Peanut bradyrhizobium sp. MY-3 and application thereof

Abstract

The invention provides bradyrhizobium anhuoshanense MY-3 and application thereof, and relates to the technical field of microorganisms. Comprising peanut bradyrhizobium sp., the classification name of the peanut bradyrhizobium sp. Is Bradyrhizobium sp., the peanut bradyrhizobium sp. Is preserved in China General Microbiological Culture Collection Center on March 25, 2025, the preservation number of the peanut bradyrhizobium sp. Is CGMCC No.1.61829, and the preservation address of the peanut bradyrhizobium sp. Is No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The strain belongs to a new strain of bradyrhizobium, can significantly promote nodulation and growth of peanuts and increase the yield of peanuts, and provides a new strain resource for improvement of nitrogen fixation efficiency in peanut production. In addition, the invention further provides a bacterial fertilizer capable of promoting peanut growth, the bacterial fertilizer is applied to field experiments, it is found that the bacterial fertilizer can remarkably improve the yield of peanut pods, and a new solution is provided for solving the problems of excessive use of nitrogen fertilizer and environmental pollution in peanut production.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and in particular to peanut bradyrhizobium MY-3 and applications thereof. Background Art

[0002] Nitrogen is a key element in regulating plant growth and development. Improving nitrogen utilization efficiency is crucial for ensuring stable and high crop yields (Huang et al., 2023). Agricultural production typically promotes high crop yields through the application of large amounts of nitrogen fertilizer. However, excessive nitrogen fertilizer use can lead to numerous problems, including water pollution and soil acidification, negatively impacting ecosystems and increasing agricultural production costs (Reinprecht et al., 2020). Symbiotic nitrogen fixation between rhizobia and legumes offers an effective solution to this problem, significantly reducing nitrogen fertilizer usage and holding important implications for the development of sustainable agriculture.

[0003] peanut( Arachis hypogaea Arachis oleraceus L. belongs to the genus Arachis in the Leguminosae family and is an important economic crop in my country. While my country has made several breakthroughs in the research and application of high-efficiency rhizobia for soybeans, such as the ability of high-efficiency rhizobia to significantly promote soybean nodulation and increase yield (Li et al., 2025), research and application of high-efficiency rhizobia for peanuts has lagged behind. Compared with other legume species, peanuts have a relatively low nitrogen fixation efficiency. Therefore, breeding high-efficiency peanut rhizobia and developing high-efficiency rhizobia for peanuts have important practical significance and broad application prospects for improving peanut quality and yield. Summary of the Invention

[0004] The object of the present invention is to provide a peanut bradyrhizobium MY-3, which is a new strain of the genus Bradyrhizobium and can significantly promote peanut nodulation and growth and increase peanut yield.

[0005] Another object of the present invention is to provide the use of the above-mentioned peanut Bradyrhizobium MY-3 in peanut planting, which can significantly increase the pod yield of peanuts.

[0006] The present invention solves the technical problem by adopting the following technical solutions.

[0007] On the one hand, the present invention provides a peanut bradyrhizobium MY-3, which is classified as Bradyrhizobium sp. , was deposited in the General Microbiology Center of China Culture Collection Administration on March 25, 2025, with the deposit number: CGMCC No. 1.61829, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0008] Furthermore, the 16S rDNA sequence of the above-mentioned Bradyrhizobium peanut MY-3 is shown in SEQ ID NO: 1.

[0009] Furthermore, the above-mentioned peanut bradyrhizobium MY-3 was obtained by isolating, purifying, and screening the nodules from 18 peanut-growing areas in Sichuan Province and Chongqing City through sand culture backgrafting experiments.

[0010] Furthermore, in the above separation step, the nodules are first cleaned and disinfected with sterile water, then crushed, and the extract is cultured on YMA plate culture medium for 5-7 days. Single colonies with electrical rhizobia colony morphology are selected, diluted, and separated by streaking on YMA plate culture medium.

