MNT1 gene for regulating and controlling nitrogen utilization efficiency of corn and application of MNT1 gene

Abstract

The invention relates to the field of plant gene map-based cloning and molecular breeding. Specifically, the invention provides a nucleic acid molecule and a polypeptide, and also provides a recombinant vector, a host cell and a plant or a part, a seed, a cell or a progeny thereof containing the nucleic acid molecule. Furthermore, the invention also provides a method for preparing the transgenic plant, and a method for regulating and controlling the nitrogen utilization efficiency, nitrate absorption or transport, biomass and / or yield of the plant.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to Chinese patent application No. 202411077906.3 filed on August 7, 2024, the entire contents of which are incorporated herein by reference in their entirety. Technical Field

[0003] The present invention relates to the fields of plant gene positional cloning and molecular breeding. Specifically, the present invention provides a nucleic acid molecule and a polypeptide, as well as recombinant vectors, host cells, and plants, or parts, seeds, cells, or progeny thereof, comprising the nucleic acid molecules. Furthermore, the present invention provides methods for producing transgenic plants, as well as methods for regulating plant nitrogen use efficiency, nitrate uptake or transport, biomass, and / or yield. Background Art

[0004] Nitrogen is the mineral element most required by plants, occupying a primary position. It is also one of the most important factors in promoting crop yields. Nitrogen accounts for 1.5-2% of the total dry weight of plants. Nitrogen is a key component of macromolecules in plants, such as proteins (including enzymes), nucleic acids (DNA, RNA), vitamins (B1, B2, B6, etc.), plant hormones (IAA, CTK), alkaloids, and chloroplasts. Therefore, nitrogen plays a vital role in maintaining normal plant life and is a major limiting factor affecting plant growth and development. Therefore, plants must absorb sufficient nitrogen from the soil to meet their growth and development (Marschner, 1995). Inorganic nitrogen sources such as nitrate and ammonium are the primary forms of nitrogen absorbed and utilized by plants (Hageman et al., 1988; Lawlor et al., 1989). They play a crucial role in crop growth and development, including chloroplast formation, root growth, and crop yield (Lam, 1996; Lawler et al., 2001). However, in the natural environment, the content of nitrogen sources that can be directly absorbed and utilized by plants is low, so nitrogen is an important limiting factor affecting plant growth and development.

[0005] In agricultural production, nitrogen fertilizer use continues to increase to ensure crop yields (Frink et al., 1999), providing a fundamental guarantee for global food security. With global arable land increasing by only 15.5%, the primary driver of this continued increase in grain production is the massive application of chemical fertilizers. While chemical fertilizers have significantly boosted crop yields, they have also increased people's overdependence on them. Since the 1980s, my country's nitrogen fertilizer use has increased dramatically, exceeding 33% of the world's total fertilizer consumption. While fertilizer use in agricultural production has played a crucial role in ensuring sustained increases in grain production, nitrogen fertilizer utilization efficiency has not improved, remaining at around 30%, less than half the rate in developed Western countries. Consequently, 50-70% of nitrogen fertilizer cannot be absorbed by crops (Peoples et al., 1995). This not only pollutes the air, soil, and water, but also contributes to increasing soil acidification and water eutrophication in China. Excessive nitrogen fertilizer application has also placed enormous environmental pressure on sustainable agricultural development. This has resulted in a waste of resources, increased environmental pressure, and serious nitrogen pollution (Zhu, 2000; Good et al., 2004). Improving crop nutrient utilization efficiency and achieving sustained yield increases while reducing fertilizer inputs have become major issues that urgently need to be addressed.

[0006] In the crop corn, it has been demonstrated that improving the plant's tolerance to low nitrogen and reducing nitrogen fertilizer use can maintain or increase crop yield (Tollenaar, 1999). Over the course of long-term evolution, plants have developed complex and sophisticated signaling regulatory networks that respond to external nitrogen nutritional conditions and integrate their own nitrogen needs.

[0007] Therefore, with the continuous advancement of plant genomics research, identifying and cloning genes involved in regulating nitrogen absorption and studying the regulatory mechanisms and signaling pathways that govern plant nitrogen absorption, transport, and utilization are key approaches to improving nitrogen nutrition efficiency. Understanding this regulatory network is crucial for improving plant nitrogen utilization efficiency, reducing fertilizer inputs in agricultural production, and achieving sustainable agricultural development. Summary of the Invention

[0008] Through extensive research, the inventors of this application have discovered a key gene that regulates maize nitrogen use efficiency. They have also developed a method for regulating maize nitrogen use efficiency by overexpressing this gene, as well as maize plants that efficiently utilize nitrogen, obtained by this method. This gene, method, or plant can be used to improve elite maize inbred lines and cultivate new maize varieties that efficiently utilize nitrogen.

[0009] Nucleic acid molecules

[0010] In a first aspect, the present invention provides a nucleic acid molecule comprising a sequence selected from the group consisting of:

[0011] (1) a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 2;

[0012] (2) a nucleotide sequence encoding an amino acid sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the amino acid sequence of SEQ ID NO: 2, wherein the encoded polypeptide has the function of regulating plant nitrogen use efficiency, nitrate uptake or transport, biomass and / or yield;

[0013] (3) A nucleotide sequence encoding an amino acid sequence obtained by substituting, deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID NO: 2, wherein the encoded polypeptide has the function of regulating plant nitrogen utilization efficiency, nitrate uptake or transport, biomass and / or yield.

[0014] In certain embodiments, the nucleotide sequences of (1) to (3) are nucleotide sequences of corn.

[0015] In a second aspect, the present invention provides a nucleic acid molecule comprising a sequence selected from the group consisting of:

[0016] (1) the nucleotide sequence shown in SEQ ID NO: 1 or 3;

[0017] (2) a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the nucleotide sequence of SEQ ID NO: 1 or 3, and the polypeptide encoded by the nucleotide sequence has the function of regulating plant nitrogen use efficiency, nitrate uptake or transport, biomass and / or yield;

[0018] (3) A nucleotide sequence that can hybridize to the sequence shown in SEQ ID NO: 1 or 3 under conditions that allow nucleic acid hybridization.

[0019] Those skilled in the art will appreciate that two nucleotide sequences capable of hybridization need not be completely complementary. In certain embodiments, when optimally aligned, the degree of complementarity between the sequence set forth in SEQ ID NO: 1 or 3 and a sequence capable of hybridization therewith can be at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%.

[0020] In certain embodiments, the nucleotide sequences of (1) to (3) are nucleotide sequences of corn.

[0021] In certain embodiments, the position of the nucleic acid molecule in the maize genome corresponds to 70817154..70825722 of chromosome 5 of the maize reference genome B73.

[0022] In the context of the present invention, the nucleic acid molecule is the nucleic acid molecule of the maize gene MNT1.

[0023] In certain embodiments, the nucleic acid molecule comprises a nucleotide sequence that is a coding region sequence of the maize gene MNT1, or both a coding region sequence and a non-coding region sequence of the maize gene MNT1.

[0024] In certain embodiments, the nucleic acid molecule further comprises a promoter.

[0025] As used herein, "promoter" refers to a nucleic acid sequence that functions to direct the transcription of downstream coding sequences.

[0026] The promoter can be native or homologous, or foreign or heterologous to the plant host and / or the nucleic acid molecule of the present invention. Furthermore, the promoter can be a native sequence or a synthetic sequence. In the case where the promoter is "native" or "homologous" to the plant host, the promoter refers to a promoter found in the native plant into which the promoter is introduced. In the case where the promoter is "foreign" or "heterologous" to the DNA sequence of the present invention, the promoter refers to a non-natural or non-naturally occurring promoter that is operably linked to the DNA sequence of the present invention. "Heterologous" generally refers to a nucleic acid sequence that is not endogenous to the cell or part of the native genome in which it is present, but has been introduced into the cell through techniques such as infection, transfection, microinjection, electroporation, microbombardment, etc. Generally, "operably linked" means that the linked nucleic acid sequences are adjacent, and in the case of linking two protein coding regions, adjacent and in the same reading frame.

[0027] In certain embodiments, the promoter is operably linked to the 5' end of any one of the sequences in (1)-(3), and the promoter is capable of regulating the transcription and / or expression (e.g., whether it is expressed, the level of expression) of any one of the sequences in (1)-(3).

