A method for improving yield, salt-alkali tolerance and disease resistance of rice based on 35s enhancer knock-in technology
By introducing the 35S enhancer and bZIP domain into the rice genome and combining it with CRISPR-Cas9 technology, the gene regulation problem of rice salt tolerance and disease resistance was solved, achieving efficient breeding and yield improvement of rice in saline-alkali land.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-20
- Publication Date
- 2026-03-03
AI Technical Summary
Current technologies lack effective gene regulation methods to improve the salt tolerance and disease resistance of rice, and traditional transgenic technology has the risks of genome damage and expression instability.
By knocking the 35S enhancer into the rice genome, the expression of the OsMYB106 gene was upregulated using the bZIP domain encoding gene and the 35S enhancer DNA fragment, and combined with CRISPR-Cas9 technology, the salt tolerance and disease resistance of rice were improved.
It significantly improved the stress resistance and disease resistance of rice in saline-alkali land, while increasing yield and reducing breeding workload and errors.
Smart Images

Figure CN120758554B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular breeding and plant genetic engineering technology, specifically relating to a method for improving rice yield, salt tolerance and disease resistance based on 35S enhancer knock-in technology. Background Technology
[0002] Developing and utilizing coastal mudflats and inland saline-alkali land resources is one of the effective ways to ensure arable land area. Rice is a moderately salt-sensitive crop that grows in aquatic environments; rice cultivation can leach soluble salts and alkalis from the soil. Therefore, rice is the preferred food crop for developing coastal mudflats and saline-alkali land.
[0003] Manipulating gene expression is crucial for advancing plant traits and agricultural productivity; however, there is currently a lack of manipulative genes to regulate salt tolerance and disease resistance in rice. Furthermore, traditional gene upregulation methods heavily rely on transgenic technology. While these technologies have had a significant impact on the biotechnology field, they also face challenges such as unpredictable risks of genome disruption, changes in expression levels due to ectopic insertions, and the stability of transgenes across generations. Summary of the Invention
[0004] In view of this, the object of the present invention is to provide an upward adjustment OsMYB106 The reagent for improving gene expression levels effectively increases rice yield, salt tolerance, and disease resistance by knocking in the 35S enhancer into the rice genome.
[0005] This invention provides an up-regulation OsMYB106 Reagents for gene expression levels, including those containing bZIP Plant gene editing vectors encoding domain-encoding genes and DNA fragments containing 35S enhancers;
[0006] The bZIP The domain-encoding gene is obtained by the tandem arrangement of the following elements: upstream homologous arm of the restriction enzyme site, first linker peptide sequence, bZIP Domain coding sequence and downstream homologous arm of restriction enzyme cleavage site;
[0007] The DNA fragment containing the 35S enhancer includes an upstream homologous arm of the 35S enhancer insertion site, the 35S enhancer sequence, a downstream homologous arm of the 35S enhancer insertion site, and... bZIP Domain-targeted sequences;
[0008] The 35S enhancer insertion site is OsMYB106 Startup sub-region.
[0009] Preferably, the bZIP Domains encoding genes bZIP The structural domain encoding sequence consists of 2 to 3 copies; adjacent two bZIPThe domain-encoding genes are linked by a second linker peptide sequence;
[0010] The second linker peptide is an 8-copy G4S linker peptide;
[0011] The first linker peptide is a 5-copy G4S linker peptide.
[0012] Preferably, in the DNA fragment containing the 35S enhancer, the bZIP The copy number of the domain-targeting sequence is 6 to 7 copies;
[0013] The 35S enhancer insertion site is OsMYB106 At 200 bp in the gene promoter region.
[0014] Preferably, the nucleotide sequence of the DNA fragment containing the 35S enhancer is shown in SEQ ID NO:8;
[0015] The containing bZIP In plant gene editing vectors that encode domain genes, the backbone vector is... pYLCRISPR / Cas9Pubi-H Carrier.
[0016] This invention provides a method for preparing the reagent, comprising:
[0017] The method for preparing the DNA fragment containing the 35S enhancer involves using a forward primer for the upstream homologous arm containing the 35S enhancer insertion site and a primer simultaneously containing... bZIP The 35S enhancer was amplified by reverse primers of the homologous arm of the domain-targeting sequence and the downstream homologous arm of the 35S enhancer insertion site, resulting in a 35S enhancer sequence with homologous arms.