[0011] Furthermore, in the above purification step, the above rhizobium colony is streaked and purified 1-2 times, and then inoculated on a YMA slant and cultured for 5-7 days to obtain a test strain. The test strain is then inoculated into YMA liquid medium and cultured for 3-5 days. The bacterial solution is then added with 25% glycerol and stored at -80°C.

[0012] Furthermore, the sand culture inoculation experiment was conducted using a low-nitrogen double-layer sand culture method. Two groups were set up: the test strain was inoculated with Shuhua No. 4 and Shuhua No. 9 peanut seeds, respectively, and a control group was set up. After inoculation, the seeds were cultured in a culture room, and their growth phenotypes were compared after the flowering period. The rhizobium that promotes peanut nodulation was named MY-3.

[0013] Furthermore, the above-mentioned MY-3 was re-spread onto YMA medium, and a single colony was selected to extract total DNA. The DNA was used as a template to amplify 16S rRNA by PCR, and then the PCR product was sequenced. Based on the sequencing results, a comprehensive developmental tree was constructed to determine its species, and sequence comparison was performed through NCBI to determine its genomic DNA.

[0014] On the other hand, the present invention provides a bacterial fertilizer for promoting peanut growth, which contains the above-mentioned Bradyrhizobium peanut MY-3. The preparation steps are as follows: 1) Prepare the fertilizer carrier: Weigh 10 g mannitol, 0.4 g yeast powder, 0.25 g KH2PO4, 0.25 g K2HPO4, 0.2 g MgSO4·7H2O, 0.1 g CaCl2·6H2O, 0.1 g NaCl, 9.5 g Ca(OH)2, 1 g superphosphate, 1 mL 0.5% ammonium molybdate, 1 mL 0.5% boric acid, and 476 g Pinnell peat (peat was dried, crushed, and passed through a 100-mesh sieve). Place the prepared fertilizer into a sterilization bag and sterilize it at high temperature.

[0015] 2) Activate the MY-3 strain using YMA medium using the streak plate method. Inoculate the activated MY-3 strain into YMA liquid medium. Add 300 mL of bacterial solution to 500 g of biofertilizer carrier, store in a cool place, and perform a biofertilizer qualification test.

[0016] 3) Conduct field experiment analysis. The experimental group used peanuts with MY-3 bacterial fertilizer, and the control group used peanuts with bacterial fertilizer carrier. Repeat 4 groups and observe the growth phenotypes of peanuts in the experimental and control groups.

[0017] Compared with the prior art, the embodiments of the present invention have at least the following advantages or beneficial effects: 1. The present invention screened and identified a peanut bradyrhizobium MY-3, a new strain of bradyrhizobium, which can significantly promote peanut nodulation, growth and increase peanut yield, providing a new strain resource for improving nitrogen fixation efficiency in peanut production.

[0018] 2. The present invention provides a microbial fertilizer that can promote the growth of peanuts, and has been applied to field experiments. It has been found that it can significantly increase the pod yield of peanuts, providing a new solution to the excessive use of nitrogen fertilizers and environmental problems in peanut production. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.

[0020] Figure 1 This is a growth comparison diagram of the Shuhua No. 4 experimental group and the control group in Example 1 of the present invention; Figure 2 This is a growth comparison diagram of the Shuhua No. 9 experimental group and the control group in Example 1 of the present invention; Figure 3 This is a comparison of the growth phenotypes of the Shuhua No. 4 experimental group and the control group in Example 1 of the present invention; Figure 4 This is a comparison of the growth phenotypes of the Shuhua No. 9 experimental group and the control group in Example 1 of the present invention; Figure 5 This is a colony growth diagram of Rhizobium MY-3 in Example 1 of the present invention; Figure 6 is the phylogenetic tree of MY-3 in Example 1 of the present invention; Figure 7 This is a comparison of peanut nodulation phenotypes of the Shuhua No. 9 experimental group and the control group in Example 2 of the present invention; Figure 8 This is a comparison chart of the number of main root nodules and lateral root nodules of peanuts in the Shuhua No. 9 experimental group and the control group in Example 2 of the present invention. DETAILED DESCRIPTION

[0021] To make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention are described clearly and completely below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer are used. Where the manufacturer of the reagents or instruments is not specified, all are conventional products that can be purchased commercially.