[0028] In certain embodiments, the promoter is selected from a constitutive promoter, an inducible promoter, or a tissue-specific promoter.

[0029] In one embodiment, the promoter is a constitutive promoter. Suitable constitutive promoters for use in plants include promoters from plant viruses, such as the peanut chlorotic streak caulimovirus (PC1SV) promoter (U.S. Pat. No. 5,850,019); the cauliflower mosaic virus (CaMV) 35S promoter (Odell et al. (1985) Nature 313:810-812); the Chlorella virus methyltransferase gene promoter (U.S. Pat. No. 5,563,328) and the figwort mosaic virus (FMV) full-length transcription promoter (U.S. Pat. No. 5,378,619); promoters of genes such as rice actin (McElroy et al. (1990) Plant Cell 2:163-171); the ubiquitin gene promoter (Christensen et al. (1989) Plant Mol. Biol. 12:619-632 and Christensen et al. (1990) Plant Cell 2:163-171); the ubiquitin gene promoter (Christensen et al. (1989) Plant Mol. Biol. 12:619-632 and Christensen et al. (1990) Plant Cell 2:163-171); the ubiquitin gene promoter (Christensen et al. (1990 ... et al. (1992) Plant Mol. Biol. 18:675-689), including the TrpPro5 promoter (U.S. Patent Application No. 10 / 377,318; filed March 16, 2005); the pEMU promoter (Last et al. (1991) Theor. Appl. Genet. 81:581-588); the MAS promoter (Velten et al. (1984) EMBO J. 3:2723-2730); the maize H3 histone promoter (Lepetit et al. (1992) Mol. Gen. Genet. 231:276-285 and Atanassova et al. (1992) Plant J. 2(3):291-300); the Brassica napus ALS3 promoter (PCT Application No. WO 200500106). 97 / 41228); and promoters of various Agrobacterium genes (see U.S. Patent Nos. 4,771,002, 5,102,796, 5,182,200, and 5,428,147).

[0030] In another embodiment, the promoter is a tissue-specific promoter. A list of commonly used tissue-specific promoters can be found in the review by Moore et al. (2006) Plant J. 45(4): 651-683, which is incorporated herein by reference in its entirety.

[0031] In certain embodiments, the promoter sequence is a natural promoter sequence derived from an animal, plant, or microorganism, or is an artificially modified promoter sequence.

[0032] In certain embodiments, the artificially engineered promoter sequence is obtained by gene editing.

[0033] In certain embodiments, the promoter sequence is a promoter sequence derived from a plant.

[0034] In certain embodiments, the promoter has a sequence shown in any one of SEQ ID NOs: 4-6.

[0035] It should be understood that the present invention does not only cover specific exemplary sequences, because the technical means of changing the amino acids at specific sites without affecting the function of the polypeptide composed of amino acids are well known in the art. For example, the codon for a hydrophobic amino acid (e.g., alanine) can be encoded by another less hydrophobic residue (e.g., glycine); or, the codons for more hydrophobic residues such as valine, leucine or isoleucine can be substituted. Similarly, one negatively charged residue can be replaced by another, such as aspartic acid replaced by glutamic acid, or one positively charged residue can be replaced by another, such as lysine replaced by arginine. The above-mentioned changes in amino acids are all conventional technical means in the art and can retain the biological activity of the encoded product (polypeptide).

[0036] The amino acid sequence of the polypeptide of the present invention may also include a sequence in which one or more amino acid residues are substituted, deleted, and / or added to the amino acid sequence shown in SEQ ID NO: 2. In certain embodiments, the substitution is a conservative substitution. "Conservative substitution" means that an amino acid residue is replaced by another residue with similar physical and chemical properties. Non-limiting examples of conservative substitutions include substitutions between aliphatic amino acid residues, such as Ile, Val, Leu, or Ala, and substitutions between polar residues, such as Lys-Arg, Glu-Asp, or Gln-Asn substitutions.

[0037] Methods for substituting, deleting and / or adding one or more amino acid residues in an amino acid sequence are known in the art, for example, see Nucleic Acid Research 10(20): 6487-6500 (1982).

[0038] In certain embodiments, the nitrogen is nitrogen from nitrate nitrogen, nitrogen from ammonium nitrogen, nitrogen from amide nitrogen, or any combination thereof.

[0039] In certain embodiments, the nitrogen includes nitrate or a substance capable of forming nitrate, and urea.

[0040] In certain embodiments, the regulation is regulation under low nitrogen conditions or under high nitrogen conditions.

[0041] In certain embodiments, the low nitrogen conditions are nitrogen fertilizers applied at a rate of less than 200 kg / ha (e.g., less than 180 kg / ha, less than 150 kg / ha, less than 120 kg / ha, less than 100 kg / ha, less than 80 kg / ha, less than 50 kg / ha, less than 20 kg / ha) of nitrogen-containing fertilizers.

[0042] In some embodiments, the high nitrogen condition is a nitrogen fertilizer application rate of nitrogen-containing elements greater than or equal to 200 kg / ha (e.g., greater than or equal to 220 kg / ha, greater than or equal to 250 kg / ha, greater than or equal to 280 kg / ha, greater than or equal to 300 kg / ha, greater than or equal to 320 kg / ha, greater than or equal to 350 kg / ha, greater than or equal to 400 kg / ha).

[0043] In certain embodiments, the biomass regulation is selected from the group consisting of regulating the height of the aboveground part of the plant, regulating the weight of the aboveground part, regulating the weight of the belowground part, or any combination thereof.

[0044] In certain embodiments, the yield regulation is regulation of grain weight, regulation of seed setting rate, regulation of total grain number, regulation of thousand-grain weight, or any combination thereof.

[0045] In certain embodiments, regulating the nitrogen utilization efficiency of a plant comprises regulating one or more aspects selected from the following:

[0046] (1) Regulate the nitrate content in the crown of plants; (2) Regulate the crown biomass of plants; (3) Regulate the nitrogen content of plants (for example, stem nitrogen content, leaf nitrogen content, and grain nitrogen content); (4) Regulate the yield per plant.

[0047] In certain embodiments, modulating the nitrogen use efficiency of a plant comprises increasing the nitrogen use efficiency of a plant.

[0048] As used herein, "increased nitrogen use efficiency" refers to a transgenic plant comprising the nucleic acid molecules of the first and / or second aspects above that has an increased amount of nitrogen taken up from the environment compared to a plant not comprising the nucleic acid molecules of the first and / or second aspects above. In certain embodiments, the amount of nitrogen taken up from the environment can be increased by about 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 200% or more.

[0049] peptides

[0050] In a third aspect, the present invention provides a polypeptide obtained by transcribing and / or expressing the nucleic acid molecule according to the first aspect or the second aspect.

[0051] In certain embodiments, the polypeptide has the amino acid sequence set forth in SEQ ID NO:2, or the polypeptide has an amino acid sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the amino acid sequence set forth in SEQ ID NO:2.

[0052] In certain embodiments, the amino acid sequence shown in SEQ ID NO: 2 and sequences identical to the amino acid sequence shown in SEQ ID NO: 2 are sequences of corn.

[0053] Nucleic acid constructs

[0054] In a fourth aspect, the present invention provides a nucleic acid construct comprising the nucleic acid molecule according to the first aspect or the second aspect.

[0055] In this article, the nucleic acid construct refers to a DNA construct capable of expressing a protein from an open reading frame in a plant cell. In certain embodiments, the nucleic acid construct includes a transcription initiation region (i.e., a promoter) operably linked to the nucleotide sequence of the nucleic acid molecule of the present invention in a 5' to 3' transcriptional direction and a transcription and translation termination region (i.e., a terminator) that functions in a plant.

[0056] Therefore, in certain embodiments, the nucleic acid construct further comprises a regulatory element operably linked to the nucleotide sequence encoding the polypeptide. In certain embodiments, the regulatory element is capable of regulating the expression of the polypeptide (e.g., whether it is expressed, the expression level).

[0057] In certain embodiments, the regulatory element is selected from a 5'UTR, a 3'UTR, a terminator, or any combination thereof.

[0058] In certain embodiments, the nucleic acid construct comprises a nucleotide sequence encoding the polypeptide and a terminator operably linked to the polypeptide.

[0059] Other elements of the nucleic acid construct

[0060] In certain embodiments, the nucleic acid construct may further comprise one or more other genes, for example, a selectable marker gene (eg, a herbicide gene, an antibiotic resistance gene).

