SfLox gene and construction method and application of high-toxicity metarhizium anisopliae engineering bacteria targeting SfLox gene

Abstract

The invention discloses a sogatella furcifera SfLox gene, dsRNA (double-stranded ribonucleic acid), a high-toxicity metarhizium anisopliae engineering bacterium and application of the high-toxicity metarhizium anisopliae engineering bacterium in prevention and treatment of sogatella furcifera. The SfLox gene has the effect of regulating and controlling the immunity of sogatella furcifera, the SfLox gene is placed in a pK2-PgpdM-pB plasmid expression vector and then transferred into fungi to obtain a high-toxicity metarhizium anisopliae engineering bacterium, and the engineering bacterium can produce dsRNA for expressing the immunosuppressive ability of sogatella furcifera and send the dsRNA into host cells, so that the expression quantity of the SfLox gene of sogatella furcifera is remarkably reduced; therefore, the pathogenicity of the metarhizium anisopliae to the sogatella furcifera is remarkably improved, and the death rate of the sogatella furcifera is remarkably increased. According to the method, dsRNA transcribed by a target gene can be effectively inhibited through metarhizium anisopliae expression, so that the pathogenicity of metarhizium anisopliae to sogatella furcifera is improved, the prevention and treatment effect on sogatella furcifera is remarkably improved, and wide application prospects are achieved.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a white-backed planthopper SfLox gene, dsRNA, highly toxic Metarhizium engineered bacteria and applications thereof in the prevention and treatment of white-backed planthoppers. Background Art

[0002] The white-backed planthopper (Sogatella furcifera) is a major pest of rice, severely impacting rice production. Entomopathogenic fungi, as fungal biopesticides with broad potential, offer advantages such as environmental safety, strong prevalence, and resistance to host resistance. However, their long insecticide duration and poor stress tolerance limit their effectiveness, necessitating the development of novel pest control methods.

[0003] RNAi technology, or RNA interference technology, primarily refers to the technique of silencing target gene mRNA by double-stranded RNA (dsRNA), thereby affecting the normal physiological activities of the target organism. The engineering improvement of strains in combination with RNAi is an ongoing research effort. For example, spraying dsRNAs to silence aphids' immune-related genes significantly increased the mortality of Beauveria bassiana against aphids (Zhang et al., 2022). Expression of dsRNAs targeting locust host ATP synthase subunit genes in Metarhizium raphis effectively inhibited target gene transcription, and RNAi silencing of host ATPase subunits enhanced the virulence of Metarhizium raphis to locusts (Hu et al., 2019). However, there is currently no effective method for controlling white-backed planthoppers by effectively inhibiting target gene transcription through expression in Metarhizium raphis. Summary of the Invention

[0004] In view of this, one of the objectives of the present invention is to provide a SfLox gene from the white-backed planthopper, the nucleotide sequence of which is shown in SEQ ID NO. 1, or the encoded amino acid sequence is shown in SEQ ID NO. 2. This gene has a scavenger receptor cysteine-rich domain (SRCR), which has been shown to be closely related to the immune function of the white-backed planthopper in research studies.

[0005] A second objective of the invention is to provide the use of the aforementioned SfLox gene in regulating immunity in white-backed planthoppers. Studies in the present invention have demonstrated that knocking down the expression of this gene in white-backed planthoppers reduces their immune function, significantly increasing the pathogenicity of Metarhizium anisopliae to them.

[0006] The third object of the present application is to provide a dsRNA targeting SfLox gene of white-backed planthopper, which is a double-stranded RNA consisting of the sequence shown in SEQ ID NO. 3 and its reverse complementary sequence.

[0007] The fourth object of the present application is to provide a fungal expression vector, which is a vector capable of expressing the above-mentioned dsRNA.

[0008] Further, the expression vector is a fragment consisting of the sequence shown in SEQ ID NO. 3, an intron sequence, the reverse complementary sequence of the sequence shown in SEQ ID NO. 3, and a TrpC terminator sequence, which is inserted into a pK2-PgpdM-pB plasmid. The intron sequence can assist the SfLox forward and reverse sequences to form a hairpin structure.

[0009] The fifth object of the present application is to provide an engineered strain of Metarhizium anisopliae with high virulence, which is an engineered strain of Metarhizium anisopliae containing the above-mentioned expression vector.