[0022] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present application can be combined with each other. The present invention will be described in detail below with reference to specific embodiments.

[0023] The features and performance of the present invention are further described in detail below with reference to the embodiments.

[0024] Example 1 This embodiment provides a peanut Bradyrhizobium MY-3, which is obtained by the following steps: 1. Acquisition, isolation and purification of strains: ① Strain Acquisition: Peanuts were collected from 18 peanut-growing areas in Sichuan Province and Chongqing City. Peanuts with lush growth, large nodules, and numerous nodules were selected. The soil attached to the roots was cleaned with clean water. The roots, along with fresh, intact nodules, were cut with scissors and placed in anhydrous CaCl2 before being isolated in the laboratory.

[0025] ② Strain isolation: After washing the nodules with sterile water, soak them in 95% alcohol and 0.1% mercuric chloride for 3-5 minutes, then rinse them with sterile water 6-8 times. After surface disinfection, crush the nodules and take the leaching liquid to streak on YMA plates. Incubate at 28°C for 5-7 days and select single colonies with typical rhizobium colony morphology (milky white, no red absorption, round, raised, neat edges, smooth surface, relatively moist, and relatively sticky). The colony growth morphology is as follows: Figure 5 As shown, it can be seen that the colony morphology is rod-shaped. After dilution, the single colony was streaked on the YMA plate for separation.

[0026] Alternatively, the YMA plate medium can be prepared as follows: 10 g mannitol, 0.4 g yeast extract, 0.25 g K2HPO4, 0.2 g MgSO4·7H2O, 0.1 g CaCl2·6H2O, 0.1 g NaCl, 2 mL 1% molybdenum acid, 2 mL 1% boric acid, 2.5 mL 0.4% Congo red, 20 g agar, pH = 7.0, and dilute to 1 L with sterile water.

[0027] ③ Strain purification: Mark the colonies preliminarily confirmed to be rhizobia, perform Gram staining after smearing, and streak and purify the colonies that are negative under microscopic examination and free of foreign bacteria 1-2 times. Inoculate the YMA slant and culture at 28°C for 5-7 days. Inoculate the obtained test strain into YMA liquid culture medium and culture it in an incubator at 28°C and 150 rpm for 3-5 days. Then take the bacterial solution, add 25% glycerol and refrigerate it at -80°C. The strain obtained in this step is recorded as the test strain.

[0028] 2. Sand culture grafting experiment: This experiment uses low nitrogen double-layer sand culture method for cultivation. The specific steps are as follows: ① Preparation of experimental materials: Peanut seeds Shuhua No. 4 and Shuhua No. 9 were selected, which were provided by the Economic Crops Institute of Sichuan Academy of Agricultural Sciences.

[0029] Prepare low-nitrogen hydroponic solution (nitrogen content 0.005 g / L): select KCl 0.075 g, K2HPO4 0.136 g, MgSO4 0.06 g, Ca(NO3)2 0.03 g, CaSO4 0.46 g, ferric citrate 0.075 g, trace element solution 1 mL, distilled water 1 L, and adjust the pH to 7.0; The configuration of the trace element solution includes: selecting 1.81 g of MnSO4, 0.22 g of ZnSO4, 0.8 g of CuSO4·5H2O, 2.86 g of boric acid, 0.02 g of molybdic acid, 1 L of distilled water, and adjusting the pH to 7.0.

[0030] Double-layer pot device: The upper layer is a cultivation bottle (500 mL) filled with vermiculite, and the lower layer is a polypropylene plastic bottle (500 mL) filled with low-nitrogen hydroponic solution. The upper and lower layers are connected with gauze strips. After assembly, sterilize and set aside.