[0061] In certain embodiments, the nucleic acid construct may further comprise 5' and 3' untranslated regions (i.e., 5' UTR and 3' UTR). In this article, "3' untranslated region" refers to the nucleotide sequence located downstream of the coding sequence. In this article, "5' untranslated region" refers to the nucleotide sequence located upstream of the coding sequence.

[0062] In certain embodiments, the nucleic acid construct may further comprise a "signal sequence" or "leader sequence" to promote co-translational or post-translational transport of the polypeptide to certain intracellular structures such as chloroplasts (or other plastids), the endoplasmic reticulum or the Golgi apparatus or to be secreted. A "signal sequence" refers to a sequence that is known or speculated to cause co-translational or post-translational transport of a peptide across the cell membrane. A "leader sequence" refers to a sequence that, when translated, results in an amino acid sequence sufficient to trigger the co-translational transport of a peptide chain to a subcellular organelle. Thus, it includes leader sequences that target transport and / or glycosylation by entering the endoplasmic reticulum, entering the vacuole, plastids including chloroplasts, mitochondria, and the like.

[0063] In certain embodiments, the nucleic acid construct may further comprise a terminator. In certain embodiments, the terminator may be obtained from the Ti-plasmid of Agrobacterium tumefaciens (A. tumefaciens), such as the octopine synthase and nopaline synthase terminator regions, or the potato proteinase inhibitor II sequence (PinII), as described in Liu et al. (2004) Acta Biochim Biophys Sin 36(8):553-558. See also Guerineau et al. (1991) Mol. Gen. Genet. 262:141-144; Proudfoot (1991) Cell 64:671-674; Sanfacon et al. (1991) Genes Dev. 5:141-149; Mogen et al. (1990) Plant Cell 2:1261-1272; Munroe et al. (1990) Gene 91:151-158; Ballas et al. (1989) Nucleic Acids Res. 17:7891-7903; and Joshi et al. (1987) Nucleic Acid Res. 15:9627-9639.

[0064] recombinant vector

[0065] In a fifth aspect, the present invention provides a recombinant vector comprising the nucleic acid molecule of the first or second aspect or the nucleic acid construct of the fourth aspect. In certain embodiments, the nucleotide sequence of the nucleic acid molecule of the present invention can be modified to obtain or enhance expression in plant cells.

[0066] host cells

[0067] In the sixth aspect, the present invention provides a host cell comprising the nucleic acid molecule described in the first aspect or the second aspect, or the polypeptide described in the third aspect, or the nucleic acid construct described in the fourth aspect, or the recombinant vector described in the fifth aspect.

[0068] As known to those skilled in the art, codons are degenerate. That is, during protein translation, each amino acid may correspond to one or more codons, for example, up to six codons. Different species differ greatly in the use of degenerate codons encoding a certain amino acid, and have different preferences. This preference phenomenon is called "codon preference." Therefore, where appropriate, the nucleotide sequence of a nucleic acid molecule can be codon-optimized based on the codon preference of the host cell to increase its expression in the host cell. For methods of codon optimization based on host cells, reference can be made, for example, to Campbell and Gowri (1990) Plant Physiol. 92: 1-11. Alternatively, see, for example, U.S. Patent Nos. 6,320,100, 6,075,185, 5,380,831, and 5,436,391, U.S. Published Application Nos. 20040005600 and 20010003849, and Murray et al. (1989) Nucleic Acids Res. 17:477-498.

[0069] Plants or their parts, seeds, cells or progeny

[0070] In the seventh aspect, the present invention provides a genetically modified plant or part, seed, cell or progeny thereof, which comprises the nucleic acid molecule described in the first aspect or the second aspect, or comprises the nucleic acid construct described in the fourth aspect, or comprises the recombinant vector described in the fifth aspect.

[0071] In certain embodiments, the plant is selected from the group consisting of corn, rice, soybean, sunflower, sorghum, rapeseed, wheat, alfalfa, cotton, barley, millet, and sugarcane.

[0072] Application in breeding methods

[0073] Plants of the present invention or parts thereof, seeds, cells or offspring can be used in plant breeding programs. The purpose of plant breeding is to combine multiple desired traits in a single variety or hybrid. For field crops, these traits can include, for example, resistance to diseases and insects, tolerance to heat and drought, reduction in the time of crop maturity, higher yields and better agronomic quality. Traditional plant breeding is an important tool for developing new and improved commercial crops. The present invention encompasses methods for producing offspring plants by hybridizing the transgenic plant of the first parent with the second parent plant.

[0074] Plant breeding techniques used in plant breeding programs, which are well known in the art, include, but are not limited to, recurrent selection, bulk selection, mass selection, backcrossing, pedigree breeding, open pollination breeding, restriction fragment length polymorphism-enhanced selection, genetic marker-enhanced selection, doubled haploids, and transformation.

[0075] use

[0076] In the eighth aspect, the present invention provides a use of the nucleic acid molecule described in the first or second aspect, the polypeptide described in the third aspect, the nucleic acid construct described in the fourth aspect, or the recombinant vector described in the fifth aspect in regulating plant nitrogen utilization efficiency, nitrate absorption or transport, biomass and / or yield.

[0077] In certain embodiments, the nitrogen is nitrogen from nitrate nitrogen, nitrogen from ammonium nitrogen, nitrogen from amide nitrogen, or any combination thereof.

[0078] In certain embodiments, the nitrogen includes nitrate or a substance capable of forming nitrate, and urea.

[0079] In certain embodiments, the regulation is regulation under low nitrogen conditions or under high nitrogen conditions.

[0080] In certain embodiments, the low nitrogen conditions are nitrogen fertilizers applied at a rate of less than 200 kg / ha (e.g., less than 180 kg / ha, less than 150 kg / ha, less than 120 kg / ha, less than 100 kg / ha, less than 80 kg / ha, less than 50 kg / ha, less than 20 kg / ha) of nitrogen-containing fertilizers.

[0081] In some embodiments, the high nitrogen condition is a nitrogen fertilizer application rate of nitrogen-containing elements greater than or equal to 200 kg / ha (e.g., greater than or equal to 220 kg / ha, greater than or equal to 250 kg / ha, greater than or equal to 280 kg / ha, greater than or equal to 300 kg / ha, greater than or equal to 320 kg / ha, greater than or equal to 350 kg / ha, greater than or equal to 400 kg / ha).

[0082] In certain embodiments, the biomass regulation is selected from the group consisting of regulating the height of the aboveground part of the plant, regulating the weight of the aboveground part, regulating the weight of the belowground part, or any combination thereof.

[0083] In certain embodiments, the yield regulation is regulation of grain weight, regulation of seed setting rate, regulation of total grain number, regulation of thousand-grain weight, or any combination thereof.

[0084] In certain embodiments, regulating the nitrogen utilization efficiency of a plant comprises regulating one or more aspects selected from the following:

[0085] (1) Regulate the nitrate content in the crown of plants; (2) Regulate the crown biomass of plants; (3) Regulate the nitrogen content of plants (for example, stem nitrogen content, leaf nitrogen content, and grain nitrogen content); (4) Regulate the yield per plant.

[0086] method

[0087] As used herein, "transformation" refers to the introduction of a nucleic acid molecule or a recombinant vector into a plant cell. Methods for introducing nucleic acid molecules or recombinant vectors into plants are known in the art and include, but are not limited to, stable transformation methods, transient transformation methods, and virus-mediated methods.

[0088] Typically, plant transformation methods involve transferring heterologous DNA (e.g., nucleic acid molecules or recombinant vectors) into target plant cells (e.g., immature or mature embryos, suspension cultures, undifferentiated callus, protoplasts, etc.), followed by recovery of transformed plant cells from a pool of untransformed cells by selection (depending on a selectable marker gene). For example, explants are transferred to a fresh supply of the same medium for conventional culture. Subsequently, the transformed cells differentiate into shoots after being placed in a regeneration medium supplemented with a selection agent (e.g., antibiotics such as spectinomycin and kanamycin). The shoots are then transferred to a selective rooting medium to recover rooted shoots or plantlets. The transgenic plantlets are then grown into mature plants and produce fertile seeds (e.g., as described in Hiei et al. (1994) The Plant Journal 6: 271-282; Ishida et al. (1996) Nature Biotechnology 14: 745-750). The explants are transferred to a fresh supply of the same medium and cultured conventionally. A general description of techniques and methods for producing transgenic plants is described in Ayres and Park (1994) Critical Reviews in Plant Science 13: 219-239 and Bommineni and Jauhar (1997) Maydica 42: 107-120.