[0018] Chemical synthesis of homologous arms containing 35S enhancer sequence bZIP Domain-targeted sequences;
[0019] The 35S enhancer subsequence with homologous arms and the 35S enhancer subsequence with homologous arms bZIP Domain-targeted sequence ligation yields a DNA fragment containing a 35S enhancer;
[0020] The containing bZIP Methods for preparing plant gene editing vectors that encode domain-encoding genes, providing a basis for utilizing... bZIP Forward primer and downstream homologous arm containing restriction enzyme site bZIP Reverse primer amplification bZIP The domain-coding sequence yields homologous arms with restriction enzyme cleavage sites. bZIP Structural domain encoding sequence;
[0021] Chemical synthesis with an enzyme cleavage site at one end and a 5' homologous arm at the other end bZIPThe domain encodes the first linker peptide sequence of the 5' homologous arm;
[0022] The homologous arm with the insertion site bZIP The domain-coding sequence, the first linker peptide sequence, and the linear backbone vector digested with the restriction enzyme corresponding to the restriction site are recombined to obtain a product containing... bZIP Plant gene editing vectors that encode genes by structural domains.
[0023] Preferably, when bZIP When the structure field encoding sequence is 2 copies, the two bZIP The domain coding sequences are linked by a second linker peptide sequence;
[0024] The second linker peptide sequence is prepared by chemical synthesis with one end containing... bZIP The structure domain encoding sequence has a homologous arm at the 5' end and a corresponding arm at the other end. bZIP The domain encodes the second linker peptide sequence of the 3' homologous arm;
[0025] The second linker peptide sequence is linked to a homologous arm containing an enzyme cleavage site. bZIP The domain-coding sequence, the first linker peptide sequence, and the linear backbone vector undergo a recombination reaction together.
[0026] This invention provides the application of the reagent or the reagent prepared by the preparation method described above in the preparation of transgenic rice varieties and / or rice genetic breeding.
[0027] The transgenic rice varieties and / or rice varieties obtained through rice genetic breeding possess at least one of the following characteristics: salt tolerance, disease resistance, and high yield.
[0028] Preferably, the disease resistance includes bacterial blight and / or rice blast;
[0029] The high yield includes at least one of the following: increasing the yield per unit area of rice, increasing the number of grains per panicle of rice, and increasing the length of the panicle of rice.
[0030] This invention provides a method for improving rice yield, salt tolerance, and disease resistance based on 35S enhancer knock-in technology, comprising the following steps:
[0031] The reagent was mixed with gold powder to form microspheres, which were then bombarded into rice callus tissue using a gene gun to obtain... OsMYB106 Gene overexpression transgenic rice.
[0032] Preferably, the disease resistance includes bacterial blight and / or rice blast;
[0033] The high yield includes at least one of the following: increasing the yield per unit area of rice, increasing the number of grains per panicle of rice, and increasing the length of the panicle of rice;
[0034] The DNA fragment containing the 35S enhancer, containing bZIP The mass ratio of the plant gene editing vector encoding the domain-encoding gene to gold powder was 10:(1~3):10:1000;
[0035] The bombardment conditions are 2 cm. 2 The bombardment area is 3~6 MPa, the bombardment pressure is 3~6 MPa, and the bombardment voltage is 9~15V.
[0036] This invention provides an up-regulation OsMYB106 Reagents for gene expression levels, including those containing bZIP Plant gene editing vectors encoding domain-encoding genes and DNA fragments containing 35S enhancers; bZIP The domain-encoding gene is obtained by the tandem arrangement of the following elements: upstream homologous arm of the restriction enzyme site, first linker peptide sequence, bZIP The domain coding sequence and the downstream homologous arm of the restriction enzyme site; the DNA fragment containing the 35S enhancer includes the upstream homologous arm of the 35S enhancer insertion site, the 35S enhancer sequence, the downstream homologous arm of the 35S enhancer insertion site, and bZIP The domain-targeted sequence; the 35S enhancer insertion site is OsMYB106 Promoter region. The reagent is used to upregulate rice using 35S enhancer knock-in technology. OsMYB106 This invention expresses and enhances the salt and alkali tolerance of rice, while simultaneously increasing rice yield and / or disease resistance. The present invention integrates CRISPR-Cas9 technology with molecular biology to obtain the reagent, which can be used to create a highly efficient breeding strategy for salt-tolerant, disease-resistant, and high-yielding rice. Compared with traditional breeding methods, this significantly reduces workload and breeding years, and precisely controls the selection sites, reducing the blind spots in traditional breeding and phenotypic judgment errors among breeders. The reagent obtained after treatment in the embodiments of the present invention... OsMYB106 Transgenic rice with upregulated gene expression utilizes NaCl and Na2CO3 (Na + The survival rate and yield traits of transgenic rice were observed by applying a rice nutrient solution (150 mM, pH = 10) to the rice plants under salt-alkali stress. The results showed that the insertion of the 35S enhancer could successfully create salt-tolerant, disease-resistant, and high-yielding rice varieties in saline-alkali land. In the rice plant creation examples, it also improved salt-alkali stress resistance and yield, as well as resistance to bacterial blight and rice blast. Attached Figure Description