[0031] ② Seed treatment and inoculation: First, prepare a bacterial suspension, including: selecting the test strain, activating it on a YMA plate, and incubating it in an inverted manner at 28°C for 5-7 days. Then, inoculate the colony onto a slant. Take one slant test tube for each test strain, add 5-6 mL of sterile water, and prepare a bacterial suspension for later use. Shuhua No. 4 and Shuhua No. 9 peanut seeds were sterilized and placed on sterile vermiculite for germination at room temperature. When the radicles grew approximately 0.5-1 cm, the seeds were placed in the sterile vermiculite layer of a double-layer pot using sterile tweezers on a sterile workbench. 1 mL of bacterial suspension was inoculated and the process was repeated three times. The seeds were then placed in a light-incubation chamber at 22-24°C under a 12-h light / dark cycle. Growth phenotypes were compared during the flowering period (approximately 35 days).

[0032] ③ Set up a control group, which also uses Shuhua No. 4 and Shuhua No. 9 peanut seeds. Except for not inoculating, the rest of the operation steps are the same as those of the experimental group and are carried out simultaneously.

[0033] It should be noted that this experiment adopted a low-nitrogen double-layer sand culture method, in which the liquid nitrogen content of hydroponic culture was 0.005 g / L, which can better study the nodulation of peanut roots under nitrogen stress conditions and further demonstrate the effect of the test strain on improving the nitrogen fixation efficiency of peanuts.

[0034] 3. Take photos of the experimental group and the control group during the flowering period, and test and compare their growth phenotypes (number of nodules, chlorophyll content, plant height and biomass). The experimental results are as follows: Figures 1-4 As shown, the dots in the bar graph represent three biological replicates, and the asterisks on the bar graph indicate significant differences (using Student t test, **P < 0.01). Figure 1 This is a comparison of the growth of peanut plants in the Shuhua No. 4 experimental group and the control group. Figure 2 This is a comparison of the growth of peanut plants in the Shuhua No. 9 experimental group and the control group. It can be seen that the plant heights of the Shuhua No. 4 and Shuhua No. 9 peanut plants inoculated with the test strain are significantly higher than those of the uninoculated Shuhua No. 4 and Shuhua No. 9 peanut plants, indicating that the test strain can significantly promote the growth of peanuts. Further, Figure 3 The growth phenotype comparison chart of the peanut plants in the Shuhua No. 4 experimental group and the control group is shown in the figure. The growth phenotype test method is a common experimental test method used by those skilled in the art and will not be described in detail here. Figure 3 (A) is the comparison of the number of nodules, Figure 3 (B) is the comparison of chlorophyll content, Figure 3 (C) is the comparison of plant height. Figure 3 (D) is the comparison of biomass; Figure 3 (A)- Figure 3 (D) It can be clearly seen that the growth phenotype of the Shuhua No. 4 experimental group inoculated with the test strain is higher than that of the control group, further indicating that the test strain can significantly promote peanut growth; Likewise, Figure 4This is a comparison of the growth phenotypes of peanut plants in the Shuhua No. 9 experimental group and the control group, among which, Figure 4 (A) is the comparison of the number of nodules, Figure 4 (B) is the comparison of chlorophyll content, Figure 4 (C) is the comparison of plant height. Figure 4 (D) is the comparison of biomass; Figure 4 (A)- Figure 4 (D) It can be clearly seen that the growth phenotype of the Shuhua No. 9 experimental group inoculated with the test strain was higher than that of the control group, especially the number of nodules was significantly improved, which also shows that the test strain can significantly promote peanut growth; From the above experiments, it can be seen that the growth potential and growth phenotype of peanuts inoculated with the test strain were significantly better than those of the control group, indicating that the test strain can significantly promote peanut growth. Moreover, since the experiment was conducted under low nitrogen conditions, it also shows that the test strain can significantly improve the nitrogen fixation efficiency of peanuts. The rhizobium of this test strain was named MY-3. Combined with this experiment, it can be seen that Bradyrhizobium MY-3 can be used as a growth-promoting product in peanut growth.

