Application of herbicide-resistant rape gene GSTU8 or encoded protein thereof in crop breeding

By screening and introducing the herbicide-resistant gene GSTU8, the problem of rapeseed varieties' tolerance to glufosinate was solved, rapeseed's high-efficiency resistance to glufosinate was achieved, and the selection and breeding of varieties with independent intellectual property rights was promoted.

CN120758562APending Publication Date: 2025-10-10HUNAN AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511042395.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-28
Publication Date
2025-10-10

AI Technical Summary

Technical Problem

The existing technology lacks safe and efficient herbicide-resistant rapeseed varieties, especially genetically modified herbicide-resistant rapeseed varieties for which China does not have independent intellectual property rights, resulting in limited rapeseed yields and serious damage to rapeseed growth caused by chemical herbicides.

Method used

By screening the herbicide-resistance-related gene GSTU8, cloning it into the vector PC1300S, and introducing it into the rapeseed hypocotyls using the Agrobacterium-mediated method, we obtained herbicide-resistant transgenic rapeseed and enhanced the plant's tolerance to glufosinate.

Benefits of technology

The transgenic strains showed stronger resistance to oxidative stress, significantly reduced the oxidative stress damage caused by herbicides, had more stable cell membrane structures, enhanced tolerance to glufosinate ammonium, and reduced phytotoxicity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120758562A_ABST
    Figure CN120758562A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to application of a herbicide-resistant rape gene GSTU8 or a protein coded by the herbicide-resistant rape gene GSTU8 in crop breeding, the herbicide-resistant rape gene GSTU8 closely related to herbicide resistance of rape is obtained through screening, a gene sequence is fused and cloned into a carrier PC1300S, then the carrier PC1300S is transferred into the rape, and herbicide-resistant transgenic rape is obtained. The CAT, POD and SOD activities of the transgenic rape are obviously higher than those of conventional seedlings, and the MDA content of the transgenic rape is obviously lower than that of the conventional seedlings; it is indicated that the transgenic line has higher oxidative stress resistance, ROS can be efficiently removed, oxidative stress damage caused by herbicides can be remarkably relieved, the structural stability of cell membranes is kept, and therefore higher glufosinate-ammonium tolerance is shown; field experiments also show that the transgenic line has glufosinate-ammonium tolerance. The rape herbicide-resistant gene GSTU8 screened by the invention can promote the breeding of a new herbicide-resistant rape variety with proprietary intellectual property rights in China.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and particularly relates to a herbicide-resistant rapeseed gene. Background Art

[0002] Weed damage is a major factor affecting rapeseed production, particularly during the seedling stage. Due to the large number and variety of weeds in rapeseed fields, weeds compete for growth factors and space, resulting in a reduction in the number of established rapeseed seedlings. This also leads to weaker seedlings and limited plant growth, which in turn leads to insufficient nutrient accumulation during the reproductive period, reduced flowering and fruit set rates, a significant decrease in siliques and grains per silique, and a reduction in thousand-grain weight, severely impacting rapeseed yield. While chemical herbicides are simple and effective for weed control, the associated pesticide residues pose a serious threat to crop growth, particularly rapeseed. At present, safe and efficient herbicides have not yet been developed, which has become one of the important factors limiting rapeseed production. Therefore, the problem of rapeseed weed control needs to be solved urgently. At present, Chinese scholars have obtained herbicide-resistant rapeseed through non-GMO means and promoted its planting. At present, foreign research mainly focuses on using GMOs to cultivate herbicide-resistant rapeseed to reduce the damage caused by herbicides. However, key genes for large-scale application, such as the bar gene for glufosinate resistance and the CP4-EPSPS gene for glyphosate resistance, are mostly owned by foreign companies. The screening of new herbicide-resistant genes is a current research hotspot.

[0003] Brassinolide (BR) can improve plant adaptation to biotic and abiotic stresses, such as those caused by heavy metals, pesticides, herbicides, and organic pollutants, and can act as a safener to prevent herbicide damage. However, the ability of BR to enhance herbicide resistance in rapeseed is currently understudied. The development of herbicide-resistant crop varieties primarily involves non-transgenic breeding methods and transgenic technology. Transferring herbicide-resistant genes into desired crops can foster the development of new herbicide-resistant crop varieties. Research on herbicide-resistant genes is often combined with research on broad-spectrum, highly effective herbicides, primarily utilizing genes that alter herbicide targeting and herbicide detoxification.