[0010] The sixth object of the present application is to provide the use of the above-mentioned expression vector or the above-mentioned engineered strain of Metarhizium anisopliae in the preparation of an insecticide.

[0011] The seventh object of the present application is to provide an insecticide containing the above-mentioned expression vector or the above-mentioned engineered strain of Metarhizium anisopliae.

[0012] The eighth object of the present application is to provide a method for controlling white-backed planthopper, comprising the following steps: 1) constructing a fungal expression vector targeting a gene of white-backed planthopper, which expresses a dsRNA of the targeted gene; 2) transforming the expression vector into Metarhizium anisopliae to obtain an engineered strain; and 3) spraying the engineered strain to control white-backed planthopper.

[0013] Further, the method for constructing the fungal expression vector comprises:

[0014] 1) extracting total RNA from white-backed planthopper and reverse transcribing it into cDNA as a template, and amplifying a fragment of SfLox gene using primer pair SfLox-F and SfLox-R, the primer sequences being:

[0015] L-SfLox-F: CTCTCCATATACACACACGCAAATCTAGAATGCGTTCGTC CTGGTTAAG,

[0016] L-SfLox-R: CACATGCTTGAATTGGTTAGGGTTAACCAATCGCTTTTCA CTGCCTG;

[0017] 2) The fragment amplified in step 1) was purified and ligated with the empty plasmid pK2-PgpdM-pB that had been digested and purified with XbaI and XhoI to obtain a recombinant plasmid containing the positive-sense fragment. The plasmid was then transformed into Escherichia coli, and the plasmid was extracted, digested with Xhol, and purified.

[0018] 3) Amplify the TrpC terminator fragment using the primer pair TrpC-F and TrpC-R. The TrpC terminator sequence is shown in SEQ ID NO. 4. The amplification template is a plasmid containing the TrpC terminator sequence. Amplify the antisense fragment of the SfLox gene using the cDNA from step 1) using the primer pair R-SfLox-R and R-SfLox-F. The primer sequences are:

[0019] TrpC-F: CTTAACCAGGACGAACGCATGATCCACTTAACGTTACTGA,

[0020] TrpC-R: TGCTCACCATACTAGTCTCGAGCGAGTGGAGATGTGGAGTG GGCGCTT,

[0021] R-SfLox-R:TCAGTAACGTTAAGTGGATCATGCGTTCGTCCTGGTTAAG,

[0022] R-SfLox-F: CTCGCTGTGCTGACACGACTCACCCAATCGCTTTTCACTG CCTG;

[0023] 4) Purifying the two fragments amplified in step 3) and performing fusion PCR to seamlessly connect the two fragments to obtain a fusion fragment. The primers for fusion PCR are TrpC-F and TrpC-R, and R-SfLox-R and R-SfLox-F;

[0024] 5) The fusion fragment of step 4) is purified and ligated with the plasmid purified by digestion with Xhol in step 2) to obtain the pK2-PgpdM-pB-SfLox recombinant plasmid, which is a fungal expression vector.

[0025] Furthermore, the transfer method includes transforming the pK2-PgpdM-pB-SfLox plasmid into Agrobacterium and then co-culturing it with wild-type Metarhizium anisopliae spores to cause homologous recombination, and then preliminarily screening and verifying the transformants by PCR and verifying the engineered strain by fluorescent quantitative PCR.

[0026] The present invention provides an SfLox gene for regulating the immunity of white-backed planthoppers. The SfLox gene is then placed into a pK2-PgpdM-pB plasmid expression vector, which is then transferred into fungi to produce a highly virulent engineered strain of Metarhizium anisopliae. This engineered strain can produce dsRNA expressing immunosuppressive properties against white-backed planthoppers and deliver it into host cells, significantly reducing the expression of the SfLox gene in white-backed planthoppers. This significantly increases the pathogenicity of Metarhizium anisopliae to white-backed planthoppers and significantly increases the mortality rate of white-backed planthoppers. The present invention uses Metarhizium anisopliae to express dsRNA that effectively inhibits the transcription of a target gene, thereby increasing the pathogenicity of Metarhizium anisopliae to white-backed planthoppers. This method significantly improves the control of white-backed planthoppers and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Schematic diagram of the construction of the SfLox-RNAi engineered strain and the screening of positive transformants of the present invention;