[0035] 4. Determine the species and genomic DNA of the obtained MY-3. The steps include: ① Re-spread the MY-3 strain onto YMA medium and culture at 28°C for 5-7 days. Select a single colony and extract its DNA using the TIANGEN (DP302) Bacterial Genomic DNA Extraction Kit. The steps for DNA extraction include: Take 3-5 mL of MY-3 culture medium in a centrifuge tube, centrifuge at 10,000 rpm for 1 min, add 200 μL of buffer GA to the bacterial pellet, and shake until the bacteria are suspended; then add 20 μL of proteinase K solution to the above centrifuge tube, shake thoroughly to mix, add 220 μL of buffer GB, shake for 15 s, and let it stand at 70°C for 10 min; after standing, add 220 μL of anhydrous ethanol and shake to mix, then add the resulting solution and flocculent precipitate to an adsorption column CB3, centrifuge at 12,000 rpm for 30 s, and discard the waste liquid; add 500 μL of buffer GD to the adsorption column CB3, centrifuge at 12,000 rpm for 30 s, and discard the waste liquid; add 600 μL of rinse solution PW to the adsorption column CB3, centrifuge at 12,000 rpm for 30 s, and discard the waste liquid; repeat the above steps. Then put the adsorption column CB3 back into the collection tube, centrifuge at 12000 rpm for 2 min, pour out the waste liquid, and then place the adsorption column at room temperature to remove the residual rinsing liquid in the adsorption column; then put the adsorption column CB3 into a new centrifuge tube, add 100 μL of elution buffer TE to the middle part of the adsorption membrane, let it stand at room temperature for 5 min, centrifuge at 12000 rpm for 2 min, repeat the operation once, add the solution obtained by centrifugation to the adsorption column CB3, let it stand at room temperature for 2 min, centrifuge at 12000 rpm for 2 min to obtain DNA.

[0036] For 16S rRNA gene sequence analysis, 16S rRNA was amplified by PCR using the extracted DNA as a template. The sequence of the PCR forward primer 27F is shown in SEQ ID NO: 2, and the sequence of the reverse primer 1492R is shown in SEQ ID NO: 3. The amplification reaction conditions are shown in Table 1. The PCR products were detected by agarose gel electrophoresis and then sent for sequencing analysis.

[0037] SEQ ID NO: 2: AGAGTTTGATCCTCGCTCAG SEQ ID NO: 3: GGYTACCTT GTTACGACTT

[0038] Table 1

[0039] Experimental results analysis: please refer to Figure 6, according to the published literature results of the applicant (Wang et al., 2025), MY-3 strain is isolated from the cultivar Shucaihua No. 1, based on 16S rRNA gene sequencing results and Eztaxon (http: / / www.ezbiocloud.net) alignment, the comprehensive development tree analysis found that MY-3 and Bradyrhizobium sp. (ATCC 43641) similarity is 96.7%, lower than the standard of 97% of the species, CGMCC identified as a new species of Bradyrhizobium, the classification name is B.guangxiense CCBAU 53363 T Bradyrhizobium sp . Through the gene accession number KU558869.1 on NCBI (https: / / www.ncbi.nlm.nih.gov) sequence alignment, the genomic DNA is determined, the genomic DNA sequence is shown as SEQ ID NO: 1. The strain has been preserved in China General Microbiological Culture Collection Center on March 25, 2025, the preservation number is: CGMCC No. 1.61829, and the patent preservation address is No. 3, Beichen West Road, Beijing City, Chaoyang District.

[0040] SEQ ID NO: 1: cgtcatcggcgagccgatcgacgaagccggcccggtcaagtcggaaggcctgcgcgccatccaccaggaggcgccgagctacaccgaccagtcgaccgaagccgaaattctcgtcaccggcatcaaggtcgtcgacctgctcgctccctacgccaagggcggcaagatcggcctgttcggcggcgccggcgtcggcaagaccgtgctgattcaggaactgatcaacaacgtcgcgaaggcgcacggcggttactccgtgttcgccggtgtcggcgagcgcacccgcgagggcaacgacctctatcacgagttcatcgagtccaaggtcaacgccgatccgaagaacccggatccgagcgtgaagtcgaagtgcgcgctggtgttcggccagatgaacgagccgccgggcgcccgcgcccgcgtcgcgctcaccggtctgaccatcgcggaagacttccgcgacaaaggccaggacgtgctgttcttcgtcgacaacatcttccgcttcacccaggc​ Example 2 This embodiment provides a bacterial fertilizer for promoting peanut growth, which uses the MY-3 strain in Example 1, and the preparation method comprises the following steps: ①Prepare the bacterial fertilizer carrier: weigh 10 g of mannitol, 0.4 g of yeast powder, 0.25 g of KH2PO4, 0.25 g of K2HPO4, 0.2 g of MgSO4·7H2O, 0.1 g of CaCl2·6H2O, 0.1 g of NaCl, 9.5 g of Ca(OH)2, 1 g of calcium superphosphate, 1 mL of 0.5% ammonium molybdate, 1 mL of 0.5% boric acid, and 476 g of peat soil (peat soil is dried, crushed and sieved through a 100-mesh sieve), and then the prepared bacterial fertilizer is loaded into a sterilized bag for high-temperature sterilization and standby.

