Application of capsicum CaMADS-RIN gene in cultivation of capsicum material with high capsorubin content and light-color capsicum material

Abstract

The invention discloses an application of a CaMADS-RIN gene of capsicum in cultivation of a capsicum material with high capsorubin content and a light-color capsicum material. The nucleotide sequence of the CaMADS-RIN gene is as shown in SEQ ID NO: 1. According to the invention, the influence of the CaMADS-RIN gene on the content of capsorubin is identified in hot pepper for the first time, and the CaMADS-RIN can regulate and control the accumulation of the content of capsorubin. According to the invention, the CaMADS-RIN gene is over-expressed in a capsicum plant, so that the capsicum peel color of the obtained plant is obviously deepened, and the capsicum content is obviously increased; the CaMADS-RIN gene is silenced / knocked out in a pepper plant, so that a light-color pepper material of which the pepper peel color of the silent plant is obviously lightened and the capsorubin content is obviously reduced is obtained.

Description

Technical Field

[0001] The invention belongs to the field of pepper variety breeding, and in particular relates to an application of a pepper CaMADS-RIN gene in breeding pepper materials with high capsanthin content and light-colored pepper materials. Background Art

[0002] The color of mature pepper fruit was initially red in the wild. Later, through artificial domestication and natural selection, it has evolved to include orange, yellow, purple, and brown (Paran et al., 2007). The rich variety and content of carotenoids in pepper fruit determine its color. Capsanthin, a highly effective natural red pigment, plays an important role in industrial applications such as food, medicine, and daily necessities.

[0003] Therefore, it is particularly important to increase the content of capsanthin in pepper fruits and cultivate pepper varieties with high capsanthin content. At the same time, with the continuous improvement of people's living standards, ornamental and edible peppers of different colors are also important plants for home gardening and even celebration decorations. Cultivating a rich variety of pepper varieties with different fruit colors is also of great significance. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the above background technology and provide an application of the pepper CaMADS-RIN gene in cultivating pepper materials with high capsanthin content and light-colored pepper materials.

[0005] In order to solve the above technical problems, the technical solution proposed by the present invention is:

[0006] The invention discloses an application of a pepper CaMADS-RIN gene in cultivating pepper materials with high capsanthin content. The nucleotide sequence of the CaMADS-RIN gene is shown in SEQ ID NO: 1.

[0007] The above application preferably involves cultivating pepper materials with high capsanthin content by overexpressing the CaMADS-RIN gene.

[0008] In the above application, preferably, the method for cultivating a pepper material with a high capsanthin content is:

[0009] The CaMADS-RIN gene was cloned into an overexpression vector, and the recombinant vector was transformed into sterile explants of red peppers through Agrobacterium-mediated genetic transformation technology. Using tissue culture technology, transgenic pepper plants with enhanced capsanthin were obtained through screening, differentiation, rooting and domestication. New materials with high capsanthin content were then obtained through breeding.

[0010] In the above application, preferably, the capsanthin content in the peel of pepper fruits overexpressing the CaMADS-RIN gene is higher than that in pepper fruits with normal expression.

[0011] In the above application, preferably, the primer sequences used to cultivate pepper materials with high capsanthin content include:

[0012] MADS-OE-F:5'-atctctctcgagctttcgcgagctcATGGGTAGAGGGAAAGTAGAATTGAAGAG-3';

[0013] MADS-OE-R:5'-tagaggatccccgggtaccgagctcTCAAAGCATCCATCCAGGTACAACTC-3'.

[0014] As a general inventive concept, the present invention also provides an application of a pepper CaMADS-RIN gene in cultivating light-colored pepper materials. The nucleotide sequence of the CaMADS-RIN gene is shown in SEQ ID NO: 1.

[0015] The above application is preferably to cultivate light-colored pepper materials by silencing / knocking out the CaMADS-RIN gene in pepper.