[0037] Figure 1 for pYLCRISPR / Cas9-2×bZIP-Pubi-H Carrier spectrum;
[0038] Figure 2 for OsMYB106 Results of salt-alkali stress tolerance phenotype in overexpression lines;
[0039] Figure 3 for OsMYB106 Statistical results of the survival rate of overexpression lines under salt and alkali stress;
[0040] Figure 4 for OsMYB106 Phenotypic and yield statistics of overexpression lines in saline-alkali soil;
[0041] Figure 5 for OsMYB106 Phenotypic and statistical results of overexpression lines in soda-saline-alkali soil;
[0042] Figure 6 for OsMYB106 Phenotypic and statistical results of overexpression lines in saline-alkali soil;
[0043] Figure 7 for OsMYB106 Phenotypic and statistical results of grain number per ear in overexpression lines in saline-alkali soil;
[0044] Figure 8 for OsMYB106 Phenotypic and statistical results of overexpression lines resisting bacterial blight and rice blast in saline-alkali soil. Detailed Implementation
[0045] This invention provides an up-regulation OsMYB106 Reagents for gene expression levels, including those containing bZIP Plant gene editing vectors encoding domain-encoding genes and DNA fragments containing 35S enhancers;
[0046] The bZIP The domain-encoding gene is obtained by the tandem arrangement of the following elements: upstream homologous arm of the restriction enzyme site, first linker peptide sequence, bZIP Domain coding sequence and downstream homologous arm of restriction enzyme cleavage site;
[0047] The DNA fragment containing the 35S enhancer includes an upstream homologous arm of the 35S enhancer insertion site, the 35S enhancer sequence, a downstream homologous arm of the 35S enhancer insertion site, and... bZIP Domain-targeted sequences;
[0048] The 35S enhancer insertion site is OsMYB106 Startup sub-region.
[0049] In this invention, the reagent is designed to knock the 35S enhancer into the rice genome, thereby effectively enhancing downstream genes in rice. OsMYB106The reagent enhances the expression level of the gene, strengthens transcription, and thereby enhances the transcriptional activation of downstream genes, thus overcoming the limitations of transgene dependence and improving the stress and disease resistance of rice in saline-alkali soil, while also increasing rice yield. This reagent can be applied to rice salt tolerance, yield increase, and breeding.
[0050] In this invention, the containing bZIP Introduced into plant gene editing vectors containing domain-encoding genes bZIP The purpose of this structural domain coding sequence is to fuse the bZIP structural domain protein with the Cas9 protein for expression, thereby enabling the Cas9 protein to bind to the target DNA fragment. bZIP Domains encoding genes bZIP The preferred encoding sequence for a structural domain is 2 to 3 copies; adjacent two bZIP The domain-encoding gene is linked using the second linker peptide sequence; the second linker peptide is preferably an 8-copy G4S linker peptide. (Double copy) bZIP The tandem binding of domain-encoding genes facilitates the formation of bZIP domain dimers, enhancing the binding affinity to the target DNA fragment. The first linker peptide is preferably a 5-copy G4S linker peptide. bZIP The insertion site is in the backbone vector of the plant gene editing vector. Cas9 The 3' end of the gene MauB I serves as the restriction enzyme site to enable... bZIP The insertion of a domain that encodes a gene. bZIP upstream homologous arm of the insertion site or bZIP The length of the homologous arm downstream of the insertion site is preferably 10-15 bp. The scaffold carrier is preferably... pYLCRISPR / Cas9Pubi-H Carrier.
[0051] In this invention, the DNA fragment containing the 35S enhancer contains the... bZIP Domain-targeted sequences can be bZIP The domain dimer specifically recognizes and binds to achieve the purpose of carrying the target insertion fragment. bZIP The copy number of the domain-targeting sequence is preferably 6-7 copies, which is beneficial for binding and enrichment by the bZIP protein. The nucleotide sequence of the DNA fragment containing the 35S enhancer is preferably as shown in SEQ ID NO:8 (TGAGACTTTCAACAAAGGCTAATATCCGGAAACCTCCTCGGATTCCA).
[0052] The 35S enhancer insertion site is shown in the figure. OsMYB106 The gene promoter region at -200 bp (TAAGGCATGGAAAATTAGGG, SEQ ID NO:9).
[0053] This invention provides a method for preparing the reagent, comprising: a method for preparing the DNA fragment containing the 35S enhancer and a method for preparing the DNA fragment containing the 35S enhancer. bZIP Methods for preparing plant gene editing vectors that encode domain-encoding genes.
