Nucleic acid extraction reagent combination and application thereof
By using a nucleic acid extraction reagent combination of high-concentration guanidine salts and surfactants on the electrowetting platform, combined with heating-assisted lysis and proteinase K, the problem of nucleic acid extraction on the electrowetting platform was solved, rapid and accurate nucleic acid extraction was achieved, the mixing effect and driving force were improved, and the failure rate and production costs were reduced.
Patent Information
- Application Number
- CN202510994192.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-18
- Publication Date
- 2025-10-10
AI Technical Summary
There is no product in the existing technology that can directly extract nucleic acids on an electrowetting platform, and traditional nucleic acid extraction methods have weak mixing effects on microfluidic platforms and cannot support the cleavage and purification of nucleic acids.
Provided is a nucleic acid extraction reagent combination, including a lysis solution, a washing solution, and an eluent. By adding a high concentration of guanidine salt and a surfactant of an appropriate concentration to the lysis solution, combined with heating to assist lysis, and adding proteinase K to the washing solution, lysis and nucleic acid adsorption are carried out simultaneously, thereby shortening the extraction time and improving the driving force on the electrowetting platform.
Rapid and accurate nucleic acid extraction is achieved on the electrowetting platform, which shortens the extraction time, improves the mixing effect, reduces the number of steps, is suitable for the adaptation of ordinary nucleic acid extraction and the electrowetting platform, and reduces the failure rate and production cost.
Smart Images

Figure BDA0005506803400000101 
Figure BDA0005506803400000102 
Figure BDA0005506803400000111
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to a nucleic acid extraction reagent combination and application thereof. Background Art
[0002] Digital microfluidics is a technology for manipulating microliter and nanoliter droplets. It can individually control the droplets on the electrode array, making the analysis of internal samples more precise and the analysis speed increased exponentially. For this technology, the most common driving method is electrowetting. Since the chip preparation and structure based on electrowetting technology are relatively simple, it has the advantages of miniaturization, integration, and easy manipulation. It is widely used in biomedicine, molecular biology, optical devices and other fields. The electrowetting effect refers to controlling the wettability of droplets placed on the driving electrode unit under the hydrophobic insulating layer by applying an external voltage to it. When the droplet is located on two driving electrodes to which no voltage is applied, the droplet is in a hydrophobic equilibrium state on the driving electrode, such as Figure 1 As shown in Figure a; only when the right driving electrode is energized, the contact angle on the left side of the droplet does not change, while the contact angle on the right side of the droplet decreases, causing the droplet to spread to the right, as shown in Figure 5. Figure 1 Based on the above principle, by applying a pulse voltage of a certain amplitude and frequency to the driving electrode, the droplets can be moved along the direction of the applied voltage, thereby realizing the manipulation of the droplets on the electrowetting chip.
[0003] Nucleic acid extraction is fundamental and crucial in molecular biology. The concentration and purity of extracted nucleic acids directly impact the accuracy of PCR results. Traditional nucleic acid extraction methods, such as alkaline lysis and phenol extraction, have been gradually replaced by centrifugal column extraction, anion exchange, and magnetic bead extraction due to their complex procedures, time-consuming nature, and low efficiency. Centrifugal column extraction was once widely used, but the emergence of magnetic bead extraction, characterized by its simplicity, reduced time consumption, and high degree of automation, has made it the predominant nucleic acid extraction method currently used in various fields. Compared to other methods, magnetic bead extraction is simpler to operate, applicable to a wide range of sample types, and exhibits lower sample requirements. Surface-modified nanoparticles can specifically adsorb nucleic acids in high-salt, low-pH solutions. Under the influence of an external magnetic field and a washing solution, nucleic acids are separated from biomacromolecules such as proteins, polysaccharides, and lipids. High-quality nucleic acids can then be obtained by modifying the solution's pH or increasing the temperature to separate the beads from the nucleic acids. Furthermore, the magnetic bead method can be used in conjunction with automated nucleic acid extraction equipment, enabling automated and high-throughput nucleic acid extraction. During the implementation of the present invention, the inventors discovered that the mixing effect of the microfluidic platform was weak, and conventional nucleic acid extraction reagents could not support direct nucleic acid lysis and purification on the microfluidic platform.
[0004] With the advancement of microfluidics in molecular diagnostics, an increasing number of microfluidics-related molecular detection products have emerged. Nucleic acid extraction methods vary, including the membrane filter method mentioned above (e.g., Cepheid's and Qiagen's POCT products, which both use column membrane methods for nucleic acid extraction), but most products utilize magnetic bead methods. Some international products, such as Biofire's, GenMark's, and Baebies' POCT products, all use the classic magnetic bead method for nucleic acid extraction.
[0005] However, most of the aforementioned manufacturers' methods for nucleic acid extraction using magnetic beads are not compatible with direct electrowetting platform extraction. For example, Biofire uses film extrusion to control the movement of magnetic beads in the reagent; Cepheid uses a pump-valve structure to control the flow of liquids, while Qiagen and GenMark both use pump-valve structures. GenMark claims to use electrowetting control, but its nucleic acid extraction steps actually use pump-valve control, and the post-extraction steps are performed on the electrowetting platform. Currently, there are no products that directly extract nucleic acids on an electrowetting platform by controlling the movement of reagents. Summary of the Invention
[0006] In view of this, the technical problem to be solved by the present invention is to provide a nucleic acid extraction reagent combination and application thereof. The nucleic acid extraction reagent combination provided by the present invention can perform rapid nucleic acid extraction on an electrowetting platform.
