Application of rice gene STP1 in cultivation of cold-tolerant rice variety
By using knockout mutants and overexpression materials of the STP1 gene, it was proved that it negatively regulates the cold tolerance of rice seedlings, solves the problem of rice being susceptible to low temperature damage, enhances the cold tolerance of rice, and provides new genetic resources for the breeding of cold-tolerant rice varieties.
Patent Information
- Application Number
- CN202511014380.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-23
- Publication Date
- 2025-10-10
AI Technical Summary
Rice is susceptible to low temperature damage, which leads to decreased yield and quality. Existing technologies lack effective cold-resistant gene resources, affecting rice production safety.
By using the STP1 gene and constructing its knockout mutants and overexpression materials, it was proved that it negatively regulates the cold tolerance of rice seedlings, providing new genetic resources for breeding cold-tolerant rice varieties.
It enhances the cold tolerance of rice at the seedling stage, provides new genetic resources, offers an important genetic improvement method for breeding cold-tolerant rice varieties, and ensures the safety of rice production.
Smart Images

Figure CN120758552A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of plant genetic engineering, and in particular to the application of rice gene STP1 in cultivating cold-resistant rice varieties. Background Art
[0002] Rice, a staple food crop, is susceptible to cold damage, which severely impacts rice yield and quality. Low temperatures primarily impact rice during the seedling and reproductive stages. Cold damage during the seedling stage can cause chlorosis, reduced tillering, and, in severe cases, even plant death. Cold damage during the reproductive stage can lead to pollen abortion, reduced seed set, and increased chalkiness, severely impacting yield and quality. Cold damage has become a major adverse factor impacting rice production. Therefore, the identification and genetic improvement of cold-tolerance genes in rice are crucial for ensuring my country's food security. Summary of the Invention
[0003] The present invention aims to provide the application of the rice gene STP1 in breeding cold-tolerant rice varieties. This invention demonstrates for the first time that the STP1 gene has the function of negatively regulating the cold tolerance of rice seedlings, and also provides a new gene resource for breeding cold-tolerant rice varieties.
[0004] In order to achieve the above-mentioned object of the invention, the technical solution adopted by the present invention is:
[0005] Provided is an STP1 gene for cultivating cold-tolerant rice varieties. The sequence of the STP1 gene includes the following groups of nucleotide sequences:
[0006] (1) the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.2 in the sequence listing;
[0007] (2) a nucleotide sequence that is at least 70%, preferably 80%, more preferably 90%, more preferably 95%, 98% or 99% identical to the nucleotide sequence in (1);
[0008] (3) a nucleotide sequence that encodes a protein having the same amino acid sequence as the nucleotide sequence in (1) but differs in sequence due to the degeneracy of the genetic code;
[0009] (4) a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO. 3, or a nucleotide sequence encoding an amino acid sequence that differs from the amino acid sequence set forth in SEQ ID NO. 3 by substitution, deletion and / or insertion of one or more (preferably, 1 to 25, preferably 1 to 20, more preferably 1 to 15, more preferably 1 to 10, more preferably 1 to 5, more preferably 1 to 3) amino acid residues, or a nucleotide sequence encoding an amino acid sequence that is at least 70%, preferably 80%, more preferably 90%, more preferably 95% or 98% identical to the amino acid sequence set forth in SEQ ID NO. 3;
[0010] (5) An active fragment of any nucleotide sequence of (1) to (4);
[0011] (6) A nucleotide sequence complementary to any one of the nucleotide sequences (1) to (4).
[0012] The present invention also provides a protein encoded by the STP1 gene that can be used to cultivate cold-tolerant rice varieties. The protein encoded by the STP1 gene includes the following groups of amino acid sequences:
[0013] (1) encoding the amino acid sequence set forth in SEQ ID NO. 3, or an amino acid sequence that differs from the amino acid sequence set forth in SEQ ID NO. 3 by substitution, deletion, and / or insertion of one or more amino acid residues, or an amino acid sequence that is at least 70%, preferably 80%, more preferably 90%, and even more preferably 95% or 98% identical to the amino acid sequence set forth in SEQ ID NO. 3;
[0014] (2) an active fragment of the amino acid sequence of (1) above;
[0015] (3) The amino acid sequence encoded by the nucleotide sequence of the aforementioned STP1 gene.
[0016] The present invention also provides a plant expression vector or a cloning vector that can be used to cultivate cold-tolerant rice varieties. The plant expression vector or the cloning vector includes the aforementioned STP1 gene.
[0017] The present invention also provides a host cell for cultivating cold-tolerant rice varieties, wherein the host cell comprises the aforementioned STP1 gene. Preferably, the host cell is selected from a plant cell or a microbial cell.
[0018] The present invention also provides a method for cultivating cold-tolerant rice varieties, wherein transgenic cold-tolerant rice plants are obtained by transfecting rice plants with recombinant Agrobacterium containing the aforementioned STP1 gene.