[0054] In this invention, the method for preparing the DNA fragment containing the 35S enhancer involves using a forward primer for the upstream homologous arm containing the 35S enhancer insertion site and a primer simultaneously containing... bZIP The 35S enhancer was amplified by reverse primers of the homologous arm of the domain-targeting sequence and the downstream homologous arm of the 35S enhancer insertion site, resulting in a 35S enhancer sequence with homologous arms.
[0055] Chemical synthesis of homologous arms containing 35S enhancer sequence bZIP Domain-targeted sequences;
[0056] The 35S enhancer subsequence with homologous arms and the 35S enhancer subsequence with homologous arms bZIP Domain-targeted sequence ligation yields a DNA fragment containing a 35S enhancer.
[0057] In this invention, the homologous arm containing the 35S enhancer sequence bZIP The nucleotide sequence of the domain-targeting sequence is shown in SEQ ID NO:10. The ligation primers include a forward primer with the nucleotide sequence shown in SEQ ID NO:6 and a reverse primer with the nucleotide sequence shown in SEQ ID NO:7.
[0058] In this invention, the containing bZIPMethods for preparing plant gene editing vectors that encode domain-encoding genes, providing a basis for utilizing... bZIP Forward primer and downstream homologous arm containing restriction enzyme site bZIP Reverse primer amplification bZIP The domain-encoded sequence yields a homologous arm with the insertion site. bZIP Structural domain encoding sequence;
[0059] Chemical synthesis with one end Cas9 The 5' homologous arm of the gene, and the other end carries bZIP The domain encodes the first linker peptide sequence of the 5' homologous arm;
[0060] The homologous arm with the insertion site bZIP The linear backbone vector, after being digested with restriction enzymes corresponding to the restriction sites of the domain coding sequence and the first linker peptide sequence, is subjected to a recombination reaction to obtain a product containing... bZIP Plant gene editing vectors that encode genes by structural domains.
[0061] In this invention, the bZIP The nucleotide sequence of the forward primer is shown in SEQ ID NO:1; the downstream homologous arm containing the restriction enzyme site... bZIP The nucleotide sequence of the reverse primer is shown in SEQ ID NO:2. The nucleotide sequence of the first linker peptide is shown in SEQ ID NO:4.
[0062] In this invention, when When the structure field encoding sequence is 2 copies, the two bZIP The domain-coding sequences are linked by a second linker peptide sequence. The second linker peptide sequence is prepared by chemical synthesis with one end containing… bZIP The structure domain encoding sequence has a homologous arm at the 5' end and a corresponding arm at the other end. bZIP The domain encodes a second linker peptide sequence with a homologous arm at the 3' end. The second linker peptide sequence is then linked to a homologous arm containing the insertion site. bZIP The domain-coding sequence, the first linker peptide sequence, and the linear backbone vector undergo a recombination reaction together.
[0063] This invention provides the application of the reagent or the reagent prepared by the preparation method in the preparation of transgenic rice varieties and / or rice genetic breeding, wherein the transgenic rice varieties and / or rice varieties obtained by rice genetic breeding possess at least one of the characteristics of salt tolerance, disease resistance and high yield.
[0064] In this invention, there are no special restrictions on the rice variety. Any rice variety well known in the art can be used to conduct the experiment, such as Kitaake or Nipponbare.
[0065] In this invention, the salt and alkali tolerance is preferably manifested in the fact that when planted under salt or alkali conditions, the survival rate of transgenic rice can be improved compared with the wild type, indicating that the transgenic rice has enhanced tolerance to salt and alkali stress.
[0066] In this invention, the disease resistance preferably includes bacterial blight and / or rice blast. In one embodiment of this invention, the transgenic rice obtained after treating rice with the reagent is grown under saline-alkali conditions. bZIP Gene expression is upregulated, which simultaneously enhances the resistance of transgenic rice to bacterial blight and / or rice blast, and reduces the area affected by leaf diseases.
[0067] In this invention, the preferred high-yield option includes at least one of the following: increasing rice yield per unit area, increasing the number of grains per panicle, and increasing panicle length. In one embodiment of this invention, the transgenic rice obtained after treating rice with the reagent is grown under saline-alkali conditions. OsMYB106 Gene expression was upregulated, and the yield per mu, panicle length, and number of grains per panicle of rice were detected. The results showed that transgenic rice not only significantly increased the yield per mu (by 30%), but also increased the plant height by about 30%, the number of grains per panicle by 90%, and the panicle length by 20%. It can be seen that the reagent can not only promote the growth of rice under saline-alkali conditions, but also greatly increase the yield of rice.
[0068] This invention provides a method for improving rice yield, salt tolerance, and disease resistance based on 35S enhancer knock-in technology, comprising the following steps:
[0069] The reagent was mixed with gold powder to form microspheres, which were then bombarded into rice callus tissue using a gene gun to obtain... OsMYB106 Gene overexpression transgenic rice.