[0007] The present invention provides a reagent combination, comprising a lysate, a washing solution and an eluent, wherein:
[0008] The lysate comprises 2-4 M guanidine salt, 8 vol%-12 vol% surfactant A and a buffer;
[0009] The washing solution and the eluent include 0.05 vol% to 5 vol% of surfactant B and a buffer solution;
[0010] The washing solution also includes 0.2-1 g / L proteinase K.
[0011] In the lysate of the present invention, high concentration of guanidine salt is used as the main component of lysis reagent, auxiliary lysis is heated in the lysis step, and cracking and nucleic acid adsorption are carried out simultaneously, shortening the extraction time; A surfactant of appropriate concentration is added in lysate, washing solution and eluent, so that reagent combination can be better driven on the electrowetting platform, thereby improving driving force and increasing mixing effect; Proteinase K is added in washing solution simultaneously, achieving the step of washing protein with high concentration salt common in magnetic bead extraction method, only one step washing is needed in the present invention, further shortening the extraction time. Compared with prior art, the reagent combination provided by the present invention has strong compatibility between each component, synergistic effect, so as to obtain more accurate technical effect.
[0012] In some embodiments, the concentration of the buffer in the lysate is 20-100 mM;
[0013] In the washing solution and the eluent, the concentration of the buffer solution is 1 to 20 mM;
[0014] In some embodiments, the guanidine salt comprises guanidine isothiocyanate and / or guanidine thiocyanate;
[0015] The surfactant A comprises at least one of polyoxyethylene lauryl ether, polysorbate, fatty acid glyceride, polyoxyethylene fatty alcohol ether, Triton 100, cetyltrimethylammonium bromide and sodium lauryl sulfate;
[0016] The buffer comprises citric acid buffer and / or Tris hydrochloric acid buffer;
[0017] The surfactant B includes at least one of a polyoxypropylene polyoxyethylene copolymer surfactant, a polyethylene glycol octylphenyl ether surfactant, a polyether surfactant, and a polysorbate surfactant.
[0018] In some embodiments, the guanidine salt is guanidine isothiocyanate, the surfactant A is polyoxyethylene lauryl ether, the buffer is Tris hydrochloric acid buffer, and the surfactant B is a polyoxypropylene polyoxyethylene copolymer surfactant and a polyethylene glycol octylphenyl ether surfactant;
[0019] Preferably, the surfactant B is poloxamer and Triton X-100.
[0020] In some embodiments, the lysate further comprises 0.0001 vol% to 0.001 vol% of a defoaming agent, wherein the defoaming agent comprises at least one of a polyether defoaming agent, a silicone defoaming agent, and a mineral oil defoaming agent;
[0021] Preferably, the defoaming agent is a silicone defoaming agent;
[0022] More preferably, the defoaming agent is silicone.
[0023] Compared with other reagents, the use of the above-mentioned reagents in the lysis solution can further improve the efficiency of nucleic acid lysis and nucleic acid adsorption, and the compatibility between the various components is stronger, synergistically enhancing the effect, thereby achieving more accurate technical effects. The use of the above-mentioned reagents in the washing solution and the eluent can further improve the driving force of the reagents on the electrowetting platform, further enhance the mixing effect, and the compatibility between the various components is stronger, synergistically enhancing the effect, thereby achieving more accurate technical effects.
[0024] In some specific embodiments, the lysis solution comprises 4 M guanidine thiocyanate, 10 vol% polyoxyethylene lauryl ether, 60 mM Tris hydrochloric acid buffer and 0.0005 vol% silicone;
[0025] The washing solution and the elution solution include 1 mg / L poloxamer 188, 1 vol% Triton X-100 and 10 mM Tris hydrochloric acid buffer;
[0026] The wash solution also included 500 mg / L Proteinase K.
[0027] Experimental verification shows that the combination of reagents at the above concentrations has the strongest compatibility between the components, synergistic effects, and the highest efficiency in nucleic acid extraction, thereby achieving the most accurate technical effect.
[0028] The present invention provides application of the reagent combination in preparing a nucleic acid extraction reagent or a kit.
[0029] The present invention provides a nucleic acid extraction reagent or kit, comprising the reagent combination and acceptable auxiliary materials or additives.
[0030] In some embodiments, a microfluidic chip is further included, wherein the microfluidic chip is provided with a reaction chamber.
[0031] The present invention provides a method for extracting nucleic acid, which uses the reagent combination or the nucleic acid extraction reagent or kit to extract the nucleic acid of a sample to be tested.
[0032] In some embodiments, the steps include:
[0033] Step 1: taking the lysate, sample and magnetic beads, mixing, incubating, magnetically aspirating and removing waste liquid;
[0034] Step 2: Take the magnetic beads after removing the waste liquid in step 1, wash them with the washing solution, magnetically absorb them, discard the waste liquid, and then elute them with the elution solution at high temperature to obtain the nucleic acid of the sample.
[0035] In some embodiments, in step 1, the incubation temperature is 25-35° C., the incubation time is 2-7 min, and the magnetic attraction time is 30 s-2 min;
[0036] In step 2, the washing time of the washing solution is 30s to 2min, the magnetic adsorption time is 30s to 2min, the temperature of the high-temperature elution is 90 to 110°C, and the high-temperature elution time is 1 to 5min.