[0028] Figure 2 The mortality rate and half-lethal time of white-backed planthoppers spray-inoculated with the SfLox-RNAi engineered strain of the present invention;

[0029] Figure 3 This is the determination of the interference efficiency of the SfLox-RNAi engineering strain of the present invention. DETAILED DESCRIPTION

[0030] The present invention will be described in detail below with reference to the examples, which are only illustrative and are not limited to the scope of application of the present invention. The present invention is not limited to the following embodiments or examples, and any modifications and variations that do not violate the spirit of the present invention should be included within the scope of the present invention. The experimental materials used in the following examples are commercially available unless otherwise specified. The Metarhizium anisopliae used in the experiments in the following examples is the CQMa421 strain, which was provided by the Gene Engineering Center of Chongqing University. This strain has been deposited in the China General Microbial Culture Collection Center, and its deposit number is CGMCC No. 4609, and is also recorded in the patent authorization announcement CN102212483B.

[0031] Example 1. Construction of pK2-PgpdM-pB-SfLox recombinant plasmid

[0032] Total RNA was extracted from white-backed planthoppers and reverse transcribed into cDNA. PCR primers SfLox-F and SfLox-R were designed based on the CDS sequence of the SfLox gene as shown in SEQ ID NO. 1 (the amino acid sequence encoded by it is shown in SEQ ID NO. 2) to amplify the SfLox fragment. The primer sequences are:

[0033] L-SfLox-F: CTCTCCATATACACACACGCAAATCTAGAATGCGTTCGTC CTGGTTAAG;

[0034] L-SfLox-R: CACATGCTTGAATTGGTTAGGGTTAACCAATCGCTTTTCA CTGCCTG.

[0035] The fragment was purified and ligated with the empty plasmid pK2-PgpdM-pB (the pK2-PgpdM-pB plasmid is the pBarEx-Som1:GFP plasmid obtained in Example 2 of Chinese patent CN201710725033.6, but does not contain the Som1 gene sequence) after digestion and purification by XbaI and XhoI to obtain a recombinant plasmid containing the positive fragment, which was transformed into Escherichia coli.

[0036] The recombinant product was transformed into competent E. coli DH5α to obtain a recombinant engineered E. coli strain. The transformation process was as follows: 50 μL of the -80°C frozen competent E. coli (DH5α) was added to 5 μL of the ligation product and incubated on ice for 30 minutes. Heat shock was performed at 42°C for 90 seconds, followed by immediate placement on ice and an ice bath for 5-10 minutes. 1 mL of LB liquid medium was added and shaken at 37°C at 220 rpm for 1 hour. After centrifugation, 100 μL of the liquid culture was resuspended and plated onto solid LB medium containing kanamycin (working concentration of 50 μg / mL). After 24 hours, the cells were verified by colony PCR and then transferred to liquid culture for expansion. The colony PCR amplification reaction conditions were: pre-denaturation at 98°C for 2 minutes; 30 cycles of 98°C for 10 seconds, 58°C for 30 seconds, and 72°C for 30 seconds; and extension at 72°C for 4 minutes. After the plasmid was extracted, it was digested with Xhol and purified to serve as a vector for connecting antisense Sflox.

[0037] The TrpC terminator fragment was amplified using the primer pair TrpC-F and TrpC-R. The TrpC terminator sequence is shown in SEQ ID NO. 4, and the amplification template was a plasmid containing the TrpC terminator sequence. The antisense fragment of Sflox was amplified using the cDNA as a template using primers R-SfLox-R and R-SfLo-F. The primer sequences are:

[0038] TrpC-F: CTTAACCAGGACGAACGCATGATCCACTTAACGTTACTGA;

[0039] TrpC-R: TGCTCACCATACTAGTCTCGAGCGAGTGGAGATGTGGAGTGGGCGCTT.

[0040] R-SfLox-R: TCAGTAACGTTAAGTGGATCATGCGTTCGTCCTGGTTAAG;

[0041] R-SfLox-F: CTCGCTGTGCTGACACGACTCACCCAATCGCTTTTCACTG CCTG.

[0042] Then the amplified product was purified and fusion PCR was performed on the SfLox reverse complementary sequence fragment and the TrpC terminator fragment, i.e. by designing overlapping primers so that the two fragments carry overlapping sequences, and then by PCR extension and amplification to achieve seamless connection, the primers being TrpC-F and TrpC-R, R-SfLox-R and R-SfLox-F.