[0016] In the above application, preferably, the method for cultivating light-colored pepper material is:

[0017] A CaMADS-RIN gene silencing vector or a CRISPR / Cas9-based CaMADS-RIN gene knockout vector is constructed, and the silencing / knockout vector is transformed into red peppers through Agrobacterium-mediated genetic transformation technology. Pepper plants with silenced / knockout CaMADS-RIN genes are obtained through screening, differentiation, rooting and domestication using tissue culture technology, and then light-colored pepper materials are obtained through breeding.

[0018] In the above application, preferably, the primer sequences used to cultivate light-colored pepper materials include:

[0019] pTRV2-CaMADS-RIN-F: 5'-cggtgaggagaagagcccAAGGTCAACTAAGACACAACACAT G-3';

[0020] pTRV2-CaMADS-RIN-R:5'-gctcgacgacaagacccACAACTCCAAGAGCATCTTGTG-3';

[0021] Alternatively, the target sequences for knocking out light-colored pepper materials include:

[0022] Knockout target 1: 5′-ATCATGGCACTCTGGGCCTG GGG-3′;

[0023] Knockout target 2: 5'-CGGATACGATAATGTGCCAC CGG-3'.

[0024] In the above application, preferably, the capsanthin content in the peel of pepper fruits in which the CaMADS-RIN gene is silenced / knocked out is lower than that in fruits with normal expression, and the color is lighter.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] This study, for the first time, identified the effect of the CaMADS-RIN gene on capsanthin content in peppers. CaMADS-RIN can regulate the accumulation of capsanthin. By overexpressing the CaMADS-RIN gene in pepper plants, the present invention produces peppers with significantly darker peel color and increased capsanthin content, resulting in high-capsanthin pepper materials. By silencing / knocking out the CaMADS-RIN gene in pepper plants, the resulting silenced peppers have significantly lighter peel color and significantly reduced capsanthin content, resulting in light-colored pepper materials.

[0027] The invention has great significance for the synthesis and accumulation of capsanthin and the improvement of fruit quality to cultivate new pepper materials with high color value. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 is a cloned electrophoresis diagram of the CaMADS-RIN gene in an embodiment of the present invention;

[0029] Figure 2 is the cDNA sequence of the CaMADS-RIN gene and the amino acid sequence encoded therein in the embodiment of the present invention;

[0030] Figure 3 is a multiple sequence alignment of the CaMADS-RIN protein in the embodiment of the present invention and other plant homologous MADS proteins;

[0031] Figure 4 This is the conserved domain analysis of the CaMADS-RIN protein in the examples of the present invention;

[0032] Figure 5 is the secondary structure prediction of the CaMADS-RIN protein in the embodiment of the present invention;

[0033] Figure 6 is the tertiary structure prediction of the CaMADS-RIN protein in the embodiment of the present invention;

[0034] Figure 7 is a phylogenetic analysis of the CaMADS-RIN protein in the examples of the present invention;

[0035] Figure 8 is the spatiotemporal expression pattern analysis of the CaMADS-RIN gene in the embodiment of the present invention;

[0036] Figure 9 This is the VIGS functional verification analysis of CaMADS-RIN in the embodiment of the present invention. DETAILED DESCRIPTION

[0037] To facilitate understanding of the present invention, the present invention will be described in more comprehensive and detailed form below in conjunction with the accompanying drawings and preferred embodiments. However, the protection scope of the present invention is not limited to the following specific embodiments.

[0038] Unless otherwise defined, all technical terms used hereinafter have the same meanings as those generally understood by those skilled in the art. The technical terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present invention.

[0039] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0040] Example 1:

[0041] This study, based on transcriptome analysis of the peels of mature red peppers of varying color-changing types at different developmental stages, identified a gene, CaMADS-RIN, that is highly correlated with capsanthin synthesis. Bioinformatics analysis of this gene was then conducted, along with virus-induced gene silencing (VIGS), to investigate its role in capsanthin accumulation in the pepper peel.