[0089] Production of transgenic plants can be performed by a number of methods including, but not limited to, introduction of heterologous DNA into plant cells by Agrobacterium (Agrobacterium-mediated transformation), particle gun bombardment of plant cells with heterologous foreign DNA attached to particles, and various other non-particle direct-mediated methods of DNA transfer (e.g., as described by Hiei et al. (1994) The Plant Journal 6:271-282; Ishida et al. (1996) Nature Biotechnology 14:745-750; Ayres and Park (1994) Critical Reviews in Plant Science 13:219-239; Bommineni and Jauhar (1997) Maydica 42:107-120).

[0090] Accordingly, in a ninth aspect, the present application provides a method of making a transgenic plant, part, seed, cell, or progeny thereof, the method comprising:

[0091] (i) transforming a plant cell with the nucleic acid molecule of the first or second aspect or the nucleic acid construct of the fourth aspect, or the recombinant vector of the fifth aspect;

[0092] (ii) developing or regenerating a plant from the plant cell.

[0093] In certain embodiments, the plant is selected from the group consisting of maize, rice, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, barley, millet, and sugarcane.

[0094] In certain embodiments, the method further comprises:

[0095] (iii) selfing the plant of (ii) with itself or crossing the plant of (ii) with a second plant, respectively, to produce seed of the transgenic plant.

[0096] In certain embodiments, the seed of the transgenic plant comprises genomic DNA of the transgenic plant.

[0097] In certain embodiments, the second plant is selected from the group consisting of maize, rice, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, barley, millet, and sugarcane.

[0098] In certain embodiments, the plant is maize and the second plant is also maize.

[0099] In certain embodiments, the plant of (ii) is crossed as a male with a second plant as a female to produce seed of the transgenic plant.

[0100] In the tenth aspect, the present application provides a method for regulating plant nitrogen utilization efficiency, nitrate absorption or transport, biomass and / or yield, the method comprising: increasing the expression level of the polypeptide described in the third aspect in the plant body; or, applying (e.g., spraying, applying) the polypeptide described in the third aspect to the plant.

[0101] In certain embodiments, the method is achieved by the following steps:

[0102] (a) transforming a plant cell with the nucleic acid molecule of the first or second aspect, the nucleic acid construct of the fourth aspect, or the recombinant vector of the fifth aspect;

[0103] (b) expressing the nucleic acid molecule in the plant cell;

[0104] (c) developing or regenerating a plant from the plant cell.

[0105] Optionally, the method further comprises:

[0106] (d) selecting from the plants of step (c) plants having increased nitrogen use efficiency, nitrate uptake or transport, biomass and / or yield compared to wild-type plants grown under the same conditions.

[0107] In certain embodiments, the plant is selected from the group consisting of corn, rice, soybean, sunflower, sorghum, rapeseed, wheat, alfalfa, cotton, barley, millet, and sugarcane.

[0108] In certain embodiments, the nitrogen use efficiency, biomass or yield is as defined or characterized as described above.

[0109] Products

[0110] In an eleventh aspect, the present application provides a product comprising the plant according to the seventh aspect or a part, seed, cell or progeny thereof.

[0111] In certain embodiments, the preparation comprises genomic DNA of the plant, or a part, seed, cell, or progeny thereof.

[0112] In certain embodiments, the product is selected from one or more of corn ears, dehusked corn, corn silk, corn pollen, corn grits, corn flour, crushed corn, cornmeal, corn oil, corn starch, corn steep liquor, corn malt, corn sugar, corn syrup, margarine produced from corn oil, unsaturated corn oil, saturated corn oil, corn flakes, popcorn, ethanol and / or liquor produced from corn, distillers dried grains (DDGS) produced from corn fermentation, animal feed from corn, cosmetics, and fillers.

[0113] In another aspect, the present invention further provides a method for producing the product, comprising obtaining the corn plant, or part, seed, cell, or progeny thereof, of the seventh aspect of the present invention and producing the product of the third aspect of the present invention therefrom. In certain embodiments, the corn plant, or part, seed, cell, or progeny thereof, is obtained by the method of the ninth or tenth aspect of the present invention.

[0114] In certain embodiments, the part of the corn plant of any of the preceding aspects is selected from the group consisting of kernels, pollen, ovules, flowers, shoots, roots, stalks, silks, tassels, ears, and leaves.

[0115] The present invention also relates to the use of the corn plant or its part, seed, cell or progeny according to any of the above aspects for producing food, agricultural products (such as feed), cosmetics, medicines or industrial products.

[0116] In certain embodiments, the corn plant, or part, seed, cell, or progeny thereof, is used to produce food, feed, starch, or for winemaking.

[0117] In certain embodiments, the part of a corn plant is selected from the group consisting of kernels, pollen, ovules, flowers, branches, roots, stems, silks, inflorescences, ears, and leaves.

[0118] In certain embodiments, the corn plant or part, seed, cell or progeny thereof is used to produce a product selected from the group consisting of: corn ears, dehusked corn, corn silk, corn pollen, corn grits, corn flour, cracked corn, cornmeal, corn oil, corn starch, corn steep liquor, corn malt, corn sugar, corn syrup, margarine produced from corn oil, unsaturated corn oil, saturated corn oil, corn flakes, popcorn, ethanol and / or liquor produced from corn, distillers dried grains (DDGS) produced from the fermentation of corn, animal feed from corn, cosmetics, and fillers.

[0119] Definition of terms

[0120] Unless otherwise indicated, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, procedures in cell culture, molecular biology, biochemistry, nucleic acid chemistry, immunology, and the like used herein are conventional procedures widely used in the relevant fields. To facilitate a better understanding of the present invention, definitions and explanations of relevant terms are provided below.

[0121] As used herein, the term "regulating nitrogen use efficiency" refers to a measurable change in any nitrogen metabolism-related index (e.g., nitrate, nitrite, ammonia, glutamate, aspartic acid, glutamine, asparagine, lysine, leucine, threonine, methionine, glycine, tryptophan, tyrosine, total protein content of a plant part, total nitrogen content of a plant part, and / or chlorophyll content) in the nitrogen assimilation pathway, or a plant having the same or increased yield at a lower nitrogen fertilization level, or a plant having increased yield at the same nitrogen fertilization level when compared to a plant transformed with a nitrogen-regulated nucleic acid molecule or recombinant vector of the present invention. The "measurable change" includes an increase or decrease in the amount of any nitrogen metabolism-related index of the nitrogen assimilation pathway.

[0122] Methods for measuring or evaluating nitrogen use efficiency have been reported in the prior art. Reference may be made, for example, to Craswell, ET and Godwin, DC (1984) The efficiency of nitrogen fertilizers applied to cereals grown in different climates. In Advances in Plant Nutrition (Vol. 1) (Tinker, PB and Lauchli, A., eds), pp. 1-55, Praeger Publishers; or to, for example, Steenbjerg, F. and Jakobsen, ST (1963) Plant nutrition and yield curves. Soil Sci. 95, 69-90; or to, for example, Siddiqi, MY and Glass, DM (1981) Utilization index: a modified approach to the estimation and comparison of nutrient utilization efficiency in plants. J. Plant Nutr. 4, 289-302; or to, for example, Moll, RH et al. (1982) Analysis and interpretation of factors which contribute to efficiency of nitrogen utilization. Agron. J. 74, 562-564.

[0123] As used herein, the term "identity" is used to refer to the matching of sequences between two polypeptides or between two nucleic acids. In order to determine the percent identity of two amino acid sequences or two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., a gap can be introduced in the first amino acid sequence or nucleic acid sequence to optimally align with the second amino acid or nucleic acid sequence). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., percent identity = number of identical overlapping positions / total number of positions × 100%). In certain embodiments, the two sequences are the same length.

[0124] The determination of percent identity between two sequences can also be achieved using a mathematical algorithm. A non-limiting example of a mathematical algorithm for the comparison of two sequences is the algorithm of Karlin and Altschul, 1990, Proc. Natl. Acad. Sci. USA 87: 2264-2268, as modified in Karlin and Altschul, 1993, Proc. Natl. Acad. Sci. USA 90: 5873-5877. Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et al., 1990, J. Mol. Biol. 215: 403.