[0037] In some specific embodiments, in step 1, the incubation temperature is 25° C., the incubation time is 5 min, and the magnetic attraction time is 1 min;
[0038] In step 2, the washing time of the washing solution is 1 minute, the magnetic adsorption time is 1 minute, the temperature of the high-temperature elution is 105° C., and the high-temperature elution time is 3 minutes.
[0039] In other embodiments, the reactions of step 1 and step 2 are performed in a reaction chamber of the microfluidic chip, wherein:
[0040] In step 1, the lysate, sample, and magnetic beads are mixed in the reaction chamber, the incubation temperature is 70-85° C., the magnetic attraction is performed 2-6 times, each for 10 seconds, and the magnetic attraction is performed 4 times, each for 30 seconds, to fully capture the nucleic acid by the magnetic beads;
[0041] In step 2, the washing time of the washing solution is 30s to 2min, the magnetic adsorption time is 30s to 2min, the temperature of the high-temperature elution is 90 to 110°C, and the high-temperature elution time is 1 to 5min.
[0042] In some specific embodiments, in step 1, the incubation temperature is 80° C., and the number of magnetic attraction is 4 times, each time for 10 seconds;
[0043] In step 2, the washing time of the washing solution is 1 minute, the magnetic adsorption time is 1 minute, the temperature of the high-temperature elution is 105° C., and the high-temperature elution time is 3 minutes.
[0044] Compared with the prior art, the extraction method of the present invention adds heat to assist lysis in the lysis step, and simultaneously realizes lysis and nucleic acid adsorption, thereby shortening the extraction time; high-temperature elution is adopted when eluting nucleic acids, which, on the one hand, can fully separate the nucleic acids from the magnetic beads and increase the nucleic acid yield; on the other hand, the high temperature inactivates proteinase K without affecting the subsequent nucleic acid amplification step, thereby obtaining a more accurate technical effect.
[0045] The present invention provides a reagent combination that is simultaneously adapted to both common nucleic acid extraction and nucleic acid extraction using an electrowetting platform. The reagent combination provided by the present invention adds high-concentration guanidine isothiocyanate to a lysate, heats the lysate during the lysate step to assist lysis, and simultaneously achieves lysis and nucleic acid adsorption, thereby shortening the extraction time. A surfactant of appropriate concentration is added to the lysate, washing solution, and eluent, so that the reagent combination can be better driven on the electrowetting platform, thereby enhancing the driving force and increasing the mixing effect. Proteinase K is added to the washing solution, thereby eliminating the common step of washing proteins with high-concentration salt in magnetic bead extraction methods, achieving a better washing effect with only one washing step, further shortening the extraction time. Meanwhile, residual proteinase K in the washing solution is inactivated by high-temperature elution, so that it does not affect subsequent amplification, and is suitable for popularization and application. BRIEF DESCRIPTION OF THE DRAWINGS
[0046] Figure 1 Schematic diagram of droplet manipulation based on electrowetting in the background technology, wherein Figure a is a schematic diagram of the state where the droplet is in hydrophobic equilibrium on the driving electrode, and Figure b is a schematic diagram of the state where the droplet is spreading to the right on the driving electrode. DETAILED DESCRIPTION
[0047] The present invention provides nucleic acid extraction reagent combinations and applications thereof. Those skilled in the art can refer to the contents herein and appropriately improve the process parameters to achieve the desired results. It should be noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications herein without departing from the content, spirit, and scope of the present invention to implement and apply the technology of the present invention.
[0048] In some embodiments, the present invention optimizes the lysis solution formulation by adding a high concentration of guanidine salt (2-4 mol / L, the commonly used concentration is 1-2 mol / L) to the lysis solution.
[0049] In some embodiments, the guanidine salt is guanidine isothiocyanate or guanidine thiocyanate.
[0050] In some embodiments, surfactants are of various types, such as cationic surfactants, anionic surfactants, zwitterionic surfactants, and nonionic surfactants. After screening, a surfactant-nonionic surfactant is found to be more suitable for use in an electrowetting platform.
[0051] In some embodiments, the amount of nonionic surfactant used is 8 vol% to 12 vol%. By adding a high concentration of surfactant to the lysis solution, the surface tension between the liquids is reduced, so that the liquid can obtain a stronger driving force on the electrowetting platform.
[0052] In some embodiments, there are many non-ionic surfactants such as polysorbate (Tween) chemicals, fatty acid glycerides, polyoxyethylene fatty alcohol ethers, etc. In the lysis solution, we preferably use 10% polyoxyethylene lauryl ether, which can not only enhance the driving force of the liquid reagent on the electrowetting platform, but also further lyse the cells.
[0053] In some embodiments, the lysis solution contains a buffer solution, which ensures the efficiency and stability of the nucleic acid release process by maintaining the pH stability and ion environment balance of the lysis system, while protecting the nucleic acid from degradation or destruction, and better promoting the binding of magnetic beads and nucleic acids.
[0054] In some embodiments, the pH value of the lysis solution is adjusted to between 2 and 5, so that cell lysis and nucleic acid binding on magnetic beads are completed in one step, saving time.
[0055] In some embodiments, a citric acid buffer system or a Tris-HCl buffer system is used as the pH buffer system.