[0042] The present invention uses pepper inbred line 8214 as the experimental material, extracts total RNA from different tissue parts of the plant material [roots, stems, leaves, flowers, seeds, placenta, and pericarp at different stages from 10 to 50 days post anthesis (DPA)], and detects the relative expression level of CaMADS-RIN using qRT-PCR after cDNA reversal.

[0043] 1. Test method

[0044] 1.1 CaMADS-RIN gene cloning

[0045] Specific primers were designed using the CaMADS-RIN sequence of the Ca_59 genome (GCA_021292125.1) as a reference. Gene amplification was performed using the cDNA of inbred line 8214 as a template using Takara's Prime STAR Max high-fidelity enzyme. The primers for gene cloning are (5′→3′):

[0046] F: ATGGGTAGAGGGAAAGTAGAATTG (as shown in SEQ ID NO: 3);

[0047] R: TCAAAGCATCCATCCAGGTACAACTC (as shown in SEQ ID NO: 4).

[0048] The PCR reaction procedure was as follows: initial denaturation at 98°C for 30 seconds; 35 cycles of denaturation at 98°C for 10 seconds, annealing at 55°C for 10 seconds, and extension at 72°C for 15 seconds; and a final extension at 72°C for 5 minutes. After amplification, 5 μL of the product was subjected to agarose gel electrophoresis to confirm the target product.

[0049] 1.2 Bioinformatics Analysis of CaMADS-RIN

[0050] Homologous amino acid sequences of CaMA DS-RIN proteins from other species were selected through BLAST alignment using the NCBI website (https: / / www.ncbi.nlm.nih.gov / ). A phylogenetic tree was constructed using the neighbor-joining method in MEGA 5.2 software, and multiple comparisons were performed using DNAMAN 6.0 software. Amino acid sequence analysis was performed using BioXM 2.6 software, and the constructed phylogenetic tree was evaluated using the bootstrap method (1000 replicates). Physicochemical properties were analyzed using the ExPASy online tool, the Prot Param tool (https: / / web.expasy.org / protparam / ). Protein secondary structure was predicted using the SOPMA method (https: / / npsa-prabi.ibcp.fr / cgi-bin / npsa_automat.pl?page=npsa_sopma.html) provided by ExPASy. The tertiary structure of CaMADS-RIN protein was predicted using SWISS-MODEL (http: / / swissmodel.expasy.org / ). The subcellular localization of CaMADS-RIN protein was predicted using the WoLF PSORT online tool (https: / / wolfpsort.hgc.jp / ).

[0051] 1.3 Gene Expression Analysis

[0052] use Total RNA was isolated from the samples using the Super Total RNA Extraction Kit (Promega, Beijing, China). RNA was reverse transcribed using HiScript IIQ RT SuperMix for qPCR (+gDNA wiper) (Novozymes, Nanjing, China). ChamQ Universal SYBR qPCR Master Mix (Novozymes, Nanjing, China) was used in Li qRT-PCR analysis was performed on a 96Instrument detection system (Roche, Basel, Switzerland). The pepper actin gene (NCBI Reference Sequence: XM_016683691.2) was used as an internal reference. Each value represents the mean of three biological replicates.

[0053] Quantitative PCR primers (5′→3′) were designed online using the NCBI Primer designing tool (nih.gov):

[0054] CaMADS-RIN-qF: AAGTTGGAAGAACTTGGTGTTGCC (as shown in SEQ ID NO: 5);

[0055] CaMADS-RIN-qR: CTGCATATTCCGGTGGCACATTATC (as shown in SEQ ID NO: 6);

[0056] CaActin-F: CCACCTCTTCACTCTCTGCTCT (as shown in SEQ ID NO: 7);

[0057] CaActin-R: ACTAGGAAAAACAGCCCTTGGT (shown in SEQ ID NO: 8).

[0058] The qPCR reaction system is shown in Table 1 below:

[0059] Table 1 qPCR reaction system

[0060]

[0061] The amplification program was as follows: pre-denaturation at 95°C for 30 s, denaturation at 95°C for 10 s, and extension at 60°C for 30 s, for a total of 40 cycles.