[0004] Since my country currently does not allow the commercial cultivation of genetically modified rapeseed, there are few domestic genetically modified herbicide-resistant rapeseed varieties with independent intellectual property rights. Chinese scholars have used genetic engineering technology to obtain genetically modified rapeseed resistant to acetolactate synthase (ALS) herbicides. Patent CN201710166233.2 cloned genes from sulfonylureas (SU) herbicide resistance, selected and marked genetically modified rapeseed, and successfully obtained herbicide-resistant genetically modified rapeseed plants; Pu Huiming et al. used hybridization and backcrossing methods to introduce the bar gene into rapeseed using the glufosinate-resistant hybrid rapeseed combination HCN-19, and obtained a new glufosinate-resistant rapeseed variety (Pu Huiming, Gao Jianqin, Qi Cunkou, et al. Inheritance and Utilization of Glufosinate-Resistant Traits in Rapeseed [ J]. Jiangsu Agricultural Science, 2003, (02): 15-18.); Wu Lumei et al. transformed the glufosinate-resistant gene Syn1-RePAT into Brassica napus, and obtained a new glufosinate-resistant Brassica napus germplasm that can tolerate 6 times the recommended field application rate (Wu Lumei, Qin Ping, Yan Tong, et al. Creation and identification of new transgenic rapeseed germplasm resistant to glufosinate herbicide [J]. Journal of Plant Genetic Resources, 2022, 23(06): 1696-1708.); Patent 2013101117395 discloses a Brassica napus sulfonylurea herbicide resistance gene BnALS3R and its application. The expression of this gene in plants can improve the plant's resistance to sulfonylurea herbicides. Since the patents and promotion rights of the CP4-EPSPS gene (glyphosate resistance), bar gene (glufosinate resistance), pat gene (glufosinate resistance) and other genes used to create herbicide-resistant rapeseed in China, as well as the introduced herbicide-resistant varieties, are controlled by foreign companies, my country does not yet have herbicide-resistant Brassica napus varieties with independent intellectual property rights, which seriously hinders the cultivation and industrialization of domestic transgenic herbicide-resistant varieties. The screening of new herbicide-resistant rapeseed genes will greatly promote the selection of new herbicide-resistant rapeseed varieties with independent intellectual property rights in my country. Summary of the Invention

[0005] To solve the above problems, the present invention proposes the use of the herbicide-resistant rapeseed gene GSTU8 or the protein encoded by it in crop breeding.

[0006] The technical solution of the present invention is achieved as follows:

[0007] On the one hand, the present invention applies to protect the use of a herbicide-resistant rapeseed gene GSTU8 or a protein encoded by it in enhancing plant resistance to herbicides.

[0008] Preferably, the herbicide is glufosinate-ammonium and the plant is rapeseed.

[0009] In a second aspect, the present invention applies to protect the use of a herbicide-resistant rapeseed gene GSTU8 or a protein encoded by it in herbicide-resistant crop breeding.

[0010] The CAT, POD and SOD activities of herbicide-resistant transgenic rapeseed obtained through crop breeding were significantly higher than those of conventional seedlings, indicating that the transgenic strains have stronger antioxidant stress resistance. By efficiently removing ROS, the transgenic strains significantly reduced the oxidative stress damage caused by herbicides; the MDA content of the transgenic strains was significantly lower than that of conventional seedlings, and the cell membrane structure maintained higher stability under glufosinate stress; the herbicide-resistant transgenic strains can not only enhance the activity of antioxidant enzymes, but also reduce the damage to cell membranes caused by oxidative stress, thereby showing stronger herbicide tolerance.

[0011] Preferably, in the above application, the nucleotide sequence of the herbicide-resistant rapeseed gene GSTU8 is shown as SEQ ID No. 1.

[0012] Preferably, in the above application, the amino acid sequence of the encoded protein is shown as SEQ ID No. 2.

[0013] Preferably, the herbicide is glufosinate-ammonium and the crop is rapeseed.

[0014] In a third aspect, the present invention applies to protect an overexpression vector containing the herbicide-resistant rapeseed gene GSTU8.

[0015] Preferably, the nucleotide sequence of the above-mentioned herbicide-resistant rapeseed gene GSTU8 is shown as SEQ ID No.1.

[0016] The herbicide-resistant rapeseed gene GSTU8 was synthesized by primers and the gene sequence was fused and cloned into the vector PC1300S by PCR method.

[0017] In a fourth aspect, the present invention applies to protect a method for cultivating herbicide-resistant rapeseed, comprising the following steps: transferring the above-mentioned overexpression vector into Agrobacterium to obtain a transformation solution; infecting the hypocotyls of rapeseed with the transformation solution, and obtaining the herbicide-resistant rapeseed after differentiation and rooting.

