccharomyces boulardii suspension was inoculated into 100 mL of Ca₃(PO₄)₂ and calcium phytate culture media, respectively. Uninoculated phosphate-dissolving culture media served as blank controls. Cultures were incubated at 28°C with shaking at 180 rpm for 8 days. Soluble phosphorus content and pH were measured daily. Soluble phosphorus content was determined using the antimony-molybdenum colorimetric method.
[0043] After culturing on solid Ca3(PO4)2 and calcium phytate plates for 8 days, the ratios of the phosphate-soluble zone D and colony diameter d of Saccharomyces boulardii were 1.30 and 4.38 ( Figure 4 After 8 days of shaking culture in Ca3(PO4)2 medium, the phosphorus content in the supernatant was 320 mg / L and the pH value was 4.3 ( Figure 5 After culturing in calcium phytate medium for 8 days with shaking, the phosphorus content in the supernatant was 280 mg / L and the pH value was 4.4 ( Figure 6 ). This shows that Saccharomyces boulardii has a strong ability to solubilize inorganic and organic phosphorus.
[0044] Example 3: Determination of potassium solubilization ability of Saccharomyces boulardii BHS09 Inoculate 3 mL of bacterial suspension into 100 mL of potassium-deficient medium, use the uninoculated medium as a blank control, and culture at 28°C and 180 rpm for 7 days. Take 10 mL of bacterial culture, add 2 mL of 6% H2O2, and digest in a boiling water bath for 1 hour. Remove the digestion solution and centrifuge at 13,000 rpm for 5 minutes. Take the supernatant and measure K on a flame photometer. + concentration.
[0045] Potassium solubilization rate (%) = (potassium content of inoculated fermentation liquid - potassium content of control) / potassium content of control × 100.
[0046] After 7 days of shaking culture in potassium-deficient medium, the potassium solubilization rate of Saccharomyces boulardii was 46.83%, showing a strong potassium solubilization ability.
[0047] Example 4: Determination of IAA production capacity of Saccharomyces boulardii BHS09 3 mL of bacterial suspension was inoculated into 100 mL of King liquid medium containing L-tryptophan (200 mg / L). Uninoculated medium was used as a blank control. After culturing at 28°C and 180 rpm for 3 days, the culture medium was collected and the IAA concentration was determined using the Salkowski colorimetric method.
[0048] After shaking culture in King liquid medium containing L-tryptophan (200 mg / L) for 3 days, the IAA content in the culture supernatant of Saccharomyces boulardii was as high as 24 mg / L.
[0049] Example 5: Inhibitory Effect of Saccharomyces boulardii BHS09 on Plant Pathogens 1. Determination of antagonistic effects on plant pathogens Plant pathogens Rhizoctonia solani, Fusarium solani, Curvularia zeae, Fusarium moniliforme, Fusarium graminearum, Fusarium graminearum, Phytophthora nicotianae, and Fusarium oxysporum were cultured on polydimethylsiloxane (PDA) plates. A 0.6 cm colony was inoculated in the center of a new PDA plate and incubated upside down in a 25°C incubator until the colony reached a diameter of approximately 2.0 cm. Four sterile filter paper discs (0.6 cm diameter) were symmetrically placed 1.5 cm from the edge of the plate. A 5 μL PBS suspension of Saccharomyces boulardii was spotted on each sterile filter paper disc. An equal amount of PBS solution was spotted at symmetrical locations across the discs as a control. The treated PDA discs were incubated upside down in a 25°C incubator, and the diameters of the pathogen colonies were measured.
[0050] Inhibition rate (%) = (control colony growth diameter - treated colony growth diameter) / control colony growth diameter × 100%.
[0051] Depend on Figure 7 It can be seen that in the plate confrontation experiment, the inhibition rates of Saccharomyces boulardii against pathogens Curvularia zeae, Fusarium moniliforme, Fusarium graminearum and Fusarium oxysporum were 11.64%, 54.82%, 46.48% and 51.80% respectively.
[0052] 2. Inhibitory effects of volatile gases on plant pathogens Use a bisected Petri dish with equal volumes of YPD solid medium and PDA medium on either side. Evenly apply a suspension of Saccharomyces boulardii to one side of the YPD medium; a control is coated with sterile water. A 6 mm diameter plant pathogen plug is inoculated in the center of the PDA medium. Incubate in the dark at 25°C for 48 hours, and measure colony diameter using the cross-hatch method.