[0062] 1.4 Functional Verification Based on VIGS

[0063] (1) Vector construction

[0064] VIGS vector pTRV1: from GenBank: AF406990.1; pTRV2 vector: from Zhou Y, Deng Y, Liu D, et al. Promoting virus-induced gene silencing of pepper genes by aheterologous viral silencing suppressor[J]. Plant Biotechnology Journal, 2021, 19(12): 2398. MLA. The efficient silencing target of CaMADS-RIN was analyzed using an online tool (vigs.solgenomics.net), and recombinant primers were designed. This fragment was recombined into the pTRV2-C2b vector to generate the silencing vector pTRV2-MADS.

[0065] The sequences of the pTRV2-CaMADS-RIN recombination primers are as follows (shown in SEQ ID NOs: 9 to 10, respectively):

[0066] pTRV2-CaMADS-RIN-F: 5'-cggtgaggagaagagcccAAGGTCAACTAAGACACAACACATG-3';

[0067] pTRV2-CaMADS-RIN-R: 5′-gctcgacgacaagacccACAACTCCAAGAGCATCTTGTG-3′ (lower case letters represent the homology arms of the pTRV2 vector).

[0068] The PCR reaction was carried out using the cDNA of the inbred line 8214 as a template. The system is shown in Table 2 below:

[0069] Table 2 PCR reaction system

[0070]

[0071] The PCR reaction procedure was as follows: initial denaturation at 98°C for 30 seconds; 35 cycles of denaturation at 98°C for 10 seconds, annealing at 55°C for 10 seconds, and extension at 72°C for 15 seconds; and a final extension at 72°C for 5 minutes. After amplification, 5 μL of the product was subjected to agarose gel electrophoresis to confirm the target product.

[0072] The amplified product was purified using the FastPure Gel DNA Extraction Mini Kit (Novagen, Nanjing, China) and inserted into the linearized pTRV2 vector. The purified target fragment and the linearized vector were ligated using the homologous recombination enzyme ClonExpress II One-Step Cloning Kit (Novagen, Nanjing, China). The recombinant plasmid was transformed into competent Escherichia coli DH5α cells and plated on LB medium containing kanamycin. After 15 hours, single colonies were identified by PCR. After verification, bacterial cultures containing the target band were sequenced and, after verification of the vector, plasmid extraction was performed to obtain the silencing vector (pTRV2-CaMADS-RIN) containing the CaMADS-RIN silencing target.

[0073] (2) Transformation of Agrobacterium

[0074] Remove 100 μL of GV3101 Agrobacterium competent cells from a -80°C freezer and place on ice. When the competent cells are ice-water mixture, add 200 ng of the pTRV2-CaMADS-RIN plasmid extracted above. After mixing, place on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and in an ice bath for 5 minutes. Then add 700 μL of LB liquid medium, culture with shaking at 28°C for 2 hours, centrifuge at 4000 rpm for 5 minutes, remove 700 μL of supernatant, and retain 100 μL of liquid to resuspend the cells. Spread the bacterial solution on YEB plates containing Km, Rif, and Gent antibiotics for culture. After single colonies are identified, Agrobacterium containing the silencing vector pTRV2-CaMADS-RIN is obtained.

[0075] (3) Infection

[0076] Use an artificial climate chamber to grow pepper seedlings and inoculate them when they are two weeks old. The specific steps are as follows:

[0077] The bacterial suspensions containing pTRV1, pTRV2, pTRV2-PDS (the leaves of the plant will turn white after silencing PDS, which serves as a positive control), and pTRV2-CaMADS-RIN plasmids were respectively cultured in YEB medium containing three antibiotics: kanamycin (Km), rifampicin (Rif), and gentamicin (Gent) (the final concentration of Km was 50 μg mL -1 , Rif 50μg·mL -1 , Gent 50μg·mL -1 ), cultured at 28°C with shaking at 200 rpm until OD600 = 1.0;

[0078] The culture product was placed in a centrifuge tube and centrifuged at 5000 g for 8 min. The supernatant was discarded and the suspension was suspended in 10 mM MES solution (MES 1.066 g, MgCl2·6H2O 1.0165 g, ultrapure water to 500 mL, pH adjusted to 5.6) containing 200 μl of AS to adjust the OD600 to 0.2.