[0018] The specific steps are:

[0019] (1) After cutting enough hypocotyl segments, aspirate the DM liquid and pour the prepared Agrobacterium transformation solution into the vessel containing the hypocotyls, allowing the hypocotyls to be fully immersed in the transformation solution. The timer is set for 5 minutes.

[0020] (2) After the time counting, pour off the transformation liquid, and transfer the hypocotyls to sterile filter paper and blow for about 5 minutes, and then transfer the hypocotyls to M1 medium (MS+30g / L sucrose+18g / L mannitol+1mg / L 2,4-D+0.3mg / L KT+20mg / L AS+8g / L agar) for dark culture for 2 days;

[0021] (3) After the co-culture, transfer the hypocotyls to M2 medium (MS+30g / L sucrose+18g / L mannitol+1mg / L 2,4-D+0.3mg / L KT+20mg / L AS+20mg / L silver nitrate+8g / L agar+200mg / L Tim+20mg / L HYG), and culture under 16h light / 8h dark, subculture every two weeks, and culture for 30 days;

[0022] (4) Transfer the hypocotyls to M3 medium (MS+10g / L glucose+0.25g / L xylose+0.6g / L MES+8g / L agar+2mg / L ZT+0.1mg / L IAA+100mg / L Tim+20mg / L HYG), and culture under 16h light / 8h dark, subculture every two weeks, until buds are differentiated;

[0023] (5) After the buds are differentiated to about 1cm, cut the buds and insert them into rooting medium (MS+30g / L sucrose+6g / L agar+100mg / L Tim), and culture under 16h light / 8h dark until roots are differentiated, and then transplant the seedlings.

[0024] Preferably, the OD 600 value of the above transformation liquid is 0.2-0.5, and the infection time is 5min.

[0025] Preferably, the above Agrobacterium is Agrobacterium tumefaciens strain C58C1.

[0026] The present application has the following beneficial effects:

[0027] The present invention screened GSTU8, a gene closely related to rapeseed herbicide resistance, using transcriptome technology. The GSTU8 gene sequence was fused and cloned into the vector PC1300S, and then introduced into rapeseed using Agrobacterium-mediated genetic transformation of rapeseed hypocotyls to obtain herbicide-resistant transgenic rapeseed. The CAT, POD, and SOD activities of the herbicide-resistant transgenic rapeseed were significantly higher than those of conventional seedlings. This indicates that the transgenic strains have stronger resistance to oxidative stress. By efficiently scavenging ROS, the transgenic strains significantly reduce the oxidative stress damage caused by herbicides. The MDA content of the transgenic strains is significantly lower than that of conventional seedlings, and the cell membrane structure maintains higher stability under glufosinate stress. The herbicide-resistant transgenic strains not only enhance the activity of antioxidant enzymes but also reduce the damage to cell membranes caused by oxidative stress, thereby demonstrating stronger glufosinate tolerance. Field experiments showed that herbicide spraying caused phytotoxicity, but no seedlings died, further confirming that the transgenic strains are glufosinate-tolerant and will promote the selection and breeding of new herbicide-resistant rapeseed varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0029] Figure 1 This is a sample correlation test.

[0030] Figure 2 Cluster diagram of differentially expressed genes.

[0031] Figure 3 This is a histogram of GO enrichment analysis, where CC is cellular component; MF is molecular function; and BP is biological process.

[0032] Figure 4 The photosynthesis metabolic pathways involved in the differentially expressed genes.

[0033] Figure 5 RT-qPCR analysis of genes.

[0034] Figure 6 This is the electrophoresis diagram of the second-round PCR products.

[0035] Figure 7 The electrophoresis diagram of positive bacteria.

[0036] Figure 8 This is a diagram of the cultivation process of GSTU8 rapeseed.

[0037] Figure 9 This is a graph showing the PCR test results.

[0038] Figure 10 Verification of transformed seedlings, with transformed seedlings on the left and controls on the right.

[0039] Figure 11 CAT activity of transgenic seedlings and conventional seedlings after glufosinate treatment.

[0040] Figure 12 POD activity of transgenic seedlings and conventional seedlings after glufosinate treatment.

[0041] Figure 13 SOD activity of transgenic seedlings and conventional seedlings after glufosinate treatment.

[0042] Figure 14 MDA content of transgenic seedlings and conventional seedlings after glufosinate treatment.

[0043] Figure 15 Field growth of rapeseed after the first glufosinate treatment.

[0044] Figure 16 Field growth of rapeseed after the second glufosinate treatment.