[0070] In this invention, the disease resistance preferably includes bacterial blight and / or rice blast; the high yield preferably includes at least one of the following: increasing rice yield per unit area, increasing the number of grains per panicle, and increasing panicle length. The disease resistance and high yield are as described in the above technical solution and will not be repeated here.
[0071] In this invention, the DNA fragment containing the 35S enhancer, containing... OsMYB106 The mass ratio of the plant gene editing vector encoding the domain-encoding gene to gold powder is 10:(1~3):10:1000, or 5:1:500. The preferred bombardment condition is per 2 cm³. 2 The bombardment area is preferably 3~6 MPa, and the bombardment pressure can be 4~5 MPa; the bombardment voltage is preferably 9~15V, and can be 10~13V, or 12V.
[0072] In this invention, the method integrates gene gun method, CRISPR-Cas9 technology and molecular biology to create an efficient breeding strategy for salt-tolerant, disease-resistant and high-yielding rice. Compared with traditional breeding methods, it greatly reduces the workload and breeding years, and accurately controls the selection sites, reducing the blindness in traditional breeding and the phenotypic judgment errors among breeders.
[0073] The following detailed description, in conjunction with embodiments, illustrates a method for improving rice yield, salt tolerance, and disease resistance based on 35S enhancer knock-in technology, but these descriptions should not be construed as limiting the scope of protection of this invention.
[0074] Example 1
[0075] bZIP The construction of the vector, and the spectrum are shown in [link to spectrum description]. pYLCRISPR / Cas9-2×bZIP-Pubi-H .
[0076] use Figure 1 The carrier was modified as a chassis. The first step was design. pYLCRISPR / Cas9Pubi-H Gene C / EBPα Primers for cloning the domain were selected. bZIP In the carrier pYLCRISPR / Cas9Pubi-H 3' end of the gene Cas9 Using nucleotide I as the restriction site, a 10 bp nucleotide from the 3' end (downstream) of the restriction site was added to the 5' end of the reverse primer sequence, named C / EBP-bZIP-R. A 10 bp nucleotide from the 3' end of 5×GGGGS was added as a homologous arm to the 5' end of the forward primer, named C / EBP-bZIP-F. The specific nucleotide sequences are shown in SEQ ID NO: 1 (CGGCGGCAGCAACGAATATCGCGTGCG) and SEQ ID NO: 2 (CCGCCCGCCGCGCGCAGTTGCCCATCGCTT). Mouse skin tissue genomic DNA was used as a template for cloning. MauB After agarose gel electrophoresis, the bZIP domain of the gene was selected, and the correctly sized bands were recovered. Once the sequencing was successful, the bands were retained for later use.
[0077] Using a chemical synthesis method, 8×GGGGS (amino acid sequence as shown in SEQ ID NO: 11, specific nucleotide sequence as shown in SEQ ID NO: 3, GGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGC) was flanked by... C / EBPαThe 3' homologous arm (ATCGACGTGA, SEQ ID NO: 15) and 5' homologous arm (CGAGAGTAGC, SEQ ID NO: 16) of the domain sequence form a second linker peptide sequence as the linker sequence of the bZIP protein. The synthesized product is mixed with the gel-recovered product and used as a template. C / EBP-bZIP-F and C / EBP-bZIP-R are used as primers for recombinant PCR. The correct band size is selected by agarose gel electrophoresis and the gel is recovered. After correct sequencing, the band is retained for later use.
[0078] Chemical synthesis was used to synthesize 5×GGGGS (amino acid sequence SEQ ID NO: 12, specific nucleotide sequence as shown in SEQ ID NO: 4 (GGCGGCGGCGGCAGCG ...
[0079] Add to both ends of the DNA fragment CGGCGGCGGCAGCGGCGGCGGCAGC) bZIP The 3' homologous arm of the gene (TCAGCACGTA, SEQ ID NO: 17) and Cas9 Encoded sequence 5 ' The terminal homologous arm (CGAGAGTAGC, SEQ ID NO: 18) forms the first linker peptide sequence for ligation. bZIP Domain sequences and skeleton carriers.
[0080] use bZIP I endonuclease, enzyme digestion MauB After linearization, the vector was recovered and mixed with the first and second linker peptide sequences for seamless cloning and recombination (using recombinase MH201, purchased from Shanghai Yamei Biomedical Technology Co., Ltd.). After the recombination reaction, the product was transformed into DH5α competent cells. Single clones were picked and sequenced. Correctly selected single-clone cultures were expanded, and plasmids were extracted to obtain the desired product. pYLCRISPR / Cas9Pubi-H pYLCRISPR / .
[0081] Example 2
[0082] Gene gun method knock-in upregulates 35S enhancer Cas9-2×bZIP-Pubi-H The establishment of a technical system to improve rice yield and disease resistance in saline-alkali land.