[0043] The fusion PCR amplification reaction conditions were: 98°C pre-denaturation for 2 min; 98°C for 10 s, 58°C for 30 s, 72°C for 30 s as one cycle, 30 cycles; 72°C extension for 4 min.

[0044] The fusion fragment was purified and ligated with the plasmid purified by Xhol enzyme digestion to obtain the pK2-PgpdM-pB-SfLox recombinant plasmid, the sequence structure of the recombinant plasmid being as shown in Figure 1 A) consisting of the forward sequence (Sense) of the SfLox fragment + the intron sequence (Intron) + the reverse complementary sequence (Anti-Sense) of the SfLox fragment + the TtrpC terminator fragment.

[0045] The recombinant product was transformed into the E. coli competent DH5a to obtain the recombinant E. coli engineering strain. After being verified by colony PCR, it was transferred into a liquid culture medium for large-scale culture. The colony PCR amplification reaction conditions were: 98°C pre-denaturation for 2 min; 98°C for 10 s, 58°C for 30 s, 72°C for 30 s as one cycle, 30 cycles; 72°C extension for 4 min.

[0046] The primer pairs were: PgpdM-R and Intron-R, Intron-F and eGFP-VR, PgpdM-R and Intron-R amplified the target fragment of 552 bp, and Intron-F and eGFP-VR amplified the target fragment of 1578 bp, as shown in the electrophoresis result diagram of Figure 1 B, the bands were consistent with the target fragments. The primer sequences were:

[0047] PgpdM-R: ACTGAGCAGAGCTTGACCAC;

[0048] Intron-F: GTTAACCCTAACCAATTCAAGCATGTG;

[0049] Intron-R:GGTGAGTCGTGTCAGCACAGCGAG;

[0050] eGFP-VR:CGATGCGGTTCACCAGGGTGT.

[0051] Example 2: Chemical transformation of Agrobacterium tumefaciens

[0052] The pK2-PgpdM-pB-SfLox recombinant plasmid was transformed into Agrobacterium using the chemical transformation method according to the Agrobacterium AGL1 competence instruction manual of Shanghai Weidi. After culturing at 28°C for 48 hours, colony PCR verification was performed. The successfully verified Agrobacterium positive colony was inoculated into 20mL LK liquid medium (LB liquid medium with kanamycin added, working concentration is 50μg / mL) and cultured in a constant temperature shaking incubator (28°C, 220rpm) for 15-18 hours until the absorbance value OD 660 The p-value was 0.6-1.0, and the primers for verifying Agrobacterium were PgpdM-R and Intron-R, Intron-F and eGFP-VR.

[0053] The transformation process is as follows: 5 μL of pK2-PgpdM-pB-SfLox plasmid is placed in 50 μL of Agrobacterium competent medium, ice bathed for 5 minutes, frozen in liquid nitrogen for 5 minutes, treated in a 37°C water bath for 5 minutes, then placed on ice for 5 minutes, added with 1 mL of LB liquid culture medium, cultured in a shaking incubator at 28°C and 220 rpm for 2-3 hours, and 100 μL is spread on LK medium.

[0054] Example 3: Co-cultivation of Agrobacterium and Metarhizium anisopliae CQMa421

[0055] Take the Agrobacterium culture liquid, centrifuge, discard the supernatant, resuspend the bacteria in NIM liquid medium (containing 200 μM / L acetosyringone), and measure the absorbance value A 660 According to A=[(0.15×10) / A 660 ]mL, calculate the A value. The A value is the initial bacterial liquid volume required for 10mL NIM liquid medium (containing 200μM / L acetosyringone). Culture in the dark for 15-16.5h with constant temperature shaking (28℃, 220rpm) until the absorbance value A 660 It is 0.5-0.7.

[0056] Scrape the conidia of Metarhizium anisopliae CQMa421 strain and prepare a spore suspension (1×10 6spores / mL). Mix with NIM Agrobacterium culture medium at a ratio of 1:1. Spread the solution onto NIM solid medium (containing acetosyringone at a working concentration of 200 μM / L) covered with a sterile microporous filter membrane and incubate inverted at 28°C in the dark for 48 hours.