[0045] Figure 17 Field growth of rapeseed after the second glufosinate treatment, with transgenic rapeseed on the left and conventional rapeseed on the right. DETAILED DESCRIPTION

[0046] The technical solutions of the present application will be described clearly and completely below in conjunction with the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative effort belong to the scope of protection of the present application.

[0047] The experimental methods used in the following experimental examples are conventional methods unless otherwise specified; the materials, reagents, etc. used are reagents and materials available through commercial channels unless otherwise specified.

[0048] Example 1: Transcriptomic analysis and screening of key genes for herbicide resistance

[0049] Transcriptome sequencing can study differentially expressed genes at the RNA level and reveal the molecular regulation mechanism of a certain biological process. In this study, Brassica napus with herbicide resistance produced after BR treatment was used as a sample for transcriptome sequencing, and bioinformatics analysis was used to screen genes closely related to rapeseed herbicide resistance. Further identification of important candidate genes related to rapeseed herbicide resistance was made as the next research object.

[0050] 1. Materials and methods

[0051] (1) Plant material: Brassica napus ‘Fanming No. 1’

[0052] (2) Treatment method: Transcriptome sequencing samples were blank controls and rapeseed pretreated with 0.015% BR (brassinolide) on the seventh day after spraying with glufosinate ammonium; fluorescence quantitative PCR analysis (RT-qPCR) selected seeds soaked in water and soaked in 0.015% BR and then sprayed with 88.8% glyphosate ammonium (400-fold dilution) and 200g / L glufosinate ammonium (400-fold dilution) as verification materials. Tissue samples of the third-to-last young leaf were collected on the 7th, 10th, and 13th days after treatment, with 5 samples collected for each treatment. The samples were divided into two parts: one part was immediately frozen at -80°C, and the other part was used for RNA extraction. For samples evaluated using RT-qPCR, the first sampling time was October 28, 2021, and the last sampling time was November 3, 2021.

[0053] (3) Extraction of RNA from plant samples:

[0054] The third-to-last leaf of the rapeseed plants in the treatment and control groups was collected at the 5- to 6-leaf stage. One sample was frozen in liquid nitrogen (-80°C). RNA was extracted using the Trans Zol Up Plus RNA Kit (Beijing Quanshijin Biotechnology Co., Ltd., China). RNA quality was assessed using a Nanodrop 2000 (Thermo Fisher Scientific, USA) and a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA).

[0055] (4) Transcriptome sequencing

[0056] Transcriptome sequencing analysis was performed by Nanjing Paisonno Gene Technology Co., Ltd.

[0057] (5) Analysis of sequencing results

[0058] We focused on metabolic pathways related to herbicide resistance, such as photosynthesis, pyruvate metabolism, and aromatic amino acid synthesis, and screened key differentially expressed genes based on the functional annotations provided by NCBI.

[0059] (6) Fluorescence quantitative PCR analysis (RT-qPCR)

[0060] Three plants were selected for each treatment, and the third-to-last expanded leaf was harvested. A sample was frozen in liquid nitrogen at −80°C, and RNA was extracted using the Trans Zol Up Plus RNA Kit (Beijing Transgenic Biotechnology Co., Ltd.). RNA quality was assessed using a Nanodrop 2000 (Thermo Fisher Scientific) and an Agilent-2100 Bioanalyzer (Agilent Technologies). cDNA was synthesized using approximately 0.5 μg of RNA and PrimeScript RT Master Mix (Agilent Biotechnology Co., Ltd., China). RT-qPCR was performed on each sample using a Bio-Rad CFX96 Touch Detection System (Hercules, USA) and SYBR Green PCR Master Mix (Agilent Biotechnology Co., Ltd.). RT-qPCR primers were designed using the NCBI (Table 1) and eight genes associated with glufosinate resistance were analyzed. The RT-qPCR system and protocol of the SYBR Green PCR Master Mix Kit (Agilent Biotechnology Co., Ltd.) were used. After PCR amplification, relative gene expression changes were analyzed using the delta Ct method.

[0061] Table 1 Primer sequences

[0062]

[0063]

[0064] 2. Results Analysis

[0065] (1) Sequencing quality statistics

[0066] The penultimate leaf of the 'Fanming No. 1' plant treated with glufosinate and the control plant was collected on the 7th day after treatment, and RNA was extracted and the RNA quality was identified. The samples after each treatment had a high correlation ( Figure 1 ) The extracted RNA integrity value is high, OD 260 / 280 and OD 260 / 230 >2. The samples were sequenced, and the sequencing data were further filtered. Q20, Q30, clean reads, and clean data contents were all >90% (Table 2), indicating reliable sequencing results. The filtered reads were aligned to the reference genome using HISAT2 (http: / / ccb.jhu.edu / software / hisat2 / index.shtml) software; Total mapped values ​​were above 90% (Table 2), indicating that the reference genome was appropriately selected and free of contamination.