[0083] 1. Preparation of insert DNA P OsMYB106 .
[0084] Insert DNA was synthesized using chemical synthesis methods. P OsMYB106-35SE-6×target Insertion DNA POsMYB106-35SE-6×target The composition involves selecting a 200 bp position in the promoter region of the OsMYB106 gene as the enhancer insertion site, and selecting 10 bp before and after the insertion site as homologous arms (before the insertion site: GAGGCTAAC, SEQ ID NO: 19; after the insertion site: GGGCATCAAT, SEQ ID NO: 20). These are added to the 5' end of the forward primer (ATTGCGCAATATTGCGC, SEQ ID NO: 13) and the 5' end of the reverse primer (GTGGTGGCATGAAAAA, SEQ ID NO: 14) of the 35S enhancer, respectively. A 6× 10⁻⁶ m² primer is added to the 5' end of the reverse primer. OsMYB106-35SE-6×target Homologous arm of (SEQ ID NO: 5) sequence (ATTGCGCAAT) , (SEQ ID NO: 21). Using the synthesized DNA as a template, after PCR amplification, fragments of the correct size were selected by agarose gel electrophoresis, recovered, sequenced, and retained for later use.
[0085] Then, using chemical synthesis, 6× ATTGCGCAAT The nucleotide sequence was obtained, and a homologous arm of the 35S enhancer was added to its 5' end, forming a homologous arm of the 35S enhancer -6× ATTGCGCAAT The DNA sequence (GCATGAAAAAATTGCGCAATATTGCGCAATATTGCGCAATATTGCGCAATATTGCGCAATATTGCGCAATATTGCGCAATAT, SEQ ID NO:10) is retained for future use.
[0086] Primers were designed at the 5' end of the 35S enhancer in a 6× ATTGCGCAAT Primers were designed at the 3' end of the sequence and named target-F and target-R. The specific nucleotide sequences are shown in SEQ ID NO: 6 (ATTGCGCAATATTGCGCA) and SEQ ID NO: 7 (ATCCTTCGTGGTGGCATGAAAAA).
[0087] The two DNA segments were ligated together using overlap PCR, and the gel was recovered and kept for later use.
[0088] 2. Transformation of rice callus tissue using gene gun method
[0089] The above-synthesized insert DNA P ATTGCGCAAT Example 1 Preparation of OsMYB106 gene promoter editing target OsMYB106-35SE-6×target、 Gene gun microbullets were prepared by mixing the carrier and gold powder in a mass ratio of 10:1:1000 and stored at 4°C.
[0090] Select plump rice seeds, remove the husks, disinfect them in a clean bench, and then inoculate them into callus induction medium. Incubate at 32°C for 7 days.
[0091] Using a gene gun, micro-projectiles are bombarded (target area: 2 cm²). 2 (Pressure: 3 MPa, Voltage: 9V) is applied to the callus tissue. After bombardment, the tissue is sealed and stored away from light.
[0092] Positive callus tissue was transferred to differentiation medium to obtain transgenic rice seedlings. After identification, two homozygous seedlings were obtained. pYLCRISPR / Cas9-2×bZIP-Pubi-H Overexpressing rice plants, propagating them, and saving them for future use.
[0093] Example 3
[0094] In situ insertion of 35S enhancer overexpression OsMYB106 Creation of high-yield, salt-tolerant, and disease-resistant genetically modified varieties
[0095] 1. Gene gun preparation OsMYB106 Gene overexpression transgenic rice
[0096] After obtaining the T2 homozygous transgenic line using the method in Example 2, total protein was extracted from rice seedling leaves. Wild-type plants were used as a control to identify the OsMYB106 protein level in each individual of the transgenic line. Two plants with high and relatively consistent expression levels were selected and named... OsMYB106 and OsMYB106-OE1 (The following content is abbreviated as) OsMYB106-OE2 and OE1 After extensive propagation, the seeds are kept for future use.
[0097] 2. Preparation OE2 Mutant rice
[0098] The OsMYB106 gene editing target was designed using the rice CRISPR target design website (http: / / crispr.hzau.edu.cn). After synthesizing the target sequence, a CRISPR vector was constructed and transferred into rice through Agrobacterium infection of callus tissue. Transgenic positive seedlings were selected for PCR editing pattern identification. Individuals with premature termination frameshift mutations were selected and retained, and then self-pollinated to obtain two stable homozygous mutant lines. and OsMYB106 (The following content is abbreviated as) osmyb106-1 and osmyb106-2 (Keep this for future use).
[0099] 3. KO1 Detection of salt-alkali tolerance phenotype in transgenic rice with gene overexpression.