[0125] As used herein, the term "recombinant vector" refers to a nucleic acid delivery vehicle into which a polynucleotide can be inserted. When a vector is capable of expressing a protein encoded by the inserted polynucleotide, the vector is referred to as an expression vector. A vector can be introduced into a host cell via transformation, transduction, or transfection, so that the genetic material elements it carries are expressed in the host cell. Vectors are well known to those skilled in the art and include, but are not limited to, plasmids; phagemids; cosmids; artificial chromosomes, such as yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), or P1-derived artificial chromosomes (PACs); bacteriophages such as lambda phage or M13 phage; and animal viruses. Animal viruses that can be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and papillomas (such as SV40). A vector can contain a variety of elements that control expression, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. In addition, a vector may also contain a replication initiation site.

[0126] As used herein, the term "plant" includes explants, plant parts, rice seedlings, seedlings, or whole plants at any stage of regeneration or development. The term "plant part" refers to any organ or intact tissue of a plant, such as a root, branch structure (e.g., stem, leaf), flower (e.g., pollen, ovule, flower spike, inflorescence, calyx, petal, stamen, carpel, anther), fruit, seed (e.g., embryo, endosperm, seed coat), protective tissue, conducting tissue, vegetative tissue, mechanical tissue, meristematic tissue, propagule. The term "propagule" includes any plant part that can grow into a complete plant.

[0127] As used herein, the term "maize" refers to maize or corn and includes all plant varieties that can be cultivated from maize, including wild maize species.

[0128] As used herein, the term "crown" refers to the portion of the flower stem or branch located at the top of the main stem of a plant. Typically, the crown is located at the top of the plant and serves a protective function. The crown is the main part of the plant that carries out photosynthesis, absorbing sunlight energy and using solar energy to synthesize organic matter. In addition, the crown can attract insects for pollination, promoting plant reproduction. The shape and size of the crown vary depending on the plant species. Some plants have crowns that are round or flat, while others have crowns that are conical or tower-shaped. The color of the crown also varies depending on the plant species and can include green, red, yellow, white, etc.

[0129] As used herein, the term "gene" refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. The term includes double-stranded and single-stranded DNA and RNA. Also included are known types of modifications, such as methylation, "capping," and substitution of one or more naturally occurring nucleotides with analogs. Preferably, a gene comprises a coding sequence encoding a polypeptide. A "coding sequence" is a nucleotide sequence that, when placed or under the control of appropriate regulatory sequences, is transcribed into mRNA and / or translated into a polypeptide. The boundaries of the coding sequence are determined by a translation start codon at the 5'-end and a translation stop codon at the 3'-end. A coding sequence may include, but is not limited to, mRNA, cDNA, a recombinant nucleic acid sequence, or genomic DNA, and in some cases introns may also be present.

[0130] As used herein, the term "plant genome" refers to the nuclear genome, mitochondrial genome, or plastid (eg, chloroplast) genome of a plant cell.

[0131] As used herein, the term "nucleic acid" can refer to any polymer comprising deoxyribonucleotides or ribonucleotides, including but not limited to modified or unmodified DNA and RNA, and is not subject to any particular length restrictions. For nucleic acids used to construct recombinant constructs, it is preferred that the nucleic acid be DNA because DNA is more stable and easier to manipulate than RNA.

[0132] As used herein, the term "transformation" is the process of introducing a heterologous nucleic acid (e.g., a nucleic acid construct, vector, expression cassette, etc.) into a host cell or organism. Specifically, "transformation" refers to the process by which a DNA molecule is transiently transferred into an organism, or stably transferred or integrated into the genome of an organism, or capable of autonomous replication. Techniques for transformation of plants and plant cells are well known in the art and may include, for example, electroporation, microinjection, Agrobacterium-mediated transformation, and biolistic transformation.

[0133] As used herein, the term "transformed / transgenic / recombinant" refers to a host organism, such as a bacterium or plant, into which a heterologous nucleic acid molecule has been introduced. The nucleic acid molecule can be stably integrated into the host's genome or the nucleic acid molecule can exist as an extrachromosomal molecule. Such extrachromosomal molecules can replicate automatically. Transformed cells, tissues, or plants are understood to include not only the final product of the transformation process, but also their transgenic progeny. A "non-transformed," "non-transgenic," or "non-recombinant" host refers to a wild-type organism or a naturally occurring organism, such as a bacterium or plant.

[0134] As used herein, the term "operably linked" refers to a functional connection between a promoter or other regulatory element and a relevant transcribable DNA sequence or coding sequence of a gene (or transgene), such that the promoter, etc., at least in a certain cell or tissue, developmental stage, and / or condition, plays a role or function in initiating, assisting, influencing, causing, and / or promoting the transcription and expression of the relevant transcribable DNA sequence or coding sequence. If the transcription of two transcribable DNA sequences is controlled by a common promoter or other regulatory element, then they can also be "operably linked" to each other.

[0135] As used herein, the term "promoter" refers to a nucleic acid sequence that functions to direct the transcription of a downstream coding sequence.

[0136] As used herein, the term "backcross" refers to a process whereby a progeny plant is repeatedly crossed back to one of its parents. In a backcross protocol, the "donor" parent refers to the parent plant that has the desired gene or locus to be introgressed. The "recipient" parent (used one or more times) or the "recurrent" parent (used two or more times) refers to the parent plant into which the gene or locus is introgressed.

[0137] As used herein, the term "crossing" refers to the fusion of gametes through pollination to produce progeny (eg, cells, seeds, or plants).

[0138] As used herein, the term "overexpression" refers to a higher level of expression of a gene in a plant, plant cell, or plant tissue as compared to the expression in a wild-type plant, cell, or tissue. Overexpression can occur throughout the plant, or in a particular tissue of the plant, or in the presence or absence of a particular environmental signal. In certain embodiments, the overexpression can occur at the transcriptional level, the translational level, or both, possibly due to altered regulatory control (e.g., a strong promoter) or increased copy number, or both.

[0139] As used herein, the terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues.

[0140] As used herein, the term "complementary" means that two nucleic acid sequences are capable of forming hydrogen bonds between each other according to the principles of base-pairing (Watson-Crick complementarity) and thereby form a duplex. In the present application, the term "complementary" includes "substantially complementary" and "perfectly complementary". As used herein, the term "perfectly complementary" means that every base in one nucleic acid sequence is capable of base pairing with a base in the other nucleic acid sequence without the presence of mismatches or gaps. As used herein, the term "substantially complementary" means that a substantial number of bases in one nucleic acid sequence are capable of base pairing with a base in the other nucleic acid sequence, which allows for the presence of mismatches or gaps (e.g., one or several nucleotide mismatches or gaps). Typically, two nucleic acid sequences that are "complementary" (e.g., substantially complementary or perfectly complementary) will selectively / specifically hybridize or anneal and form a duplex under conditions that allow nucleic acid hybridization, annealing, or amplification. Accordingly, the term "non-complementary" means that two nucleic acid sequences are incapable of hybridizing or annealing and forming a duplex under conditions that allow nucleic acid hybridization, annealing, or amplification. As used herein, the term "not perfectly complementary" means that bases in one nucleic acid sequence are not capable of perfect base pairing with a base in the other nucleic acid sequence, at least one mismatch or gap is present.

[0141] As used herein, the terms "hybridization" and "annealing" mean the process in which complementary single-stranded nucleic acid molecules form double-stranded nucleic acid. In the present application, "hybridization" and "annealing" have the same meaning and are used interchangeably. Typically, two nucleic acid sequences that are perfectly complementary or substantially complementary can hybridize or anneal. The degree of complementarity required for two nucleic acid sequences to hybridize or anneal depends on the hybridization conditions, particularly the temperature, used.

[0142] As used herein, "conditions permissive for nucleic acid hybridization" have a meaning generally understood by those skilled in the art and can be determined by conventional methods. For example, two nucleic acid molecules with complementary sequences can hybridize under appropriate hybridization conditions. Such hybridization conditions may involve factors such as temperature, the pH, composition, and ionic strength of the hybridization buffer, and may be determined based on the length and GC content of the two complementary nucleic acid molecules. For example, when the two complementary nucleic acid molecules are relatively short and / or have a relatively low GC content, low-stringency hybridization conditions may be employed. When the two complementary nucleic acid molecules are relatively long and / or have a relatively high GC content, high-stringency hybridization conditions may be employed. Such hybridization conditions are well known to those skilled in the art and can be found, for example, in Joseph Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); and MLM Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc., NY (1999). In this application, "hybridization" and "annealing" have the same meaning and are used interchangeably. Accordingly, the expressions "conditions that allow nucleic acid hybridization" and "conditions that allow nucleic acid annealing" also have the same meaning and are used interchangeably.