[0057] Example 4. Screening of Metarhizium anisopliae transformants (SfLox-RNAi engineered strains)

[0058] After 48 hours, transfer the microporous filter membrane to Cha's medium (containing 400 μL / mL of glufosinate and 400 mg / mL of cephalosporin). Further, after 7-9 days, pick a single colony and streak it on a new Cha's medium (containing 400 μL / mL of glufosinate and 400 mg / mL of cephalosporin) for expansion culture. The culture time is 3-5 days. Pipette 0.7 mL of 1 / 4SDAY liquid culture base into a 1.5 mL centrifuge tube, pick a small amount of bacteria on the plate and inoculate it into the centrifuge tube. The plate and the centrifuge tube should be marked and correspond one to one. After constant temperature shaking (28 ° C, 220 rpm) shaking culture for 3 days, DNA was extracted, and the SfLox-RNAi engineering strain was constructed by PCR verification. The verification primers were PgpdM-R and Intron-R, Intron-F and eGFP-VR, and the target fragment was amplified as follows. Figure 1 C shows the electrophoresis results, and the bands are consistent with the target fragments.

[0059] The DNA extraction process is as follows: centrifuge the bacteria at room temperature (12,000 rpm, 10 min) and discard the supernatant. Add grinding beads to grind the sample. Add 0.4 mL of lysis buffer and lyse at 37°C for 2-3 hours. Further, add 0.15 mL of potassium acetate solution to each tube of sample to neutralize for 10 minutes. Centrifuge (room temperature, 12,000 rpm, 10 min), aspirate 0.4 mL of supernatant into a new centrifuge tube, add an equal volume of isopropanol, and precipitate in an ice bath for 30 minutes. Centrifuge (room temperature, 12,000 rpm, 10 min), discard the supernatant and see a small amount of white precipitated DNA at the bottom of the centrifuge tube. Add 1 mL of 70-75% ethanol, centrifuge (room temperature, 12,000 rpm, 5 min), and discard the supernatant. After the alcohol evaporates, add 65°C ddH2O to dissolve.

[0060] Example 5: Bioassay experiment on white-backed planthopper

[0061] Take a plastic cup, cut off the bottom, and place it upside down on top of another plastic cup. Secure the interface of the two plastic cups with sealing film. Add soil and 7 rice seedlings of similar growth into the cup, place 20 fifth-instar larvae of white-backed planthoppers, cover the top with gauze and secure with a rubber band. Pipette 500 μL of the strain spore suspension (prepared with 1×10 using 0.05% Tween 80) 7conidia / mL) were sprayed into plastic cups using a spray tower, with three biological replicates per group. The number of white-backed planthopper deaths was counted every 24 hours in a bioassay chamber for 8 consecutive days. Three replicates were used for each group, and the experiment was repeated three times. The results showed that compared to the WT strain (half-lethal time, LT 50 =6.04d), SfLox-RNAi engineering strain (LT 50 =5.29d) significantly increased its toxicity to white-backed planthoppers, LT 50 Shorten 0.75d( Figure 2 A and B).

[0062] Example 6: Determination of interference efficiency of engineered strains

[0063] Prepare WT and SfLox-RNAi engineered strain spore suspensions respectively and dilute the spore suspensions to 1×10 7 conidia / mL, sprayed the white-backed planthopper with bacteria, and 2 days later, 6 white-backed planthoppers treated with different strains were taken out, RNA was extracted, reverse transcribed into cDNA, and RT-PCR was performed using the white-backed planthopper SfLox quantitative primers and internal reference primers. The results showed that compared with WT, the SfLox-RNAi engineered strain could significantly reduce the expression level of SfLox at 24h (reduced by 44.26%) and 48h (reduced by 45.12%). After 96h of inoculation, the interference efficiency was not significantly different from that of WT. The above results show that the SfLox-RNAi engineered strain can significantly reduce the expression level of SfLox in white-backed planthoppers ( Figure 3 ).

[0064] In summary, the engineered strain of Metarhizium anisopliae expressing the white-backed planthopper immunosuppressive dsRNA (dsSfLox) knocked down the host target gene, weakened its immune response to Metarhizium, and increased the mortality rate of white-backed planthoppers, which has important theoretical and practical significance for the development of new control strategies against the pest white-backed planthopper.