[0019] The beneficial effects of the present invention are:
[0020] (1) The cloned rice STP1 gene of the application is a PP2C homologous gene, has serine / threonine protein phosphatase activity, but is different from the ABA signal pathway regulation of cold tolerance, and the functional analysis of the gene helps to enrich the diversity of the genetic mechanism of rice cold tolerance.
[0021] (2) The application is verified by experiments, the cold tolerance of the STP1 mutant is enhanced, the cold tolerance of the overexpression transgenic rice strain is reduced, and the yield and related agronomic traits are not different from the wild type. Therefore, the STP1 gene can be used for genetic improvement of rice cold tolerance. The application provides a new gene resource for breeding of cold-tolerant rice varieties, and has important application value for breeding of cold-tolerant rice varieties and protection of rice production safety.
[0022] In summary, the research results of the application show that the cold tolerance of the STP1 mutant is enhanced, the cold tolerance of the overexpression transgenic rice strain is reduced, and the cold tolerance of the overexpression transgenic rice strain is reduced, which is negatively regulated in the seedling stage. The coding sequence of the STP1 gene, the nucleotide sequence in the genome and the protein sequence encoded by the gene are SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3, respectively. The application first proves that the STP1 gene has the function of regulating the cold tolerance of rice. The STP1 gene has great application prospect for breeding of cold-tolerant rice varieties, and the application provides a new gene resource for breeding of cold-tolerant rice varieties. BRIEF DESCRIPTION OF DRAWINGS
[0023] Figure 1 The stp1 mutant material is in the seedling stage cold tolerance phenotype; note: (A) stp1 mutant genotype analysis; (B) stp1 mutant seedling low temperature treatment plant type; (C) stp1 mutant seedling low temperature survival rate; error line indicates standard deviation (SD); statistical analysis uses t test; different letters indicate significant difference (P<0.05); data from 3 biological replicates (n=3);
[0024] Figure 2 The stp1 mutant material is in the seedling stage cold tolerance phenotype; note: (A) stp1 mutant genotype analysis; (B) stp1 mutant seedling low temperature treatment plant type; (C) stp1 mutant seedling low temperature survival rate; error line indicates standard deviation (SD); statistical analysis uses t test; different letters indicate significant difference (P<0.05); data from 3 biological replicates (n=3);
[0025] Figure 3 The stp1 mutant material is in the seedling stage cold tolerance phenotype; note: (A) stp1 mutant genotype analysis; (B) stp1 mutant seedling low temperature treatment plant type; (C) stp1 mutant seedling low temperature survival rate; error line indicates standard deviation (SD); statistical analysis uses t test; different letters indicate significant difference (P<0.05); data from 3 biological replicates (n=3);
[0026] Figure 4 The normal temperature phenotype of STP1 overexpressing materials at the seedling stage; Note: (A) Plant type of STP1 overexpressing lines treated at normal temperature at the seedling stage; (B) Survival rate of STP1 overexpressing lines at normal temperature at the seedling stage; Error bars represent standard deviation (SD); Statistical analysis was performed using t-test; Different letters indicate significant differences (P<0.05); Data were from 3 biological replicates (n=3). DETAILED DESCRIPTION
[0027] The specific embodiments of the present invention are described below to facilitate understanding of the present invention by those skilled in the art. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the appended claims, these changes are obvious, and all inventions and creations utilizing the concepts of the present invention are protected.
[0028] Example 1: Cloning of the rice cold-tolerant gene STP1
[0029] PP2C is known to be a core factor in the ABA signaling pathway, negatively regulating cold tolerance. Using homology comparison of PP2C amino acid sequences, a homologous gene, STP1, was identified in rice. This gene is expressed in roots, leaves, and anthers and exhibits serine / threonine protein phosphatase activity. Transgenic methods were used to construct knockout mutants and overexpression materials of this gene. Seedling cold tolerance experiments showed that mutations enhanced cold tolerance in seedlings, while overexpression reduced cold tolerance, indicating that STP1 negatively regulates cold tolerance in rice. Figure 1-4 ). The cDNA sequence of the gene is shown in SEQ ID NO.1, the genomic nucleotide sequence is shown in SEQ ID NO.2, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.3.
[0030] Example 2: Construction of gene STP1 overexpression vector and rice genetic transformation
[0031] Construction of overexpression vector:
[0032] 1) Primer design and gene amplification: Based on the coding region sequence of STP1, primers STP1-OE-F (GTCGACTCTAGAGGATCCATGGCCACCGCCGCCGCC) (SEQ ID NO. 4) containing a BamhI restriction site and primer STP1-OE-R (CGATCGGGGAAATTCGAGCTCTTAAGCCGCCTTAGCTTGTACCTC) (SEQ ID NO. 5) containing a SacI restriction site were designed. The STP1 gene was amplified using cDNA of the japonica rice variety Nip as a template.