[0143] Advantageous Effects of the Invention

[0144] Through extensive research, the inventors of this application have discovered a key gene that regulates maize nitrogen utilization efficiency. They have also developed a method for regulating maize nitrogen utilization efficiency by overexpressing this gene, as well as maize plants that efficiently utilize nitrogen, obtained by this method. Furthermore, the inventors have experimentally demonstrated that maize plants overexpressing this key gene have enhanced nitrate absorption or transport capacity, and increased biomass and / or yield.

[0145] Therefore, the key gene and corn plants overexpressing it can improve the efficiency of nitrogen fertilizer utilization in corn, thereby reducing the amount of nitrogen fertilizer applied and promoting environmental sustainability. Furthermore, the gene, method, or plant can be used to improve corn inbred lines or to cultivate new corn varieties that efficiently utilize nitrogen.

[0146] The embodiments of the present invention will be described in detail below with reference to the accompanying drawings and examples, but it will be understood by those skilled in the art that the following drawings and examples are only intended to illustrate the present invention and are not intended to limit the scope of the invention. Based on the following detailed description of the drawings and preferred embodiments, the various objects and advantages of the present invention will become apparent to those skilled in the art. BRIEF DESCRIPTION OF THE DRAWINGS

[0147] Figure 1 Schematic diagram of the structure of the MNT1 gene.

[0148] Figure 2 To identify MNT1 overexpressing materials and detect low nitrogen tolerance phenotype, Figure 2 A is the identification result of two overexpression materials, Figure 2 B is the phenotypic detection of two overexpression materials under high and low nitrogen treatments.

[0149] Figure 3 Root and crown biomass measurements of MNT1 overexpressing materials were performed. Four groups were analyzed: roots and crowns treated with high nitrogen, and roots and crowns treated with low nitrogen. The samples in each group, from left to right, are: wild-type maize inbred line ND101 (WT), MNT1 OE-1, and MNT1 OE-2.

[0150] Figure 4 To detect the nitrate transport activity of MNT1 protein.

[0151] Figure 5 The nitrogen content of stems and leaves of MNT1 overexpressing inbred lines and hybrids was detected under different nitrogen conditions in the field. Figure 5 A and Figure 5 B shows the nitrogen content test results of leaves and stems of MNT1 overexpressing inbred line plants and wild-type control inbred line ND101; Figure 5 C and Figure 5 D are the nitrogen content detection results of leaves and stems of MNT1 overexpressing hybrid plants and control hybrid plants (hybrid of ND101 and T13), respectively.

[0152] Figure 6 The single ear weight traits of MNT1 overexpressing inbred lines and hybrids under different nitrogen treatments are shown in Figure 2. Figure 6 A is the result of single ear weight test of MNT1 overexpression inbred line and wild type control inbred line ND101. Figure 6 B is the results of single ear weight test of MNT1 overexpressing hybrid plants and control hybrid plants (hybrid of ND101 and T13).

[0153] Figure 7Comparison of the differential regions of the MNT1 gene promoter between the inbred varieties Zheng58 and Teo.

[0154] Figure 8 NIL Teo and NIL Zheng58 Comparison of phenotype, xylem bleeding sap nitrate content and biomass under different nitrogen treatments. Figure 8 A is NIL under low nitrogen / high nitrogen conditions Teo and NIL Zheng58 Phenotypic comparison of the low nitrogen and high nitrogen conditions, with NIL on the left in each group. Zheng58 , the right side is NIL Teo ; Figure 8 B is the comparison of nitrate content in xylem bleeding sap of two genotypes under low nitrogen / high nitrogen conditions, divided into two groups under low nitrogen / high nitrogen conditions, with NIL on the left in each group Zheng58 , the right side is NIL Teo ; Figure 8 C is the comparison of biomass of two genotypes under low nitrogen / high nitrogen conditions, divided into two groups under low nitrogen / high nitrogen conditions, with NIL on the left in each group Zheng58 , the right side is NIL Teo .

[0155] Sequence information

[0156] A description of the sequences involved in this application is provided in the table below.

[0157] Table 1: Sequence information

[0158]

[0159]

[0160]

[0161]

[0162]

[0163] DETAILED DESCRIPTION

[0164] The invention will now be described in the following non-limiting examples.

[0165] Those skilled in the art will appreciate that the examples are provided to illustrate the present invention by way of example and are not intended to limit the scope of the invention. The experimental methods in the examples are conventional methods unless otherwise specified. Where specific conditions are not specified in the examples, the experiments were carried out according to conventional conditions or the conditions recommended by the manufacturer. Where the manufacturer of the reagents or instruments is not specified, they are all commercially available conventional products.

[0166] Example 1: Identification and phenotypic analysis of MNT1 overexpressing materials

[0167] The inventors of this application discovered a gene that can improve the nitrogen utilization efficiency of corn in their previous research and named it MNT1 (Maize NO3-Transporter 1). The amino acid sequence of the MNT1 protein is shown in SEQ ID No: 2, the nucleotide sequence encoding the protein is shown in SEQ ID No: 1, and the schematic diagram of the MNT1 gene structure is shown in Figure 1 shown.

[0168] Overexpression of MNT1

[0169] The CDS of the MNT1 gene (SEQ ID No: 3) was driven by the Ubiquitin promoter (SEQ ID No: 4) to transform the wild-type material. The pBCXUN expression vector (Qin YJ, Wu WH, Wang Y. ZmHAK5 and ZmHAK1 function in K+ uptake and distribution in maize under low K+ conditions. J Integr Plant Biol. 2019 Jun; 61(6): 691-705. doi: 10.1111 / jipb.12756. Epub 2019 Feb 1. PMID: 30548401) preserved in our laboratory was used to construct the maize MNT1 gene overexpression material:

[0170] RNA was extracted from maize B73 leaves and reverse transcribed using the obtained RNA as a template to generate cDNA. PCR amplification of the obtained cDNA was performed using primers F: 5'-GGGTCTTCGTCTTCGTGTAC-3' and R: 5'-GAACTGGTCGTAGTAGAACTCG-3'. The resulting PCR product was sequenced and revealed the CDS sequence of the MNT1 gene. The amplified PCR product was recovered and purified to obtain a purified product. This product was then inserted into the XcmI restriction site of the expression vector pBCXUN via TA cloning to generate the recombinant expression vector pBCXUN-MNT1. XcmI restriction enzyme digestion results in the formation of two T tails. The recombinant expression vector pBCXUN-MNT1 was transformed into competent cells of Agrobacterium tumefaciens EHA105 and cultured in YEP medium (containing 50 mg / L kanamycin) at 28°C for two days. Positive clones were selected and identified by PCR using primers F: 5'-GGGTCTTCGTCTTCGTGTAC-3' and -R: 5'-GAACTGGTCGTAGTAGAACTCG-3' (product size: 1392 bp). The positive bacterial solution identified by PCR was designated recombinant Agrobacterium tumefaciens EHA105 / pBCXUN / MNT1 and stored at -80°C. The recombinant Agrobacterium EHA105 / pBCXUN / MNT1 was transformed into the maize inbred line material ND101 to obtain the T0 generation MNT1 transgenic overexpressing maize material, and the positive plants were detected using the PCR amplification method of the screening marker Bar gene (primers Bar-F: GAAGGCACGCAACGCCTACGA, Bar-R: CCAGAAACCCACGTCATGCCA, target fragment of approximately 262 bp); the T0 generation MNT1 transgenic overexpressing maize material was harvested to obtain the T1 generation MNT1 transgenic overexpressing maize material for planting and identification until seeds of the T3 generation MNT1 transgenic overexpressing maize material MNT1 OE were obtained.