[0079] The same method was used to prepare pTRV1, pTRV2, and pTRV2-PDS bacterial solutions;

[0080] The pTRV1 strain was mixed with other strains (pTRV2, pTRV2-PDS, and pTRV2-CaMADS-RIN) at a ratio of 1:1 and allowed to stand in the dark at 28°C for 4 h before inoculation;

[0081] The wild-type pepper strain was infected. Pepper cotyledons (dehydrated 2 days before inoculation) were inoculated by needle-free infiltration. After inoculation, the cotyledons were cultured in an artificial climate chamber at 18°C ​​in the dark for 3 days, then adjusted to a day / night temperature of 22°C / 18°C and a light intensity of 375 μmol·(m -2 ·s -1 )(16h / 8h), and cultured under the conditions of relative humidity of 60%.

[0082] (4) Phenotypic observation

[0083] After 5 weeks of silence, the positive control PDS began to show phenotypes, and the experimental group observed the color change of the fruit.

[0084] (5) Analysis of CaMADS-RIN-RIN expression levels in silenced plants

[0085] Total RNA was extracted from the peels of the silenced plants TRV2-CaMADS-RIN and the control plants TRV2 7 days after color change and reverse transcribed into cDNA, which was then subjected to qRT-PCR analysis. The qRT-PCR reaction system was the same as in Table 1.

[0086] (6) Determination of capsanthin content

[0087] The capsanthin content in pepper peel was determined using an UltiMate 3000 ultra-high performance liquid chromatograph (Thermo Fisher Scientific, Waltham, USA).

[0088] 2. Results Analysis

[0089] 2.1 Bioinformatics analysis of the CaMADS-RIN gene

[0090] The CaMADS-RIN gene was cloned by PCR amplification using the cDNA of pepper inbred line 8214 as a template. Figure 1The sequencing results showed that the full-length coding sequence of the gene was 732 bp (nucleotide sequence as shown in SEQ ID NO: 1), and the deduced protein sequence had 243 amino acids (amino acid sequence as shown in SEQ ID NO: 2) ( Figure 2 ), and its relative molecular weight was estimated to be 27.95 kDa.

[0091] To understand the similarity of CaMADS-RIN protein sequences with other species, DNAMAN 6.0 software was used to perform multiple alignment analysis of CaMADS-RIN homologous proteins in Physalis pubescens, Solanum lycopersicum, Solanum umpennellii, Solanum dulcamara, Nicotiana sylvestris, Coffea arabica, Vitis riparia, Handroanthus simpetiginosus, Heracleum sosnowskyi, Erigeron canadensis, and Arabidopsis thaliana. Figure 3 As shown, the sequence identity is 73.13%, indicating that the protein is highly conserved in different species.

[0092] The hydrophilicity / hydrophobicity analysis of CaMADS-RIN protein was performed using the ExPASy online analysis tool ProtParam tool. The grand average of hydropathicity (GRAVY) was -0.811, indicating that CaMADS-RIN has extremely strong hydrophilicity. The subcellular localization results predicted by WoLF PSORT showed that CaMADS-RIN is located in the cell nucleus. The results of the conserved domain analysis, such as Figure 4 As shown, the results showed that CaMADS-RIN protein belongs to the MADS gene family.

[0093] The secondary structure of CaMADS-RIN protein was predicted using the online analysis software SOPMA. Figure 5 The results show that the α-helix accounts for 51.44%, the extension accounts for 9.88%, the β-turn accounts for 3.29%, and the random coil accounts for 35.39%. The prediction results of the protein tertiary structure using the online software SWISS-MODEL are shown in Figure 6As shown, the CaMADS-RIN protein's polypeptide chain further coils or folds on top of various secondary structures to form a regular three-dimensional structure. The protein structure was constructed using a structure with PDB number A0A7T7D204.1.A as a template. The sequence identity is 70.94% and the GMQE value (Global Model Quality Estimate) is 0.77.