[0067] (2) Expression difference analysis

[0068] By comparing samples pairwise, log2|fold change|>1, p-value<0.05 were used as the criteria for judging differentially expressed genes. A total of 24,053 differentially expressed genes were identified, of which 12,112 differentially expressed genes were up-regulated and 11,941 differentially expressed genes were down-regulated. The R language Pheatmap package was used to perform a two-way cluster analysis on the clusters and samples with differentially expressed genes (DEGs) in each group to evaluate the differences in gene expression, such as Figure 2 shown.

[0069] (3) Functional enrichment analysis of DEGs

[0070] GO enrichment analysis:

[0071] GO enrichment analysis showed that the differentially expressed genes were mainly enriched in metabolic pathways such as photosynthetic membrane (135), photosystem (122), thylakoid (137), thylakoid part (137), photosynthesis (146) and cell biosynthesis process (1692). Figure 3 Glufosinate mainly affects the photosynthesis and cell growth of rapeseed.

[0072] Table 2 Library quality assessment and alignment results analysis

[0073]

[0074]

[0075] Note: CK1-CK3 are blank controls, C1-C3 are BR-treated and then glufosinate-ammonium-treated.

[0076] Kyoto Encyclopedia of Genes and Genomes Enrichment Analysis:

[0077] According to the enrichment analysis of DEGs in Kyoto Encyclopedia of Genes and Genomes (KEGG), 121 metabolic pathways showed differences, of which 40 metabolic pathways had p-values ​​below a specific threshold and a false discovery rate of <0.3. These pathways were mainly divided into lipid metabolism (9), amino acid metabolism (8), carbohydrate metabolism (5), cofactor and vitamin metabolism (4), other secondary metabolite synthesis (2), signal transduction (2), nucleotide metabolism (2), folding (2), energy metabolism (1), transport and catabolism (2), terpenoid and polyketide metabolism (1), other amino acid metabolism (1), and glycan biosynthesis and metabolism (1) (Table 3). Amino acid metabolism, other amino acid metabolism, secondary metabolite synthesis, energy metabolism, lipid metabolism, carbohydrate metabolism, and terpenoid and polyketide metabolism were closely related to growth and development, indicating that the effects of BR immersion on high oleic rapeseed 'Fanming No. 1' seedlings were mainly concentrated in growth and development.

[0078] Table 3 Differences in metabolic pathways

[0079]

[0080]

[0081]

[0082] (4) Analysis of glufosinate-related metabolic pathways

[0083] Through GO and KEGG enrichment analysis, we focused on DEGs in herbicide-related pathways, including photosynthesis, pyruvate metabolism, and amino acid metabolism.

[0084] photosynthesis

[0085] After glufosinate application, nine DEGs were identified in photosystem I, all of which were downregulated. Nine DEGs were identified in photosystem II, two of which were upregulated. Seven genes were downregulated in photosystem II. One DEG in the cytochrome b6 / f complex was downregulated. Four DEGs were involved in photosynthetic electron transport, one nodal gene was upregulated, and three were downregulated. Three F-type ATPases were downregulated ( Figure 4 ).

[0086] Pyruvate metabolism

[0087] EPSP synthase is involved in the synthesis of aromatic amino acids, catalyzing the reaction of shikimate-3-phosphate and phosphoenolpyruvate to produce 5-enolpyruvylshikimate-3-phosphate. After pesticide spraying, 114 genes in the pyruvate metabolism pathway showed differential expression levels. Three gene nodes were upregulated, five were downregulated, and 10 were both upregulated and downregulated. Most of these genes are related to EPSP synthase, suggesting that glufosinate affects pyruvate biosynthesis, leading to changes in EPSP synthase.

[0088] Amino acid metabolism

[0089] After spraying glufosinate ammonium, 669 genes were differentially expressed in amino acid metabolism pathways, including arginine biosynthesis pathway; tyrosine metabolism; serine, glycine and threonine metabolism, of which 269 genes were down-regulated and 400 genes were up-regulated.