[0171] Two overexpression lines were obtained and named MNT1 OE-1 and MNT1 OE-2. Uniformly sized, plump corn seeds were sterilized with 10% H₂O₂ for 20 minutes. They were then rinsed with deionized water and germinated at 25°C. After germination, the seeds were placed on a clean, moist sand bed. When they had one leaf and one heart, uniformly growing seedlings were selected for soil cultivation. Hoagland's nutrient solution was used, containing 4mM Ca(NO₃)₂·4H₂O for the high-nitrogen treatment and 0.4mM Ca(NO₃)₂·4H₂O for the low-nitrogen treatment. Root RNA was extracted from wild-type and overexpression lines and reverse-transcribed for RT-qPCR.

[0172] The results showed that both overexpression lines achieved overexpression to varying degrees ( Figure 2 A). The high and low nitrogen phenotypes of the overexpressing materials were tested. MNT1 overexpression showed delayed yellowing of old leaves compared to the wild type, indicating tolerance to low nitrogen ( Figure 2 B).

[0173] Example 2: Biomass Detection of MNT1 Overexpressing Materials

[0174] Maize MNT1 overexpression materials (MNT1 OE-1 and MNT1 OE-2) were self-crossed for three generations to obtain T3 generation MNT1 overexpression materials. These materials were grown to the V5 stage and then separated from their wild-type maize inbred line ND101 to obtain root and crown materials. The materials were then oven-dried at 80°C to a constant weight. The biomass was weighed and the results showed that the biomass of the crown of the MNT1 overexpression material was significantly increased ( Figure 3 ), indicating that the increase in crown nitrogen content led to a significant increase in biomass.

[0175] Example 3: Functional verification of MNT1 protein

[0176] 3.1 Nitrate transport activity assay of MNT1 protein

[0177] Using wild-type cDNA as a template, the CDS sequence of MNT1 protein (SEQ ID No: 3) was amplified and ligated into the pGEMHE Xenopus oocyte expression vector (stored in our laboratory). After in vitro transcription of cRNA, it was injected into Xenopus oocytes (cultured in our laboratory). The oocytes to be injected were placed in a NO-free 3- Modified Barths (MBS) solution (a layer of nylon mesh was laid on the bottom of the culture dish in advance to prevent the oocyte from moving). The injection capillary was moved to the vicinity of the oocyte using a three-dimensional manipulator and slowly inserted into the interface between the animal pole and the vegetal pole of the oocyte. The pneumatic microinjector pedal was stepped on to inject 25nL of MNT1 cRNA into the oocyte. The capillary was gently withdrawn after a few seconds. Cultured at 18°C ​​for 2.5 days, the culture medium was changed twice a day, and necrotic eggs were removed at the same time. The current of Xenopus oocytes was recorded using a dual-voltage clamp. When the MNT1 protein was co-expressed with the NAR protein, it was found that MNT1 mediated the outward nitrate current ( Figure 4 ).

[0178] 3.2 Determination of nitrogen content in leaves and stems of MNT1 overexpressing materials

[0179] Obtaining MNT1 overexpression inbred line materials: Maize MNT1 overexpression materials (MNT1 OE-1 and MNT1OE-2) were self-pollinated for three generations to obtain T3 generation MNT1 overexpression materials.

[0180] Obtaining of MNT1 overexpression hybrid material: MNT1 overexpression materials (MNT1 OE-1 and MNT1 OE-2) were crossed with inbred line T13 (from the Center of Crop Functional Genomics and Molecular Breeding, China Agricultural University) respectively to obtain MNT1 overexpression hybrid materials.

[0181] MNT1 overexpression inbred material lines and wild type control corn inbred line ND101, and MNT1 overexpression hybrid materials and control hybrid materials (hybrid of ND101 and T13) were planted respectively in Beijing Shangzhuang Experimental Station of China Agricultural University, Sanya Experimental Station of Hainan and Gongzhuling Experimental Station of Jilin to determine the nitrogen content of leaf and stem.

[0182] 1. Planting conditions and treatments

[0183] The corn materials were planted in the field with row length of 2.5 m, plant spacing of 0.25 m and row spacing of 0.5 m. The seeds were coated before sowing, double-seed sowing was implemented, and after germination, the seedlings were grown to 13 plants per row during V3 period. Three nitrogen gradients were set in the three test stations, each nitrogen treatment set three replicates, and each replicate included 65 single plants. The fertilization of the plots was as follows in Table 2.

[0184] Table 2: Fertilization scheme

[0185] Fertilization plan <![CDATA[低氮(120kg ha -1 )]]> <![CDATA[中氮(180kg ha -1 )]]> <![CDATA[高氮(240kg ha -1 )]]> Stanley compound fertilizer (15-15-15) 50kg / mu 50kg / mu 50kg / mu urea 1.1kg / mu 9.78kg / mu 18.48kg / mu

[0186] The fertilization of different nitrogen treatments was achieved by using different concentrations of urea, and Stanley compound fertilizer was applied as basal fertilizer in the early stage, and different concentrations of urea were applied as topdressing at the jointing stage.

[0187] 2. Sampling to determine the nitrogen content of leaf and stem

[0188] The ear leaves at silking stage and the stems were selected to determine the nitrogen content of leaf and stem. After sampling, the materials were dried at 80 degrees, and ground into powder. 0.1 g of plant sample was weighed into a digestion tube (make sure to pour into the bottom to prevent sticking to the wall), and the specific weight was recorded. A small funnel was placed on each digestion tube, 0.5 mL of distilled water was added, 1 g of catalyst (K2SO4: CuSO4 10:1) was added, and finally 5 mL of concentrated sulfuric acid was added with a pipette. The digestion furnace was heated to 200°C and kept for 30 min, then heated to 380°C and digested until the sample turned peacock green, and continued to keep warm for 30-60 min. After cooling, add deionized water to 50 mL. Take 1 mL of sample in a 1.5 mL centrifuge tube, centrifuge at 18000 rpm / min for 1 min. Transfer 200 μL of supernatant to a 5 mL centrifuge tube and add 3.80 mL of deionized water. After filtering the sample, it was measured by flow analyzer.

[0189] The experimental results are as follows Figure 5As shown in the results, under low nitrogen conditions, both the MNT1 overexpressing inbred line material and the overexpressing hybrid material had significantly higher nitrogen content in leaves and stems than the control material.

[0190] Example 4: Yield trait detection of MNT1 overexpressing inbred lines and hybrids

[0191] The MNT1 overexpressing inbred lines were harvested from the field under different nitrogen treatments and the results showed that 120 kg ha -1 Under low nitrogen conditions, the ear weight of the MNT1 overexpressing inbred lines was significantly higher than that of the control materials ( Figure 6 A). Similarly, the ear weight of the MNT1 overexpressing hybrid material under low nitrogen conditions was significantly higher than that of the control material ( Figure 6 B) This suggests that overexpression of MNT1 can increase corn ear yield under low nitrogen conditions. In production, regulating MNT1 expression may improve nitrogen utilization efficiency in corn.

[0192] Example 5: NIL Teo 、NIL Zheng58 Construction of near-isogenic lines (NILs) and determination of nitrate content The promoter region of the MNT1 gene in the inbred line variety (Zheng58) and Teo (Teo) showed significant differences ( Figure 7 ). The sequence of the MNT1 gene promoter in Zheng58 is shown in SEQ ID NO: 5, and the sequence of the MNT1 gene promoter in Teo is shown in SEQ ID NO: 6. A near-isogenic line was constructed using the maize inbred line Teo as the donor parent and Zheng58 as the recipient parent. Teo and Zheng58 were backcrossed twice and then selfed for three generations to obtain BC2F4. The backcross progeny were identified using PCR polymorphic markers distributed on 10 chromosomes to obtain NIL-containing Teo The near-isogenic lines. 3- The results showed that the NIL Zheng58 Compared to NIL Teo , showed higher biomass and higher nitrate content in xylem bleeding sap ( Figure 8 A-8C).

[0193] Although the specific embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that various modifications and variations may be made to the details based on all the teachings disclosed, and that such modifications are within the scope of protection of the present invention. The full scope of the present invention is given by the appended claims and any equivalents thereof.

[0194] All patents, applications, publications, test methods, literature, and other materials cited herein are incorporated by reference.