[0041] ②Prepare the MY-3 rhizobium bacterial fertilizer: use the plate streaking method to activate the MY-3 strain with YMA medium, inoculate the activated MY-3 strain into YMA liquid medium, and cultivate at 28°C and 180 rpm until the OD=0.6-0.8. Add 300 mL of MY-3 bacterial liquid to 500 g of the bacterial fertilizer carrier and mix well, and store in a cool and dry place for 20 days. Bacterial fertilizer qualification test: randomly select 3 bags of bacterial fertilizer, take 10 g of bacterial fertilizer sample and add it to a conical flask containing 90 mL of 0.9% NaCl solution, cultivate at 28°C and 180 rpm for 30 min, take the supernatant and dilute it with 0.9% NaCl solution to 10 -6、 10 -7 、10 -8 gradient dilution, then coat on YMA medium, cultivate at 28°C for 5-7 days, count the white colonies on the plate, and the bacterial count is not less than 108 CFU / g for qualification. The qualified bacterial fertilizer is stored in a cool and dry place for standby.

[0042] Bacterial fertilizer experiment: field experiments are conducted in Qingbaijiang, Chengdu, Sichuan Province, and Huili, Panxi, Sichuan. The experimental group includes 4 repeated plots, each plot is divided into 4 rows, and each row has a number of holes, with a row length of 2.6 m and a row width of 1.5 m. The inner row spacing is 25 cm, the large row spacing is 50 cm, the hole spacing is 20 cm, and the area of each plot is about 4 m 2 . Each hole of the experimental group contains 2 peanut seeds with MY-3 bacterial fertilizer. The control group is set synchronously, and the difference between the control group and the experimental group is that the peanut seeds in the control group are not treated. The experimental results are shown in Figure 7-Figure 8 .

[0043] Reference Figure 7 , Figure 7This is a comparison of the peanut nodulation phenotypes of the Shuhua No. 9 experimental group and the control group in this example. It can be seen that the number of main root nodules and lateral root nodules of peanuts treated with MY-3 bacterial fertilizer increased significantly, indicating that MY-3 bacterial fertilizer can promote peanut nodulation during the flowering period. In addition, biological phenotypic measurements were performed on the experimental and control groups. The results are shown in Table 2. The data represent the mean ± standard deviation (n=4). Different uppercase and lowercase letters in the same column indicate statistically significant differences between different locations and inoculation treatments (p<0.05). The results showed that after treatment with MY-3 bacterial fertilizer, the chlorophyll content of the Shuhua No. 4 peanut plant increased by about 49.9%, the plant height increased by about 22.6%, and the biomass increased by about 66.6% compared with the untreated control group; the chlorophyll content of the Shuhua No. 9 peanut plant increased by about 41.1%, the plant height increased by about 13.2%, and the biomass increased by about 31.8%. This indicates that MY-3 bacterial fertilizer can also cause peanut leaves to accumulate more chlorophyll, promote peanut growth, and increase peanut biomass in the field, that is, MY-3 bacterial fertilizer can significantly promote peanut growth.