[0056] In some embodiments, a certain amount of proteinase K is added to the washing solution. Common nucleic acid extraction reagents all have two washes. The first step is to use a high concentration of salt to wash the magnetic beads to wash off some proteins on the magnetic beads. The second step is to use a low concentration of salt to wash the magnetic beads to wash off the high concentration of salt ions in the first step. The present invention uses the aforementioned method to omit the salt washing step, so that a better washing effect can be achieved with only one wash, further saving extraction time.
[0057] In some embodiments, unlike the nucleic acid extraction process in which proteinase K is often added directly to the sample and the commonly used dosage is 50-200 mg / L, the proteinase K content in the wash solution of the present invention is 0.2-1 g / L and is added to the wash solution to achieve the purpose of fully digesting the mucin in the sample.
[0058] In some embodiments, the washing solution also contains a buffer solution, which can maintain a stable binding between the nucleic acid and the magnetic beads, protect the nucleic acid from enzymatic or chemical damage, and efficiently remove contaminants such as proteins, lipids, and salts.
[0059] In some embodiments, the buffer comprises citrate buffer and / or Tris-HCl buffer.
[0060] In some embodiments, the wash solution contains 1-20 mM Tris-HCl.
[0061] In some embodiments, the pH value of the washing solution is about 6-8, which can not only maintain the activity of proteinase K but also wash away the salt ions remaining after the first step of lysis.
[0062] In some embodiments, a certain amount of surfactant is also added to the washing solution. The surfactant added to the washing solution should be considered to prevent its residue from affecting the subsequent PCR amplification process. After screening, we also selected a non-ionic surfactant in the washing solution.
[0063] In some embodiments, Poloxamer 188 and Triton X-100 are added to the wash solution to increase the driveability of the droplets on the electrowetting platform.
[0064] In some embodiments, the eluent contains a buffer solution that can maintain a suitable pH value, making it easier for the nucleic acids to dissociate from the magnetic beads. At the same time, the suitable pH value does not affect subsequent PCR amplification.
[0065] In some embodiments, the buffer in the eluent includes citrate buffer and / or Tris-HCl buffer.
[0066] In some embodiments, the pH value of the elution solution is adjusted to between 8 and 9, and the nucleic acid is eluted from the magnetic beads by creating a low-salt, high-pH environment.
[0067] In some embodiments, high temperature elution is performed to inactivate residual proteinase K in the washing solution so as not to affect subsequent amplification.
[0068] In some embodiments, in order to increase the driving performance of the eluent on the electrowetting platform, a certain amount of surfactant needs to be added to the eluent.
[0069] In some embodiments, since the eluate needs to be directly used for PCR amplification, the surfactant should not affect the subsequent PCR amplification. After screening, we selected Poloxamer 188 and Triton X-100 with the same concentration as that in the eluate.
[0070] The technical solution provided by this invention solves the problems of complex structure, high failure rate, and high production cost encountered by other similar platforms using pump-valve structures and film extrusion control. It also solves the long extraction time problem of other similar platforms, and no related electrowetting products use this method for nucleic acid extraction.
[0071] The test materials used in the present invention are all common commercial products and can be purchased in the market. The present invention will be further described below with reference to the examples.
[0072] Example 1
[0073] This embodiment provides a nucleic acid extraction reagent, including a lysate, a wash solution, and an eluate, wherein:
[0074] The lysis solution includes: guanidine salt, surfactant, and buffer. Guanidine salt includes guanidine isothiocyanate or guanidine thiocyanate. There are many different types of surfactants, such as cationic surfactants, anionic surfactants, zwitterionic surfactants and non-ionic surfactants. After screening, a surfactant that is more suitable for use on the electrowetting platform was found - non-ionic surfactant. There are many non-ionic surfactants, such as: polysorbate (Tween) chemicals, fatty acid glycerides, polyoxyethylene fatty alcohol ethers, etc.; the buffer includes a citric acid buffer system or Tris hydrochloric acid buffer.
[0075] Washing solution: proteinase K, surfactant (poloxamer 188, Triton X-100), buffer (Tris-HCL),
[0076] The eluent includes: surfactants (poloxamer 188 and Triton X-100), buffer (Tris-HCl buffer)
[0077] In this example, lysates, washes, and eluates of different components and concentrations were screened to extract nucleic acids from rhinovirus and Bordetella pertussis samples. By comparing the extraction results, a reagent combination suitable for nucleic acid extraction on an electrowetting platform was determined.
[0078] Samples: Clinical samples of rhinovirus and Bordetella pertussis - throat swabs, rhinovirus is the viral target, Bordetella pertussis is the bacterial target.
[0079] The primer and probe sequences for rhinovirus detection are from the published patent CN 108546786A.
[0080] F:GACTCGCAGCTATCGCACA(SEQ ID NO:1)
[0081] R: CAGTCGACACATCAATCG (SEQ ID NO: 2)
[0082] T: GAGGATCTACGTCTGTAGCGGC (SEQ ID NO: 3), the fluorescent group selected was ROX, and the quenching group selected was BHQ2.
[0083] The primer and probe sequences for detecting Bordetella pertussis are from the detection sequences of Bordetella pertussis in the published patent CN 109402296 A.
[0084] F: CAGCGCTAGCTGCAATCC (SEQ ID NO:4)
[0085] R:GCTAGCTGGCTACTGAGC(SEQ ID NO:5)
[0086] T: CGTCCTAGACTAGCGTTCAATACAG (SEQ ID NO: 6) The fluorescent group selected is CY5, and the quenching group selected is BHQ2.