Claims

1. A nucleic acid molecule comprising a sequence selected from the group consisting of: (1) a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 2; (2) a nucleotide sequence encoding an amino acid sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the amino acid sequence of SEQ ID NO: 2, wherein the encoded polypeptide has the function of regulating plant nitrogen use efficiency, nitrate uptake or transport, biomass and / or yield; (3) A nucleotide sequence encoding an amino acid sequence obtained by substituting, deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID NO: 2, wherein the encoded polypeptide has the function of regulating plant nitrogen utilization efficiency, nitrate absorption or transport, biomass and / or yield.

2. A nucleic acid molecule comprising a sequence selected from the group consisting of: (1) the nucleotide sequence shown in SEQ ID NO: 1 or 3; (2) a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the nucleotide sequence of SEQ ID NO: 1 or 3, and the polypeptide encoded by the nucleotide sequence has the function of regulating plant nitrogen use efficiency, nitrate uptake or transport, biomass and / or yield; (3) A nucleotide sequence that can hybridize with the sequence shown in SEQ ID NO: 1 or 3 under conditions that allow nucleic acid hybridization.

3. The nucleic acid molecule according to claim 1 or 2, wherein The nucleic acid molecule further comprises a promoter; Preferably, the promoter is operably linked to the 5' end of any one of the sequences in (1)-(3), and the promoter is capable of regulating the transcription and / or expression (e.g., whether the sequence is expressed, and the expression level) of any one of the sequences in (1)-(3); Preferably, the promoter is selected from a constitutive promoter, an inducible promoter or a tissue-specific promoter; Preferably, the promoter sequence is a natural promoter sequence derived from animals, plants or microorganisms, or an artificially modified promoter sequence; Preferably, the artificially modified promoter sequence is obtained by gene editing; Preferably, the promoter sequence is a promoter sequence derived from a plant; Preferably, the promoter has a sequence shown in any one of SEQ ID NOs: 4-6.

4. The nucleic acid molecule according to any one of claims 1 to 3, which has one or more characteristics selected from the group consisting of: (1) The nitrogen is nitrogen from nitrate nitrogen, nitrogen from ammonium nitrogen, nitrogen from amide nitrogen, or any combination thereof; (2) The nitrogen includes: Nitrate or substances capable of forming nitrate, and urea; (3) The biomass regulation is selected from the group consisting of regulating the height of the aboveground part of the plant, regulating the weight of the aboveground part, regulating the weight of the underground part, or any combination thereof; (4) the yield regulation is regulation of grain weight, regulation of seed setting rate, regulation of total number of grains, regulation of thousand-grain weight, or any combination thereof; (5) The regulating the nitrogen utilization efficiency of the plant comprises regulating one or more aspects selected from the following: (1) Regulate the nitrate content in the crown of plants; (2) regulating the crown biomass of plants; (3) regulating the nitrogen content of plants (e.g., stem nitrogen content, leaf nitrogen content, and grain nitrogen content); (4) Regulate the yield of individual plants.

5. A polypeptide obtained by transcription and / or expression of the nucleic acid molecule according to any one of claims 1 to 4; Preferably, the polypeptide has the amino acid sequence shown in SEQ ID NO: 2, or the polypeptide has an amino acid sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the amino acid sequence shown in SEQ ID NO:

2.

6. A nucleic acid construct comprising the nucleic acid molecule according to any one of claims 1 to 4; Preferably, the nucleic acid construct further comprises a regulatory element operably linked to the nucleotide sequence encoding the polypeptide; Preferably, the regulatory element is capable of regulating the expression of the polypeptide (e.g., whether it is expressed, or the expression level); Preferably, the regulatory element is selected from 5'UTR, 3'UTR, terminator, or any combination thereof.

7. A recombinant vector comprising the nucleic acid molecule according to any one of claims 1 to 4 or the nucleic acid construct according to claim 5.

8. A host cell comprising the nucleic acid molecule according to any one of claims 1 to 4, or the polypeptide according to claim 5, or the nucleic acid construct according to claim 6, or the recombinant vector according to claim 7.

9. A genetically modified plant or part, seed, cell or progeny thereof, comprising the nucleic acid molecule according to any one of claims 1 to 4, or the nucleic acid construct according to claim 6, or the recombinant vector according to claim 7; Preferably, the plant is selected from the group consisting of corn, rice, soybean, sunflower, sorghum, rapeseed, wheat, alfalfa, cotton, barley, millet and sugarcane.

10. Use of the nucleic acid molecule according to any one of claims 1 to 4, the polypeptide according to claim 5, the nucleic acid construct according to claim 6, or the recombinant vector according to claim 7 in regulating nitrogen use efficiency, nitrate uptake or transport, biomass and / or yield of plants; Preferably, the nitrogen use efficiency, biomass or yield is as defined in claim 4.

11. A method for preparing a transgenic plant, a part, seed, cell or progeny thereof, comprising: (i) transforming a plant cell with the nucleic acid molecule according to any one of claims 1 to 4, the nucleic acid construct according to claim 6, or the recombinant vector according to claim 7; (ii) developing or regenerating a plant from the plant cell; Preferably, the plant is selected from the group consisting of corn, rice, soybean, sunflower, sorghum, rapeseed, wheat, alfalfa, cotton, barley, millet and sugarcane.

12. The method of claim 11, wherein The method further comprises: (iii) selfing the plant of (ii) with itself or crossing it with a second plant to produce seeds of the transgenic plant; Preferably, the seeds of the transgenic plant contain the genomic DNA of the transgenic plant; Preferably, the second plant is selected from the group consisting of corn, rice, soybean, sunflower, sorghum, rapeseed, wheat, alfalfa, cotton, barley, millet and sugarcane; Preferably, the plant is corn and the second plant is also corn; Preferably, the plant of (ii) is used as the male parent and is crossed with a second plant as the female parent to produce transgenic plant seeds.

13. A method for regulating nitrogen use efficiency, nitrate uptake or transport, biomass and / or yield in plants, the method comprising: Increasing the expression level of the polypeptide according to claim 5 in the plant; or applying (e.g., spraying, applying) the polypeptide according to claim 5 to the plant; Preferably, the method is implemented by the following steps: (a) transforming a plant cell with the nucleic acid molecule according to any one of claims 1 to 4, the nucleic acid construct according to claim 6, or the recombinant vector according to claim 7; (b) expressing the nucleic acid molecule in the plant cell; (c) developing or regenerating a plant from the plant cell; Optionally, the method further comprises: (d) selecting from the plants of step (c) plants having increased nitrogen use efficiency, nitrate uptake or transport, biomass and / or yield compared to wild-type plants grown under the same conditions; Preferably, the plant is selected from the group consisting of corn, rice, soybean, sunflower, sorghum, rapeseed, wheat, alfalfa, cotton, barley, millet and sugarcane; Preferably, the nitrogen use efficiency, biomass or yield is as defined in claim 4.

14. A product comprising the plant of claim 9 or a part, seed, cell or progeny thereof; Preferably, the preparation comprises genomic DNA of the plant or part, seed, cell or progeny thereof; Preferably, the product is selected from one or more of corn ears, dehusked corn, corn silk, corn pollen, corn grits, corn flour, crushed corn, cornmeal, corn oil, corn starch, corn steep liquor, corn malt, corn sugar, corn syrup, margarine produced from corn oil, unsaturated corn oil, saturated corn oil, corn flakes, popcorn, ethanol and / or liquor produced from corn, distillers dried grains (DDGS) produced from corn fermentation, animal feed from corn, cosmetics, and fillers.

15. A method for regulating the transcription and / or expression of a nucleic acid molecule according to any one of claims 1 to 4, or the expression of a polypeptide according to claim 4, comprising introducing a modification into a nucleic acid molecule according to any one of claims 1 to 4, or a nucleic acid molecule encoding a polypeptide according to claim 5; Preferably, the modification is located in the promoter; Preferably, the modification comprises deletion, substitution, insertion, inversion, duplication or any combination thereof; Preferably, the modification is introduced by gene editing; Preferably, the genome editing comprises the use of at least one site-specific nuclease, such as an RNA-guided nuclease (e.g., a Cas nuclease), a zinc finger nuclease, a meganuclease, a TALE nuclease, a recombinase, a transposase, and any combination thereof; Preferably, the genome editing is selected from CRISPR / Cas, TALEN, ZFN, transposon technology, PASTE technology, PE technology, base editor, and any combination thereof; Preferably, the modification is capable of increasing or inhibiting the transcription and / or expression of the nucleic acid molecule according to any one of claims 1 to 4, or the expression of the polypeptide according to claim 5.

Images