[0053] Inhibition rate (%) = (control colony growth diameter - treated colony growth diameter) / control colony growth diameter × 100%.
[0054] Depend on Figure 7 It can be seen that in the plate confrontation experiment, the inhibition rate of volatile gases of Saccharomyces boulardii on Rhizoctonia solani, Fusarium solani, Curvularia zeae, Fusarium moniliforme, Fusarium graminearum, Fusarium graminearum, Phytophthora nicotianae and Fusarium oxysporum was 40.05%-76.02%.
[0055] Example 6: Determination of the Growth-Promoting Effect of Saccharomyces boulardii BHS09 on Potted Wheat Peat soil and vermiculite were mixed in a 1:1 ratio and watered thoroughly. After sterilization at 121°C for 3 hours, the mixture was divided into pots. Surface-sterilized wheat seeds were sown into the pots, with about 10 seeds per pot, and the seeding depth was about 1 cm. The mixture was placed in a 25°C wheat greenhouse and cultured according to a 16-hour light and 8-hour dark cycle. For the first two days, 150 mL of OD600 The plants were irrigated with a suspension of Saccharomyces boulardii at a concentration of approximately 1.0, while the control was irrigated with the same volume of sterile water.
[0056] After approximately 21 days of incubation, wheat seedlings were gently pulled from the soil and their roots rinsed with sterile water to remove soil particles. Root and stem lengths were then measured. Wheat roots and stems were placed in paper bags, sterilized at 105°C for 10 minutes, and then dried at 80°C to constant weight. Root and stem dry weights were then measured. Roots were scanned using a root scanner to measure root growth indicators.
[0057] Depend on Figure 8 It can be seen that Saccharomyces boulardii significantly promotes wheat growth. After 21 days of inoculation with Saccharomyces boulardii, the seedling height of potted wheat increased by 25%, the root dry weight increased by 18%, and the root volume increased by 40% compared with the uninoculated control.
[0058] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. A strain of Saccharomyces boulardii BHS09, which is classified as Saccharomyces boulardii , deposited in the Guangdong Microbiological Culture Collection Center on June 18, 2025, with the deposit number GDMCC No. 66542, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.
2. A bacterial agent, characterized in that: Contains the boulardii yeast BHS09 according to claim 1.
3. The method for preparing the microbial agent according to claim 2, characterized in that: The boulardii yeast BHS09 according to claim 1 was inoculated into a YPD medium and cultured with shaking at 100-200 rpm and 25-35° C. for 18-30 h.
4. Use of the boulardii yeast BHS09 according to claim 1 or the bacterial agent according to claim 2, characterized in that: The application includes at least one of the following: (1) Phosphate solubilization; (2) Potassium removal; (3) Synthesis of IAA; (4) Promote plant growth; (5) Inhibit the growth of plant pathogens.
5. The use according to claim 4, characterized in that: The phosphorus includes inorganic phosphorus and / or organic phosphorus; and the plant is wheat.
6. The use according to claim 5, characterized in that: The plant pathogen is any one of Rhizoctonia solani, Fusarium solani, Curvularia zeae, Fusarium moniliforme, Fusarium graminearum, Fusarium graminearum, Phytophthora nicotianae and Fusarium oxysporum.
7. The product prepared from the Saccharomyces boulardii BHS09 according to claim 1 or the bacterial agent according to claim 2, characterized in that: The product has at least one of the following functions: a. Phosphate solubilization; b. Potassium solution; c. Synthetic IAA; d. Promote plant growth; e. Inhibit the growth of plant pathogens.
8. The product according to claim 7, characterized in that: The phosphorus includes inorganic phosphorus and / or organic phosphorus; the plant is wheat; and the plant pathogen is any one of Rhizoctonia solani, Fusarium solani, Curvularia zeae, Fusarium moniliforme, Fusarium graminearum, Fusarium graminearum, Phytophthora nicotianae and Fusarium oxysporum.
9. A method for promoting plant growth, characterized in that: The bacterial agent according to claim 2 is poured onto the root system of the plant.
10. The method for promoting plant growth according to claim 9, wherein: The OD of the inoculum 600 The value is 0.6-1.2; the plant is wheat.
Citation Information
Patent Citations
Candida sp. XHZG06-95A3 and application thereof
CN118109322A