[0065] The conventional techniques and schemes not described in detail in the above embodiments are well known in the art and will not be described in detail here. The above embodiments and / or experimental examples describe the preferred embodiments of the present invention in detail, but the present invention is not limited to the specific details of the above embodiments. Within the scope of the technical concept of the present invention, various simple variations of the technical scheme of the present invention can be made, and these simple variations all fall within the scope of protection of the present invention.

Claims

1. A white-backed planthopper SfLox gene, characterized in that The nucleotide sequence of the gene is shown as SEQ ID NO.1, or the encoded amino acid sequence is shown as SEQ ID NO.

2.

2. Use of the SfLox gene according to claim 1 in regulating immunity of white-backed planthopper.

3. A dsRNA targeting the SfLox gene of white-backed planthopper, characterized in that The sequence of the dsRNA is shown in SEQ ID NO.

3.

4. A fungal expression vector, characterized in that The expression vector is a vector for expressing the dsRNA according to claim 3.

5. The expression vector according to claim 4, wherein The fragment consisting of the sequence shown in SEQ ID NO. 3, the intron sequence, the reverse complementary sequence of the sequence shown in SEQ ID NO. 3 and the TrpC terminator sequence was inserted into the pK2-PgpdM-pB plasmid to obtain the fragment.

6. A highly toxic engineered strain of Metarhizium anisopliae, characterized in that: The invention relates to an engineered strain of Metarhizium anisopliae containing the expression vector according to claim 4 or 5.

7. Use of the expression vector according to claim 4 or 5 or the engineered strain of Metarhizium anisopliae according to claim 5 in the preparation of insecticides.

8. An insecticide, characterized in that Contains the expression vector according to claim 4 or 5 or the engineered bacteria of Metarhizium anisopliae according to claim 5.

9. A method for controlling white-backed planthoppers, characterized in that: The method comprises the following steps: 1) constructing a fungal expression vector targeting a white-backed planthopper gene, wherein the expression vector expresses dsRNA of the targeting gene; 2) transferring the expression vector into Metarhizium anisopliae to obtain an engineered strain; and 3) spraying the engineered strain to control the white-backed planthopper.

10. The method according to claim 9, wherein The method for constructing the fungal expression vector comprises: 1) Total RNA was extracted from white-backed planthoppers and reverse transcribed into cDNA as a template. The SfLox gene fragment was amplified using the primer pair SfLox-F and SfLox-R. The primer sequences are: L-SfLox-F: CTCTCCATATACACACACGCAAATCTAGAATGCGTTCGTC CTGGTTAAG, L-SfLox-R:CACATGCTTGAATTGGTTAGGGTTAACCAATCGCTTTTCA CTGCCTG; 2) The fragment amplified in step 1) was purified and ligated with the empty plasmid pK2-PgpdM-pB that had been digested and purified with XbaI and XhoI to obtain a recombinant plasmid containing the positive-sense fragment. The plasmid was then transformed into Escherichia coli, and the plasmid was extracted, digested with Xhol, and purified. 3) Amplify the TrpC terminator fragment using the primer pair TrpC-F and TrpC-R. The TrpC terminator sequence is shown in SEQ ID NO.

4. The amplification template is a plasmid containing the TrpC terminator sequence. Amplify the antisense fragment of the SfLox gene using the cDNA from step 1) using the primer pair R-SfLox-R and R-SfLox-F. The primer sequences are: TrpC-F: CTTAACCAGGACGAACGCATGATCCACTTAACGTTACTGA, TrpC-R: TGCTCACCATACTAGTCTCGAGCGAGTGGAGATGTGGAGTG GGCGCTT, R-SfLox-R:TCAGTAACGTTAAGTGGATCATGCGTTCGTCCTGGTTAAG, R-SfLox-F: CTCGCTGTGCTGACACGACTCACCCAATCGCTTTTCACTG CCTG; 4) Purifying the two fragments amplified in step 3) and performing fusion PCR to seamlessly connect the two fragments to obtain a fusion fragment. The primers for fusion PCR are TrpC-F and TrpC-R, and R-SfLox-R and R-SfLox-F; 5) The fusion fragment of step 4) is purified and ligated with the plasmid purified by digestion with Xhol in step 2) to obtain the pK2-PgpdM-pB-SfLox recombinant plasmid, which is a fungal expression vector.

Images