[0044] Table 2

[0045] Subsequently, during the harvest period, the nodule number and yield of peanuts in the plots of Qingbaijiang and Huili were measured respectively. The results are shown in Table 3. The results showed that after treatment with MY-3 bacterial fertilizer, the number of nodules and pod yield of peanut plants in Huili and Qingbaijiang areas showed a significant growth trend compared with the control group without any treatment. Among them, in Huili area, the number of nodules of Shuhua No. 4 showed a substantial increase, and the pod yield increased by about 55.9% year-on-year; the number of nodules of Shuhua No. 9 also showed a substantial increase, and the pod yield increased by about 36.5% year-on-year; in Qingbaijiang area, the number of nodules of Shuhua No. 4 increased by about 63.3% year-on-year, and the pod yield increased by about 10.4% year-on-year; the number of nodules of Shuhua No. 9 increased by about 64.3% year-on-year, and the pod yield increased by about 6.3% year-on-year. There were large differences in the initial yield and growth rate of nodules, as well as the initial yield and growth rate of pods in Huili and Qingbaijiang areas. It is speculated that this may be due to factors such as the different geographical environments of the two areas. However, the results showed an overall upward trend, indicating that MY-3 bacterial fertilizer significantly promoted the nodulation of peanuts in the two areas, and the pod weight of a single peanut plant also increased significantly.

[0046] In summary, MY-3 as a microbial fertilizer can significantly promote peanut nodulation and increase peanut pod yield. It has broad application prospects and economic benefits, and is of great significance for promoting sustainable agricultural development.

[0047] Table 3

[0048] Example 3 This example, based on Example 1, explored the effect of MY-3 on the structure of peanut rhizosphere microbial community. Peanut rhizosphere microorganisms in Huili and Qingbaijiang areas of Sichuan were measured and analyzed using 16s RNA of rhizosphere bacteria and ITS gene sequencing of fungi. The analysis results are shown in Table 4. It can be seen that MY-3 detected 16 differentially abundant genera, among which Pseudomonas ( Pseudarthrobacter ) and Septoria ( Mycosphaerella ) increased in abundance, Pseudarthrobacter and Mycosphaerella The relative abundance of these two dominant genera was extremely significantly positively correlated with peanut nodulation, growth and pod yield. Therefore, we speculated that MY-3 may have improved the structure of the host rhizosphere microbial community, especially the proportion of these two dominant genera, thereby promoting peanut nodulation, growth and yield.

[0049] Table 4 Peanut rhizospheric microorganisms enriched by Bradyrhizobium MY-3

[0050] In summary, the embodiments of the present invention provide a peanut bradyrhizobium MY-3 and its application, screen and identify a peanut bradyrhizobium MY-3, which is a new strain of bradyrhizobium. It can significantly promote peanut nodulation, growth and increase peanut yield, providing a new strain resource for improving nitrogen fixation efficiency in peanut production.

[0051] The present invention also provides a bacterial fertilizer that can promote the growth of peanuts. It has been applied to field experiments and found that it can significantly increase the pod yield of peanuts. It provides a new solution to solve the excessive use of nitrogen fertilizer and environmental problems in peanut production. It has broad application prospects and economic benefits, and is of great significance for promoting the sustainable development of agriculture.

[0052] The embodiments described above are some, but not all, of the embodiments of the present invention. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention as claimed, but rather merely represents selected embodiments of the present invention. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without inventive effort are also within the scope of protection of the present invention.

Claims

1. A peanut bradyrhizobium MY-3, characterized in that Category Name Bradyrhizobium sp. , deposited in the General Microbiology Center of China Culture Collection Administration on March 25, 2025, with the deposit number: CGMCC No.1.61829, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

2. A peanut bradyrhizobium MY-3 according to claim 1, characterized in that The 16S rDNA sequence is shown in SEQ ID NO:

1.

3. Use of the peanut bradyrhizobium MY-3 according to claim 1 in promoting peanut growth.

4. The use according to claim 3, characterized in that The peanut bradyrhizobium MY-3 is used as a growth-promoting product in peanut growth.

5. A bacterial fertilizer for promoting peanut growth, characterized in that: The peanut bradyrhizobium MY-3 as claimed in claim 1 or 2 is used.

Images