[0090] (5) RT-qPCR analysis of glufosinate resistance-related genes

[0091] According to the sequencing results, there are many genes affecting glufosinate resistance in Fanming No. 1, including LHCB1 (BnaA05g09410D), Figure 5 A), fabF(BnaA06g36060D, Figure 5 B), psbW(BnaA04g17660D, Figure 5 C), CYP90A1 (BnaA10g24860D, Figure 5 D), ALDH3F1 (BnaA03g59170D, Figure 5 E), ACOX1 (BnaC08g23150D, Figure 5 F), petF (BnaA03g22350D, Figure 5 G) and ACSL (BnaC01g15670D, Figure 5 H). We collected samples from CK1 and CK2, glufosinate-only treatment (death on the 7th day), A1 (glyphosate-treated, death on the 15th day), A2 (survival), 7 and 10 days after glufosinate treatment, and 13 days after glufosinate treatment to determine the expression levels of each gene at different stages.

[0092] These eight key glufosinate resistance genes were evaluated using RT-qPCR. Figure 5 The expression levels of these genes 7 days after glufosinate treatment are shown. The first period of each graph reveals the changes in the expression level of each gene based on RT-qPCR (A2) and transcriptome sequencing. Figure 5 The results showed that the trends of expression levels determined in RT-qPCR and transcriptome sequencing were highly similar, indicating that the expression data obtained using transcriptome sequencing are reliable.

[0093] Combined with the NCBI database and bioinformatics analysis results, BnaC01g39170D (GSTU8) was preliminarily identified as a key gene related to herbicide resistance.

[0094] Example 2: Experimental process of gene sequence fusion and cloning into vector

[0095] 1. Experimental purpose:

[0096] The gene GSTU8 was synthesized by primers and PCR method to fuse the gene sequence and cloned into the vector PC1300S.

[0097] 2. Experimental Materials:

[0098] Primers; PC1300S vector plasmid; high-fidelity PCR polymerase (T8); recombinase (produced by Qingke Biotechnology: GN-Trelief SoSoo Cloning Kit); gel recovery kit (Axygen); other conventional molecular cloning reagents and consumables.

[0099] The nucleotide sequence of gene GSTU8 is shown in SEQ ID No.1.

[0100] 3. Experimental steps:

[0101] (1) Synthesize the following 14 primers based on the target sequence:

[0102] Table 4 Synthetic primer sequences

[0103]

[0104]

[0105] (2) PCR to obtain the cloned target sequence

[0106] Full-length PCR round 1:

[0107] Reaction system: primers 1-14 (CS0171864-1_1_CS0171864-1_14), approximately 50 pmol / μL, polymerase (pv2), 0.5 μL, 5X PV2 buffer, 10 μL, 10 mM dNTP, 1 μL, make up to 50 μL with ddH2O.

[0108] Reaction conditions: 95°C, 3 min; 95°C 25 s, 62°C 20 s, 25 cycles; 72°C 40 s; 72°C 1 min; storage at 4°C.

[0109] Second round of full-length PCR:

[0110] Reaction system: template (PCR product from the first round), approximately 100 ng / μL, primer 1 CS0171864-1_1, approximately 50 pmol / μL, 0.5 μL, primer 2 CS0171864-1_14, approximately 50 pmol / μL, 0.5 μL, polymerase (pv2), 0.5 μL, 5X PV2 buffer, 10 μL, 10 mM dNTP, 1 μL, make up to 50 μL with ddH2O.

[0111] Reaction conditions: 95°C, 3 min; 95°C 25 s, 62°C 20 s, 25 cycles; 72°C 40 s; 72°C 1 min; storage at 4°C.

[0112] (3) Recover the PCR products from the second round of the above steps by gel recovery. Figure 6 Prepare for ligation experiments as shown.

[0113] (4) Recombination and ligation experiments

[0114] Simultaneously with PCR, the PC1300S plasmid was treated with ECORI-XHOI and recovered by gel extraction.

[0115] Recombination reaction system (10 μL):

[0116] Gel recovery product, 3 μL, PC1300S (linearized vector), 2 μL, recombinant enzyme, 5 μL.

[0117] Reaction conditions:

[0118] Place in a 50°C water bath for 25 min, perform transformation and bacterial solution coating experiments, and incubate at 37°C overnight.

[0119] (5) Colony screening experiment

[0120] a. Pick a single colony from the overnight plate;

[0121] b. Colony PCR was performed using primers 20240416-TY001-B02 / 20240416-TY001-C01;

[0122] c. Identify positive clones by electrophoresis;

[0123] d. Randomly select 8 positive bacteria and culture them in a 4 mL single tube at 37°C in a shaker overnight.

[0124] Depend on Figure 7 It can be seen that the size of positive bacteria is in line with expectations.