[0087] The amplification program was: 50°C for 2 min, 95°C for 1 min, and 45 cycles of (95°C for 5 s, 60°C for 22 s).
[0088] The result analysis refers to the comparison of the size of the CT value. The smaller the CT value, the more nucleic acid there is. A 1-digit increase in the CT value means a 2-fold difference in the amount of nucleic acid.
[0089] The basic formula includes:
[0090] The lysis buffer consisted of 4 M guanidine isothiocyanate, 10 vol% polyoxyethylene lauryl ether, and 60 mM Tris-HCl buffer;
[0091] The wash solution included 500 mg / L proteinase K, 1 mg / L poloxamer 188, 1 vol% Triton X-100, and 10 mM Tris-HCl buffer;
[0092] The eluent includes 1 mg / L poloxamer 188 (HLB=16), 1 vol% Triton X-100 and 10 mM Tris hydrochloric acid buffer, wherein the pH of the lysate is 4, the pH of the washing solution is 6, and the pH of the eluent is 9.
[0093] The following experiments 1 to 6 were performed by changing the components and dosage settings in the basic formula.
[0094] Experiment 1: Comparison of different concentrations of guanidine thiocyanate.
[0095] Samples: Clinical samples of rhinovirus and Bordetella pertussis - throat swabs, rhinovirus is the viral target, Bordetella pertussis is the bacterial target.
[0096] Experimental plan: The concentration of guanidine isothiocyanate, the main component in the lysate, was compared and verified. The test results are shown in Table 1 below:
[0097] The concentration of formula 1 is 0.5 M guanidine thiocyanate, 10% polyoxyethylene lauryl ether, 60 mM Tris-HCl, and 0.0005% defoaming agent silicone.
[0098] The concentration of formula 2 is 1 M guanidine thiocyanate, 10% polyoxyethylene lauryl ether, 60 mM Tris-HCl, and 0.0005% defoaming agent silicone.
[0099] The concentration of formula 3 is 2M guanidine thiocyanate, 10% polyoxyethylene lauryl ether, 60mM Tris-HCl, and 0.0005% defoaming agent silicone.
[0100] The concentration of formula 4 isothiocyanate is 4M, 10% polyoxyethylene lauryl ether, 60mM Tris-HCl, and 0.0005% defoaming agent silicone.
[0101] The concentration of formula 5 guanidine isothiocyanate is 5M, 10% polyoxyethylene lauryl ether, 60mM Tris-HCl, and 0.0005% defoaming agent silicone.
[0102] The concentration of formula 6 guanidine isothiocyanate is 4 M, 10% polyoxyethylene lauryl ether, and 60 mM Tris-HCl.
[0103] Result analysis:
[0104] From the analysis of the results in Table 1, it was found that there was a certain optimal range for the concentration of guanidine isothiocyanate in the lysate. Guanidine isothiocyanate worked best when the concentration was greater than 1 M, and 4 M was the best. The lower the concentration, the worse the effect. The defoaming agent could eliminate the influence of foam on the mixing effect, but the effect was limited and did not affect the Ct value of the experiment.
[0105] Table 1
[0106]
[0107] Experiment 2: The types of surfactants in the lysis buffer were compared.
[0108] Samples: Clinical samples of rhinovirus and Bordetella pertussis - throat swabs, rhinovirus is the viral target, Bordetella pertussis is the bacterial target.
[0109] Experimental plan: The types of surfactants in the lysate were compared and verified. The test results are shown in Table 2 below:
[0110] The surfactant type in the lysis solution of Formula 1 is a nonionic surfactant - polyoxyethylene lauryl ether, the concentration of guanidine isothiocyanate is 4M, 60mM Tris-HCl, and 0.0005% of defoaming agent silicone.
[0111] The surfactant type in the lysis solution of Formula 2 is a non-ionic surfactant - Triton X-100, the concentration of guanidine isothiocyanate is 4M, 60mM Tris-HCl, and 0.0005% of the defoaming agent silicone.
[0112] The surfactant type in the lysis solution of formula 3 is a cationic surfactant - hexadecyltrimethylammonium bromide, the concentration of guanidine isothiocyanate is 4M, 60mM Tris-HCl, and 0.0005% of the defoaming agent silicone.
[0113] The surfactant type in the lysis solution of formula 4 is an anionic surfactant - sodium dodecyl sulfate (SDS), the concentration of guanidine isothiocyanate is 4M, 60mM Tris-HCl, and 0.0005% of defoaming agent silicone.
[0114] Result analysis:
[0115] From the analysis of the results, it was found that different types of surfactants are different. The phenomenon is that different types of surfactants have inconsistent driving forces. Poor driving forces lead to poor extraction effects. The most suitable type of surfactant in the present invention is non-ionic surfactant, and the best is polyoxyethylene lauryl ether.
[0116] Table 2
[0117]
[0118]
[0119] Experiment 3: Whether to add proteinase K to the washing solution.
[0120] Samples: Clinical samples of rhinovirus and Bordetella pertussis - throat swabs, rhinovirus is the viral target, Bordetella pertussis is the bacterial target.
[0121] Experimental plan: A comparative verification was conducted on whether proteinase K was added to the washing solution. The test results are shown in Table 3 below.