[0033] 2) Vector digestion: digest the vector pTCK303 with BamhI and SacI.
[0034] 3) DNA recovery: DNA recovery reagent from Tiangen Biotechnology was used to recover PCR products and vector enzyme digestion products;
[0035] 4) Homologous recombination: The STP1 gene was homologously recombined with pTCK303 using the Infusion kit from Nanjing Novozymes according to its instructions;
[0036] 5) DH5a transformation: Add 20 μL of the homologous recombination product to 50 μL of DH5a competent cells, mix gently, place on ice for 30 min, then heat shock in a 42°C water bath for 45 s. Immediately place on ice for 2 min, then add 900 μL of LB medium and incubate at 37°C for 1 h at 200 rpm. Then, spread the plate onto a solid LB medium plate containing Kana antibiotics and incubate in a 37°C incubator overnight.
[0037] 6) Plasmid extraction: After overnight culture, 10 plaques were inoculated into liquid LB medium containing Kana antibiotics and incubated at 37°C in a shaker at 200 rpm for 12 h. When the culture solution became turbid, plasmids were extracted using the Tiangen Plasmid Extraction Kit and digested with BamhI and SacI to identify positive clones.
[0038] 7) The positive plasmid was entrusted to Qingke Biotechnology Co., Ltd. for Sanger sequencing using amplification primers to confirm that the exogenous sequence cloned into the expression vector was the STP1 gene without mutation.
[0039] Rice genetic transformation and phenotypic identification:
[0040] The plasmid was transformed into Agrobacterium tumefaciens GV3101 strain by heat shock method, and then transformed into japonica rice variety ZH11 by Agrobacterium-mediated method (Agrobacterium infection method reference: Lin Yongjun et al., Acta Agronomica Sinica, 2002, 28: 294-300). The T0, T1, and T2 transgenic plants were continuously tracked using hygromycin gene, and the transgenic families with positive T2 plants were selected for STP1 expression analysis ( Figure 3 A).
[0041] In conclusion, the application identifies a gene STP1 regulating cold tolerance of rice seedling by homologous alignment and mutant screening. The gene encodes a serine / threonine protein phosphatase, which is expressed in root, leaf and anther tissue and has protein phosphatase activity. It is known that serine / threonine protein phosphatase PP2C is a core negative regulatory factor in ABA signal pathway and negatively regulates cold tolerance of rice. In order to identify the regulation of STP1 on cold tolerance of rice, STP1 knock-out mutant and overexpression transgenic material are used to identify cold tolerance of seedling, and the results show that STP1 negatively regulates cold tolerance of rice and does not affect main agronomic traits such as yield of rice. Therefore, the application firstly proves that STP1 (database number: LOC_Os11g15570) gene has the function of negatively regulating cold tolerance of rice seedling, and the application simultaneously provides a new gene resource for breeding of cold-tolerant rice varieties.
[0042] It will be obvious to a person skilled in the art that the application is not limited to the details of the above-described exemplary embodiments but can be implemented in other embodiments without departing from the scope of the application. The embodiments are to be considered in all respects as illustrative and not restrictive, the scope of the application being indicated by the appended claims rather than by the above description, and all changes which come within the meaning and range of equivalents of the claims are therefore intended to be embraced therein.
[0043] Furthermore, it should be understood that, although the present specification is described in terms of embodiments, not every implementation embodies an independent technical solution, and the description of the specification is only for the sake of clarity, and those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can be appropriately combined to form other embodiments that those skilled in the art can understand.
Claims
1. Application of rice gene STP1 in breeding cold-tolerant rice varieties, characterized in that: The cDNA sequence of the rice gene STP1 is shown in SEQ ID NO. 1, and its genomic nucleotide sequence is shown in SEQ ID NO.
2. The rice gene STP1 negatively regulates the cold tolerance of rice at the seedling stage.
2. The use of the protein encoded by the rice gene STP1 in breeding cold-tolerant rice varieties, characterized in that: The amino acid sequence of the protein encoded by the rice gene STP1 is shown in SEQ ID NO.
3.
3. Use of a plant expression vector or cloning vector in cultivating cold-tolerant rice varieties, characterized in that: The plant expression vector or cloning vector comprises the rice gene STP1 according to claim 1.
4. Use of the host cell in cultivating cold-tolerant rice varieties, characterized in that: The host cell comprises the rice gene STP1 according to claim 1.
5. The use according to claim 4, characterized in that The host cell is selected from plant cells or microbial cells.
6. A method for cultivating cold-tolerant rice varieties, characterized in that: The method comprises: using recombinant Agrobacterium containing the rice gene STP1 according to claim 1 to transfect rice plants to obtain transgenic cold-tolerant rice plants.