[0125] (6) Extract plasmid and send for testing

[0126] The plasmid was extracted from the overnight bacterial solution in (5) and sent for sequencing. The positive bacterial solution was sequenced using the M13F / M13R-88 primers, and the sequence was as follows:

[0127] 20240416-TY001-B02:TTATGCTTCCGGCTCGTATG

[0128] 20240416-TY001-C01: TGTAAAACGACGGCCAGT

[0129] M13F:TGTAAAACGACGGCCAGT

[0130] M13R-88:TTATGCTTCCGGCTCGTATG

[0131] Example 4: Rapeseed genetic transformation method

[0132] Plant material: Zhongshuang 11 seeds.

[0133] Bacterial strain: Agrobacterium tumefaciens strain C58C1.

[0134] Instruments and equipment: pipette, clean bench, infrared sterilizer, 1 / 10,000 electronic balance, high-pressure steam sterilizer, bacterial incubator, oven, pH meter, shaker, ice maker, PCR instrument, electrophoresis instrument, UV spectrophotometer, etc.

[0135] Other tools: Erlenmeyer flasks, glass tissue culture dishes, tissue culture flasks, bacterial culture dishes, 50 mL volumetric flasks, beakers, weighing paper, medicine spoons, tweezers, lens cleaning paper, scalpels, surgical scissors, filter paper, 2 mL and 50 mL centrifuge tubes.

[0136] Reagents: MS basal medium, LB medium, sucrose, glucose, agar, 6-benzylaminopurine (6-BA), naphthaleneacetic acid (NAA), indoleacetic acid (IBA), timentin (Tim), hygromycin (HYG), acetosyringone (AS), zeatin (ZT), IAA, kinetin (KT), silver nitrate, xylose, mannitol, rifampicin (Rif), kanamycin (Kan), sodium hypochlorite, alcohol.

[0137] Steps

[0138] 1. Seed sterilization and explant acquisition

[0139] Perform this in a clean bench. Take out a sterilized empty flask and pour an appropriate amount of seeds into it. Soak the seeds in 70% alcohol for 1 minute. Then add an appropriate amount of 0.1% mercuric chloride solution and 0.1% Tween solution and soak for 15 minutes. Pour the mercuric chloride into a waste bottle and rinse with sterile water 4-5 times. Use sterile tweezers to sow the seeds on seed germination medium (MS + 30g / L sucrose + 7g / L agar), about 40 seeds per bottle, and place in a 24°C incubator in the dark for 6 days.

[0140] The rapeseed hypocotyls were cut into 0.5-1 cm hypocotyl segments using a sterile scalpel and placed in a small amount of DM liquid base (MS + 30 g / L sucrose).

[0141] 2 Transformation of rapeseed hypocotyls

[0142] (1) After cutting enough hypocotyl segments, aspirate the DM liquid and pour the prepared Agrobacterium transformation solution into the vessel containing the hypocotyls. Allow the hypocotyls to be fully immersed in the transformation solution and time for 5 minutes.

[0143] (2) After the timing is completed, the transformation solution is discarded, and the hypocotyls are transferred to sterile filter paper and blown for about 5 minutes. Then, they are transferred to M1 medium (MS + 30 g / L sucrose + 18 g / L mannitol + 1 mg / L 2,4-D + 0.3 mg / L KT + 20 mg / L AS + 8 g / L agar) and cultured in the dark for 2 days.

[0144] (3) After the co-cultivation, the hypocotyls were transferred to M2 medium (MS + 30 g / L sucrose + 18 g / L mannitol + 1 mg / L 2,4-D + 0.3 mg / L KT + 20 mg / L AS + 20 mg / L silver nitrate + 8 g / L agar + 200 mg / L Tim + 20 mg / L HYG) and cultured under 16 h light / 8 h dark conditions. The cells were subcultured every two weeks for 30 days.

[0145] (4) The hypocotyls were transferred to M3 medium (MS + 10 g / L glucose + 0.25 g / L xylose + 0.6 g / LMES + 8 g / L agar + 2 mg / L ZT + 0.1 mg / LIAA + 100 mg / L Tim + 20 mg / L HYG) and cultured under 16 h light / 8 h dark conditions. The cells were subcultured every two weeks until buds were differentiated.

[0146] (5) When the differentiated buds grow to about 1 cm, cut them and insert them into rooting medium (MS + 30g / L sucrose + 6g / L agar + 100mg / L Tim). Cultivate them under 16h light / 8h dark until roots emerge and then harden and transplant.

[0147] The cultivation process of GSTU8 rapeseed is as follows Figure 8 As shown; PCR test results are as follows Figure 9 shown.

[0148] Example 5: Transformed seedling verification test method

[0149] Experimental materials: conventional rapeseed variety Zhongshuang 11 (CK) and its herbicide-resistant transgenic strains.

[0150] Treatment agent: 200g / L glufosinate-ammonium aqueous solution.