[0122] Formula 1: Add 500 mg / L proteinase K, 10 mM Tris-HCl, 1 mg / L poloxamer F68, and 1% Triton X-100 to the washing solution.
[0123] The washing solution of formula 2 contains no proteinase K, 10 mM Tris-HCl, 1 mg / L Poloxamer F68, and 1% Triton X-100.
[0124] Result analysis:
[0125] The results showed that adding proteinase K to the wash solution was beneficial. The addition of proteinase K eliminated the traditional salt wash step, achieving the same effect as the traditional two-step wash with just one wash.
[0126] Table 3
[0127]
[0128] Experiment 4: Verification of polyoxyethylene lauryl ether (non-ionic surfactant) in the lysis buffer; comparison of guanidine isothiocyanate and guanidine hydrochloride in the lysis buffer; verification of the key surfactant poloxamer 188 (non-ionic surfactant) in the eluent.
[0129] Samples: Clinical samples of rhinovirus and Bordetella pertussis - throat swabs, rhinovirus is the viral target, Bordetella pertussis is the bacterial target.
[0130] Experimental plan: The main component of the lysate, polyoxyethylene lauryl ether, was compared and verified, and the main component of the lysate, guanidine isothiocyanate, was compared and verified. The test results are shown in Table 4 below.
[0131] The concentration of guanidine isothiocyanate in the lysis solution of formula 1 is 4 M, 10% polyoxyethylene lauryl ether, 60 mM Tris-HCl, and 0.0005% defoaming agent silicone.
[0132] The concentration of guanidine isothiocyanate in the lysis buffer of formula 2 is 4 M, 60 mM Tris-HCl, and 0.0005% of defoaming agent silicone.
[0133] The concentration of guanidine isothiocyanate in the lysis solution of formula 3 is 4 M, 10% polyoxyethylene lauryl ether, 60 mM Tris-HCl, and 0.0005% defoaming agent silicone.
[0134] The concentration of guanidine hydrochloride in the lysis solution of formula 4 is 4M, 10% polyoxyethylene lauryl ether, 60mM Tris-HCl, and 0.0005% defoaming agent silicone.
[0135] Result analysis:
[0136] The results showed that the non-ionic surfactant in the lysis buffer can improve the controllability of the lysis buffer on the electrowetting platform to a certain extent, and can also play a role in lysing cells to a certain extent; at the same time, the main component of the lysis buffer, guanidine isothiocyanate, was replaced with guanidine hydrochloride. The lysis effect was slightly different, but both could achieve effective extraction of nucleic acids.
[0137] Table 4
[0138]
[0139] Experiment 5: Comparison of surfactant concentrations in the eluate.
[0140] Samples: Clinical samples of rhinovirus and Bordetella pertussis - throat swabs, rhinovirus is the viral target, Bordetella pertussis is the bacterial target.
[0141] Experimental plan: The range of surfactant concentration in the eluate was verified, and the test results are shown in Table 5 below.
[0142] The concentration of poloxamer 188 in the eluent of Formula 1 is 0.05%, 10 mM Tris-Hcl, 1% Triton X-100.
[0143] The concentration of poloxamer 188 in the eluent of Formula 2 is 0.1%, 10 mM Tris-Hcl, 1% Triton X-100.
[0144] The concentration of poloxamer 188 in the eluent of Formula 3 is 0.5%, 10 mM Tris-Hcl, 1% Triton X-100.
[0145] The concentration of poloxamer 188 in the eluent of Formula 4 is 1%, 10 mM Tris-Hcl, 1% Triton X-100.
[0146] The concentration of poloxamer 188 in the eluent of Formula 5 is 1.5%, 10 mM Tris-Hcl, 1% Triton X-100.
[0147] The concentration of Triton X-100 in the eluent of Formula 6 is 0.005%, the concentration of poloxamer 188 is 1%, and the concentration of Tris-Hcl is 10 mM.
[0148] The concentration of Triton X-100 in the eluent of Formula 7 is 0.01%, the concentration of poloxamer 188 is 1%, and the concentration of Tris-Hcl is 10 mM.
[0149] The concentration of Triton X-100 in the eluent of Formula 8 is 0.5%, the concentration of poloxamer 188 is 1%, and the concentration of Tris-Hcl is 10 mM.
[0150] The concentration of Triton X-100 in the eluent of Formula 9 is 1%, the concentration of poloxamer 188 is 1%, and the concentration of Tris-Hcl is 10 mM.
[0151] The concentration of Triton X-100 in the eluent of Formula 10 is 1.5%, the concentration of poloxamer 188 is 1%, and the concentration of Tris-Hcl is 10 mM.
[0152] Result analysis:
[0153] From the result analysis, it is found that after adding non-ionic surfactant poloxamer 188 in the eluent, the controllability of the eluent on the electrowetting platform can be greatly enhanced, and the extraction efficiency on the electrowetting microfluidic platform can be improved. The concentration of surfactant in the eluent has a certain optimal range.
[0154] Table 5
[0155]
[0156]
[0157] Experiment 6: Comparison of surfactant concentrations in washing solutions.
[0158] Samples: Clinical samples of rhinovirus and Bordetella pertussis - throat swabs, rhinovirus is the viral target, Bordetella pertussis is the bacterial target.
[0159] Experimental plan: The range of surfactant concentration in the wash solution was verified, and the results are shown in Table 6.
[0160] The concentration of Poloxamer 188 in the washing solution of Formula 1 is 0.05 mg / L, 10 mM Tris-HCl, 1% Triton X-100, and 500 mg / L Proteinase K.