[0100] Wild-type Kitaake that has grown to the three-leaf-one-heart stage and homozygous...KO2 Gene overexpression transgenic plants ( OsMYB106 OsMYB106 OsMYB106-OE1 and OsMYB106-OE2 ) Move to a container containing NaCl and Na2CO3 (Na + After treatment in a nutrient solution containing 150 mM (pH = 10) for 5 days, the phenotype was observed. The cells were then transferred to a normal nutrient solution to recover for 3 days, and the survival rate was calculated.
[0101] The results showed that, compared with wild-type Kitaake, OE-1 and OE-2 The plant's tolerance to salt and alkali stress is enhanced. Figure 2 Its survival rate is significantly higher than that of wild-type Kitaake and osmyb106 mutant ( KO-1 and KO-2 () Figure 3 ).
[0102] 4. OsMYB106 Phenotypic detection of transgenic rice with overexpressed genes in soda-saline soil in Northeast China.
[0103] wild type, KO-1 , KO-2 , OE-1 and OE-2 Seeds (approximately 200 seeds per line) were evenly sown in seedling trays, and seedlings were raised in a nursery field. Once the seedlings reached transplanting age, they were transplanted to the soda-saline-alkali soil experimental field of the Da'an Experimental Station of the Northeast Institute of Geography, Chinese Academy of Sciences, Jilin Province. After maturity, phenotypes were observed, and yield traits were statistically analyzed.
[0104] The results showed that, compared with wild type and mutant, OE-1 and OE-2 The yield increased significantly, with the yield per unit area increasing by approximately 30% compared to the wild type. Figure 4 In addition to total output, OE-1 and OE-2 The plant height was also increased by about 30% compared to the wild type. Figure 5 ). OE-1 and OE-2 The length of the ear increased by about 20% ( Figure 6 The number of grains per ear increased by approximately 90%. Figure 7 ).In summary, OE-1 and OE-2 The increase in yield was mainly due to a significant increase in the number of grains per ear.
[0105] 5. OsMYB106 Phenotypic detection of gene overexpression transgenic rice against bacterial blight and rice blast in soda saline-alkali soil in Northeast China.
[0106] To combat bacterial blight, rice was cultured to the four-leaf stage. The third leaf of the rice was then taken, and the leaf was inoculated with activated bacterial blight pathogens. Xoo (Liang X, Yu X, Pan X, et al. A thiadiazole reduces the virulence of Xanthomonas oryzae pv. oryzae by inhibiting the histidine utilization pathway and quorum sensing. Mol Plant Pathol. 2018;19(1):116-128.) After being dipped into the suspension, it was placed in a petri dish and incubated under white light for 10 days.
[0107] The results showed that, compared to wild type and mutant, OsMYB106 The overexpressing plants had the smallest proportion of lesion area on their leaves, and the lesions were the lightest in color. Figure 8 (Middle and upper layer diagram).
[0108] To combat rice blast, cultivate rice to the 4-leaf stage, take the third leaf, cut about 2 cm from the middle section of the leaf, and make evenly spaced cuts on the underside of the leaf with a disposable blade. Use a syringe to extract the activated rice blast pathogen. Guy11 ( Pan Y, PanR, Tan L, Zhang Z, Guo M. Pleiotropic roles of O-mannosyltr-
[0109] ansferase MoPmt4 in development and pathogenicity of Magnaportheoryzae [published correction appears in Curr Genet. 2019 Feb;65(1):241. doi:10.1007 / s00294-018-0888-7.]. Curr Genet. 2019;65(1):223-239. ) The suspension was injected into the wound on the leaf by pressing and cultured under white light for 7 days.
[0110] The results showed that, compared to wild type and mutant, OsMYB106 The overexpressing plants had the smallest lesion area on their leaves, and the gray infected patches in the center of the lesions were the lightest in color. Figure 8 (Middle and lower layer diagram).
[0111] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. An upregulation OsMYB106 A reagent for gene expression levels, characterized in that, Including bZIP Plant gene editing vectors encoding domain-encoding genes and DNA fragments containing 35S enhancers; The bZIP The domain-encoding gene is obtained by the tandem arrangement of the following elements: upstream homologous arm of the restriction enzyme site, first linker peptide sequence, bZIP Domain coding sequence, downstream homologous arm of enzyme cleavage site; The DNA fragment containing the 35S enhancer includes an upstream homologous arm of the 35S enhancer insertion site, the 35S enhancer sequence, a downstream homologous arm of the 35S enhancer insertion site, and... bZIP Domain-targeted sequences; The 35S enhancer insertion site is OsMYB106 Start the sub-region; The bZIP The copy number of the structure field encoding sequence is 2 to 3 copies; adjacent two bZIP The domain-encoding gene is linked by a second linker peptide sequence; the second linker peptide is an 8-copy G4S linker peptide; In the DNA fragment containing the 35S enhancer, the bZIP The copy number of the domain-targeting sequence is 6-7 copies; bZIP The domain-targeting sequence is shown in SEQ ID NO:5; The containing bZIP In plant gene editing vectors that encode domain genes, the backbone vector is... pYLCRISPR / Cas9Pubi- H carrier; The bZIP The domain coding sequence was obtained using mouse skin tissue genomic DNA as a template, with nucleotide sequences as shown in primers SEQ ID NO:1 and SEQ ID NO:
2. C / EBPα The bZIP domain of the gene.
2. The reagent according to claim 1, characterized in that, The first linker peptide is a 5-copy G4S linker peptide.
3. The reagent according to claim 1, characterized in that, The 35S enhancer insertion site is OsMYB106 At 200 bp in the gene promoter region.
4. A method for preparing the reagent according to any one of claims 1 to 3, characterized in that, include: The method for preparing the DNA fragment containing the 35S enhancer involves using a forward primer for the upstream homologous arm containing the 35S enhancer insertion site and a primer simultaneously containing... bZIP The 35S enhancer was amplified by reverse primers of the homologous arm of the domain-targeting sequence and the downstream homologous arm of the 35S enhancer insertion site, resulting in a 35S enhancer sequence with homologous arms. Chemical synthesis of homologous arms containing 35S enhancer sequence bZIP Domain-targeted sequences; The 35S enhancer subsequence with homologous arms and the 35S enhancer subsequence with homologous arms bZIP Domain-targeted sequence ligation yields a DNA fragment containing a 35S enhancer; The containing bZIP Methods for preparing plant gene editing vectors that encode domain-encoding genes, providing a basis for utilizing... bZIP Forward primer and downstream homologous arm containing restriction enzyme site bZIP Reverse primer amplification bZIP The domain-coding sequence yields homologous arms with restriction enzyme cleavage sites. bZIP Structural domain encoding sequence; Chemical synthesis with an enzyme cleavage site at one end and a 5' homologous arm at the other end bZIP The domain encodes the first linker peptide sequence of the 5' homologous arm; The homologous arm with the insertion site bZIP The domain-coding sequence, the first linker peptide sequence, and the linear backbone vector digested with an enzyme corresponding to the restriction enzyme cleavage site are subjected to a recombination reaction to obtain a product containing... bZIP Plant gene editing vectors that encode genes by structural domains.
5. The preparation method according to claim 4, characterized in that, when bZIP When the structure field encoding sequence is 2 copies, the two bZIP The domain coding sequences are linked by a second linker peptide sequence; The second linker peptide sequence is prepared by chemical synthesis with one end containing... bZIP The structural domain encoding sequence has a homologous arm at the 5' end and a corresponding arm at the other end. bZIP The domain encodes the second linker peptide sequence of the 3' homologous arm; The second linker peptide sequence is linked to a homologous arm containing an enzyme cleavage site. bZIP The domain-coding sequence, the first linker peptide sequence, and the linear backbone vector undergo a recombination reaction together.
6. The application of the reagent according to any one of claims 1 to 3 or the reagent prepared by the preparation method according to claim 4 or 5 in the preparation of transgenic rice varieties and / or rice genetic breeding, wherein the reagent upregulates rice OsMYB106 Gene expression levels; The transgenic rice variety and / or the rice variety obtained through rice genetic breeding possess at least one of the following characteristics: salt tolerance, disease resistance, and high yield; the disease resistance refers to bacterial blight and / or rice blast.
7. The application according to claim 6, characterized in that, The high yield includes at least one of the following: increasing the yield per unit area of rice, increasing the number of grains per panicle of rice, and increasing the length of the panicle of rice.
8. A method for improving rice yield, salt tolerance, and disease resistance based on 35S enhancer knock-in technology, characterized in that, Includes the following steps: The reagent described in any one of claims 1 to 3 is mixed with gold powder to prepare microspheres. These microspheres are then bombarded into rice callus tissue using a gene gun to obtain... OsMYB106 Gene overexpression transgenic rice; the disease resistance is bacterial blight and / or rice blast.
9. The method according to claim 8, characterized in that, The improvement of rice yield includes at least one of the following: increasing rice yield per unit area, increasing the number of grains per panicle, and increasing the panicle length; The DNA fragment containing the 35S enhancer, containing bZIP The mass ratio of the plant gene editing vector encoding the domain-encoding gene to gold powder was 10:(1~3):1000; The bombardment conditions are 2 cm. 2 The bombardment area is 3~6 MPa, the bombardment pressure is 3~6 MPa, and the bombardment voltage is 9~15V.
Citation Information
Patent Citations
Cloning and application of rice salt-stress-resistant gene OsMYB106
CN111778261A