[0094] To understand the relationship of this protein in the evolutionary process, a phylogenetic tree was constructed between CaMADS-RIN and CaMADS-RIN homologous protein sequences in Physalis pubescens, Solanum lycopersicum, Solanum pennellii, Solanum dulcamara, Nicotiana sylvestris, Coffea arabica, Vitis riparia, Handroanthus impetiginosus, Heracleum sosnowskyi, Erigeron canadensis and Arabidopsis thaliana. Figure 7 As shown, the results indicate that CaMADS-RIN is most closely related to the MADS protein in short acid pulp.

[0095] 2.2 Analysis of spatiotemporal expression of CaMADS-RIN genes

[0096] The expression patterns of CaMADS-RIN genes in different tissues and at different developmental stages of the fruit peel of pepper inbred line 8214 were analyzed by qRT-PCR. Figure 8 The results showed that the CaMADS-RIN gene was barely expressed or expressed at low levels in tissues other than the pericarp, and was also barely expressed or expressed at low levels during the early stages of pericarp development (before color change). After the fruit began to change color (43 days post-production), the expression level of the CaMADS-RIN gene increased significantly, and capsanthin began to accumulate, showing a strong correlation with capsanthin synthesis.

[0097] 2.3 CaMADS-RIN functional verification

[0098] To verify the function of this gene, the present invention further utilized VIGS technology. Silencing was performed using inbred line 8214. Fruits from pTRV2-CaMADS-RIN-silenced plants and pTRV2-negative control plants were observed at color break. Seven days after color change, samples were collected to measure gene expression and capsanthin content.

[0099] After the CaMADS-RIN gene was silenced, the color of the pepper peel was observed to become significantly lighter. Figure 9 As shown in A. The detection of pTRV1, pTRV2 and coat proteins in the pepper peel of the experimental and control groups indicated that the color change was related to the silencing of CaMADS-RIN. Figure 9 As shown in Figure B. qRT-PCR analysis was further used to detect the transcription levels of CaMADS-RIN and several key genes related to capsanthin biosynthesis. The results showed that the transcription level of CaMADS-RIN in the silenced plants decreased to 52-62% of the control group's peel. The key genes for capsanthin biosynthesis, PSY, CHYB1, CCC, and their upstream regulatory gene DIVARICATA1, were also significantly downregulated to varying degrees, showing a similar trend. Figure 9 As shown in Figure C, the capsanthin content in the fruit peel of the silenced strain was found to be reduced to 36-46% of the control. This result indicates that CaMADS-RIN can regulate the synthesis of capsanthin.

[0100] The above results indicate that the CaMADS-RIN gene can regulate the biosynthesis of capsanthin by affecting the expression of key genes for capsanthin synthesis. Light-colored peppers can be cultivated by silencing the CaMADS-RIN gene in peppers, or pepper materials with high capsanthin content can be cultivated by overexpressing the gene.

[0101] Example 2:

[0102] The CaMADS-RIN gene was knocked out at the genomic level. The target sequences for knockout included (respectively shown in SEQ ID NOs: 11 to 12):

[0103] Knockout target 1: 5′-ATCATGGCACTCTGGGCCTG GGG-3′;

[0104] Knockout target 2: 5'-CGGATACGATAATGTGCCAC CGG-3'.

[0105] The pepper inbred line 8214 was used as the experimental material, and a knockout vector was constructed using the provided knockout target. The recombinant vector was transformed into the sterile explants of red pepper (cotyledons or hypocotyls) through Agrobacterium-mediated genetic transformation technology. The CaMADS-RIN knockout pepper plants were obtained through screening, differentiation, rooting and domestication using tissue culture technology, and then new light-colored pepper materials were obtained through breeding.