[0161] The concentration of Poloxamer 188 in the washing solution of Formula 2 is 0.1 mg / L, 10 mM Tris-HCl, 1% Triton X-100, and 500 mg / L Proteinase K.
[0162] The concentration of Poloxamer 188 in the washing solution of Formula 3 is 0.5 mg / L, 10 mM Tris-HCl, 1% Triton X-100, and 500 mg / L Proteinase K.
[0163] The concentration of Poloxamer 188 in the washing solution of Formula 4 is 1 mg / L, 10 mM Tris-HCl, 1% Triton X-100, and 500 mg / L Proteinase K.
[0164] The concentration of Poloxamer 188 in the washing solution of Formula 5 is 1.5 mg / L, 10 mM Tris-HCl, 1% Triton X-100, and 500 mg / L Proteinase K.
[0165] The concentration of Triton 100 in the washing solution of Formula 6 is 0.005%, the concentration of Poloxamer 188 is 1 mg / L, 10 mM Tris-HCl, and 500 mg / L Proteinase K.
[0166] The concentration of Triton 100 in the washing solution of Formula 7 is 0.01%, the concentration of Poloxamer 188 is 1 mg / L, 10 mM Tris-HCl, and 500 mg / L Proteinase K.
[0167] The concentration of Triton 100 in the washing solution of Formula 8 is 0.5%, the concentration of Poloxamer 188 is 1 mg / L, 10 mM Tris-HCl, and 500 mg / L Proteinase K.
[0168] The concentration of Triton X-100 in the formula 9 washing solution is 1%, the concentration of poloxamer 188 is 1 mg / L, 10 mM Tris-Hcl, 500 mg / L protease K.
[0169] The concentration of Triton X-100 in the formula 10 washing solution is 1.5%, the concentration of poloxamer 188 is 1 mg / L, 10 mM Tris-Hcl, 500 mg / L protease K.
[0170] Table 6
[0171]
[0172] Result analysis:
[0173] It is found from the results in Table 6 that the concentration of surfactant in the washing solution has an optimal range, and the formula 8 has the best effect, in which the concentration of Triton X-100 is 0.5%, the concentration of poloxamer 188 is 1 mg / L, 10 mM Tris-Hcl, and 500 mg / L protease K.
[0174] Comparative example
[0175] The example 37 in the patent CN118421619A is selected as a control because the nucleic acid release effect of the example 37 is relatively good, and the disclosed formula is as shown in Table 7:
[0176] Table 7
[0177] Nucleic acid releaser concentration Guanidine thiocyanate 60mM Ammonium chloride 80mM Tris-HCl 6mM SDS 0.10% Proteinase K 9:1
[0178] The operation steps are as follows: 100 μL of the release agent is taken, 10 μL of the sample is added, oscillation is performed for 15 s, incubation is performed at 65℃ for 5 min, then incubation is performed at 95℃ for 3 min, and then centrifugation is performed for 3 min. The supernatant is taken for machine amplification.
[0179] According to the formula, the reagent is prepared, after preparation, the operation is performed, the sample is selected as a throat swab of a clinical sample of a rhinovirus and a Bordetella pertussis bacterium. 10 μL of liquid is taken and added to 100 μL of the release agent, and after the operation is completed, the supernatant is taken for PCR amplification. At the same time, 200 μL of the sample is taken on a microfluidic platform to extract nucleic acid by using the reagent formula of the patent, and the extracted nucleic acid is subjected to PCR amplification.
[0180] The reagent formula of the present application is shown in Table 8.
[0181] Table 8
[0182]
[0183] Procedure: Add 400 μL of lysis buffer to 200 μL of sample, then 50 μL of magnetic beads. Mix thoroughly, incubate at room temperature for 5 minutes, magnetically absorb for 1 minute, discard the waste solution, add 400 μL of wash buffer, wash for 1 minute, magnetically absorb for 1 minute, discard the waste solution, add 50 μL of elution buffer, and elute at high temperature for 3 minutes. The resulting nucleic acid is amplified by PCR.
[0184] The comparison results are shown in Table 9 below.
[0185] Table 9
[0186]
[0187] As can be seen from Table 9, the nucleic acids extracted by the present invention all showed the same value, while the nucleic acids released by the nucleic acid releaser of the comparative patent all showed the same value, which proves that the present invention is far superior to the comparative patent.
[0188] Effect Example 1
[0189] Further explore the effect of the reagent combination provided by the present invention on the extraction of nucleic acid on the electrowetting platform. Taking the formula in Table 8 as an example, the timing is set on the electrowetting platform. First, the lysate is separated, and a part is transported to the magnetic bead drying position. The magnetic beads are dissolved by heating and the movement of the liquid. Then the sample, magnetic beads and lysate are mixed together, and the mixing action is set to alternate up and down and left and right. It runs for 72 seconds. While running, the temperature under the electrode plate is set to 80°C to accelerate lysis. After the lysis is completed, the upper magnetic suction is set 4 times, each for 10 seconds, and the lower magnetic suction is set 4 times, each for 30 seconds, to complete the full capture of nucleic acid by the magnetic beads. Then the waste liquid after lysis is moved to the waste liquid bin. Then the wash solution is transported to the magnetic beads with nucleic acid, the magnetic beads are released, and the magnetic beads are mixed with the wash solution and washed for 60 seconds. Then the waste liquid is moved to the waste liquid bin. Then the eluent is transported to the magnetic beads to dissolve the magnetic beads. At the same time, the elution temperature is set to 105°C, and the magnetic beads are eluted at high temperature for 3 minutes to elute the nucleic acid from the magnetic beads, and finally the nucleic acid is obtained.