[0106] Example 3:

[0107] Overexpression primers were designed, and their sequences were as follows (shown in SEQ ID NOs: 13-14, respectively):

[0108] MADS-OE-F:5'-atctctctcgagctttcgcgagctcATGGGTAGAGGGAAAGTAGAATTGAAGAG-3';

[0109] MADS-OE-R:5'-tagaggatccccgggtaccgagctcTCAAAGCATCCATCCAGGTACAACTC-3'.

[0110] Taking Zunla No. 1 as the experimental material, the overexpression primer was used to clone CaMADS-RIN and constructed into the overexpression vector pCAMBIA1300. The recombinant vector was transformed into sterile explants of red pepper (cotyledons or hypocotyls) through Agrobacterium-mediated genetic transformation technology. The transgenic pepper plants with enhanced capsanthin were obtained through screening, differentiation, rooting and domestication using tissue culture technology, and then new pepper materials with high capsanthin content were obtained through breeding.

Claims

1. An application of the pepper CaMADS-RIN gene in cultivating pepper materials with high capsanthin content, characterized in that: The nucleotide sequence of the CaMADS-RIN gene is shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that Pepper materials with high capsanthin content are cultivated by overexpressing the CaMADS-RIN gene.

3. The use according to claim 2, characterized in that The method for cultivating a pepper material with high capsanthin content is: The CaMADS-RIN gene was cloned into an overexpression vector, and the recombinant vector was transformed into sterile explants of red peppers through Agrobacterium-mediated genetic transformation technology. Transgenic pepper plants with enhanced capsanthin were obtained through screening, differentiation, rooting and domestication using tissue culture technology. Pepper materials with high capsanthin content were then selected and bred.

4. The use according to claim 2, characterized in that The capsanthin content in the peel of pepper fruits overexpressing the CaMADS-RIN gene was higher than that in fruits with normal expression.

5. The use according to claim 2, characterized in that The primer sequences used to cultivate pepper materials with high capsanthin content include: MADS-OE-F:5'-atctctctcgagctttcgcgagctcATGGGTAGAGGGAAAGTAGAATTGAAGAG-3'; MADS-OE-R:5'-tagaggatccccgggtaccgagctcTCAAAGCATCCATCCAGGTACAACTC-3'.

6. An application of the pepper CaMADS-RIN gene in cultivating light-colored pepper materials, characterized in that: The nucleotide sequence of the CaMADS-RIN gene is shown in SEQ ID NO:

1.

7. The use according to claim 6, characterized in that Breeding light-colored pepper materials by silencing / knockout of the CaMADS-RIN gene in pepper.

8. The use according to claim 7, characterized in that The method for cultivating the light-colored pepper material is: A CaMADS-RIN gene silencing vector or a CRISPR / Cas9-based CaMADS-RIN gene knockout vector is constructed, and the silencing / knockout vector is transformed into red peppers through Agrobacterium-mediated genetic transformation technology. Pepper plants with silenced / knockout CaMADS-RIN genes are obtained through screening, differentiation, rooting and domestication using tissue culture technology, and then light-colored pepper materials are obtained through breeding.

9. The use according to claim 7, characterized in that The primer sequences used to cultivate light-colored pepper materials include: pTRV2-CaMADS-RIN-F: 5'-cggtgaggagaagagcccAAGGTCAACTAAGACACAACACAT G-3'; pTRV2-CaMADS-RIN-R:5'-gctcgacgacaagacccACAACTCCAAGAGCATCTTGTG-3'; Alternatively, the target sequences for knocking out light-colored pepper materials include: Knockout target 1: 5′-ATCATGGCACTCTGGGCCTG GGG-3′; Knockout target 2: 5'-CGGATACGATAATGTGCCAC CGG-3'.

10. The use according to claim 7, characterized in that The capsanthin content in the peel of pepper fruits with silenced / knocked CaMADS-RIN gene is lower and the color is lighter than that of fruits with normal expression.

Images