[0190] Using Antu Bio's commercially available extraction reagent, registration number: Yuzheng Xiebei 20180037, as a comparative reagent, a parallel comparison was performed using the method flow and reagents described in this invention, using the same sample volume and the same amount of eluent to achieve the same concentration multiple. Different types of samples were then used, including viral samples such as influenza A, bacterial samples such as Bordetella parapertussis, quasi-bacterial samples such as Mycoplasma pneumoniae, and fungal samples such as yeast. Parallel comparisons were then performed on the same amplification platform using the same nucleic acid amplification reagent, and the nucleic acid extraction capabilities were compared by comparing the CT values between the two different methods.
[0191] For comparison, the commercially available extraction reagent from Antu Biotechnology (registration number: Yuzheng Xiebei 20180037) takes approximately 20 minutes to complete, requiring manual operation. The electrowetting platform of the present invention only requires manual sample addition, after which the platform automatically completes nucleic acid extraction. The comparative results are shown in Table 10.
[0192] Table 10 Comparison results of Antu extraction reagent and electrowetting platform extraction
[0193]
[0194]
[0195] The results in Table 10 show that the electrowetting platform is as capable of extracting nucleic acids as commercially available extraction kits. Furthermore, the process is compressed to 11 minutes and requires no manual operation, demonstrating the wide applicability of the present invention.
[0196] The above are only preferred embodiments of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.
Claims
1. A reagent combination, characterized in that It includes lysis buffer, washing buffer and elution buffer, wherein: The lysate comprises 2-4 M guanidine salt, 8 vol%-12 vol% surfactant A and a buffer; The washing solution and the eluent include 0.05 vol% to 5 vol% of surfactant B and a buffer solution; The washing solution also includes 0.2-1 g / L proteinase K.
2. The reagent combination according to claim 1, characterized in that The guanidine salt includes guanidine isothiocyanate and / or guanidine thiocyanate; The surfactant A comprises at least one of polyoxyethylene lauryl ether, polysorbate, fatty acid glyceride, polyoxyethylene fatty alcohol ether, Triton 100, cetyltrimethylammonium bromide and sodium lauryl sulfate; The buffer comprises citric acid buffer and / or Tris hydrochloric acid buffer; The surfactant B includes at least one of a polyoxypropylene polyoxyethylene copolymer surfactant, a polyethylene glycol octylphenyl ether surfactant, a polyether surfactant, and a polysorbate surfactant.
3. The reagent combination according to claim 1 or 2, characterized in that The guanidine salt is guanidine isothiocyanate, the surfactant A is polyoxyethylene lauryl ether, the buffer is Tris hydrochloric acid buffer, and the surfactant B is a polyoxypropylene polyoxyethylene copolymer surfactant and a polyethylene glycol octylphenyl ether surfactant; Preferably, the surfactant B is poloxamer and Triton X-100.
4. The reagent combination according to any one of claims 1 to 3, characterized in that The lysis solution further includes 0.0001 vol% to 0.001 vol% of a defoamer, wherein the defoamer includes at least one of a polyether defoamer, a silicone defoamer, and a mineral oil defoamer; Preferably, the defoaming agent is a silicone defoaming agent; Preferably, the defoaming agent is silicone.
5. Use of the reagent combination according to any one of claims 1 to 4 in the preparation of a nucleic acid extraction reagent or kit.
6. A nucleic acid extraction reagent or kit, characterized in that: The invention comprises the reagent combination according to any one of claims 1 to 4, and acceptable excipients or auxiliary agents.
7. The nucleic acid extraction reagent or kit according to claim 6, characterized in that It also includes a microfluidic chip, which is provided with a reaction chamber.
8. A method for extracting nucleic acid, characterized in that: The nucleic acid of the sample to be tested is extracted using the reagent combination according to any one of claims 1 to 4 or the nucleic acid extraction reagent or kit according to claim 6 or 7.
9. The extraction method according to claim 8, characterized in that The steps include: Step 1: taking the lysate, sample and magnetic beads, mixing, incubating, magnetically aspirating and removing waste liquid; Step 2: Take the magnetic beads after removing the waste liquid in step 1, wash them with the washing solution, magnetically absorb them, discard the waste liquid, and then elute them with the elution solution at high temperature to obtain the nucleic acid of the sample.
10. The extraction method according to claim 9, characterized in that The reactions of step 1 and step 2 are carried out in the reaction chamber of the microfluidic chip.
Citation Information
Patent Citations
Kit for detecting rhinoviruses, respiratory syncytial viruses and parainfluenza viruses and use method thereof
CN108546786A
Kit for detecting ADV (respiratory adenovirus), SP (Streptococcus pneumoniae) and BP (Bordetella pertussis) simultaneously and use method of kit
CN109402296A
Kit for nucleic acid extraction with magnetic bead method, magnetic bead and preparation method of magnetic bead
CN112980830A
Rapid nucleic acid extraction or purification kit
CN116179535A
Nucleic acid rapid extraction reagent, nucleic acid extraction method and application
CN118421619A