[0151] Operation steps: Using a homologous control design, conventional seedlings and transgenic seedlings were simultaneously cultivated under the same cultivation conditions to the 5-6 leaf stage; the glufosinate ammonium stock solution was diluted 1000 times (final concentration 200 mg / L), and then a fully expanded leaf in the middle of each rapeseed plant was selected for targeted spraying using a quantitative sprayer.

[0152] Observation indicators:

[0153] (1) Observation of phytotoxicity symptoms: Observe leaf browning, wilting and other phytotoxicity symptoms 48 h after treatment and take phenotypic photos.

[0154] (2) Physiological index measurement: sampling and measurement 48 hours after treatment

[0155] CAT activity (hydrogen peroxide method); POD activity (guaiacol method); SOD activity (nitroblue tetrazolium method); MDA content (thiobarbituric acid method).

[0156] Figure 10 To verify the results of the transformation test, Figure 10 It can be seen that the transformed seedlings on the left are more resistant to herbicides, while the control on the right quickly died after being sprayed with herbicides.

[0157] The experimental results show that ( Figures 11 to 14 ), the activities of CAT (catalase), POD (peroxidase), and SOD (superoxide dismutase) in the herbicide-resistant transgenic lines were significantly higher than those in conventional seedlings. This phenomenon suggests that the transgenic lines have a stronger ability to resist oxidative stress. Glufosinate, as a herbicide, induces the accumulation of reactive oxygen species (ROS) in plants. By efficiently scavenging ROS, the transgenic lines significantly reduce the damage caused by oxidative stress to cells.

[0158] Furthermore, the transgenic lines showed significantly lower levels of malondialdehyde (MDA) than conventional seedlings, further confirming that their cell membrane structures maintained greater stability under glufosinate stress. MDA is the primary product of membrane lipid peroxidation, and its reduced content indicates that the transgenic lines effectively inhibited membrane damage caused by ROS. Overall, the herbicide-resistant transgenic lines not only enhanced antioxidant enzyme activity but also reduced oxidative stress-induced damage to cell membranes, thereby demonstrating enhanced glufosinate tolerance.

[0159] Field identification Figure 15-17 As shown by Figure 15-17 It can be seen that the seeds were sown on October 18, 2023, and glufosinate was applied on November 21. According to the conventional concentration of herbicide (1 times), it was observed on the 28th that the conventional rapeseed varieties died quickly after being sprayed with herbicide (see Figure 15 ), while the herbicide-resistant transgenic plants showed no significant changes ( Figure 15On January 10, 2024, the second application of glufosinate (1 times) was carried out. One week later, it was found that all conventional rapeseed varieties had died (see Figure 16 The herbicide-resistant transgenic plants showed only slight damage, but no seedlings died ( Figure 16 On February 14, 2024, the third application of glufosinate (10 times) was conducted. It was observed that most of the herbicide-resistant transgenic plants were damaged and died, but a few seedlings in each plot were not affected ( Figure 17 left).

[0160] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Use of the herbicide-resistant rapeseed gene GSTU8 or the protein it encodes in enhancing plant resistance to herbicides.

2. Application of the herbicide-resistant rapeseed gene GSTU8 or the protein it encodes in herbicide-resistant crop breeding.

3. The use according to claim 1 or 2, characterized in that: The nucleotide sequence of the herbicide-resistant rapeseed gene GSTU8 is shown in SEQ ID No.

1.

4. The use according to claim 1 or 2, characterized in that: The amino acid sequence of the encoded protein is shown in SEQ ID No.

2.

5. The use according to claim 1, characterized in that: The herbicide is glufosinate ammonium; and the plant is rapeseed.

6. The use according to claim 2, characterized in that: The herbicide is glufosinate ammonium and the crop is rapeseed.

7. An overexpression vector, characterized in that: Contains the herbicide-resistant rapeseed gene GSTU8.

8. The overexpression vector according to claim 7, wherein: The nucleotide sequence of the herbicide-resistant rapeseed gene GSTU8 is shown in SEQ ID No.

1.

9. A method for cultivating herbicide-resistant rapeseed, characterized in that: The method comprises the following steps: transferring the overexpression vector according to claim 8 into Agrobacterium to obtain a transformation liquid; infecting rapeseed hypocotyls with the transformation liquid, and obtaining herbicide-resistant rapeseed after differentiation and rooting.

10. The method for cultivating herbicide-resistant rapeseed according to claim 9, wherein: The OD of the transformation solution 600 The value is 0.2-0.5, the infection time is 5 min; the Agrobacterium is Agrobacterium tumefaciens strain C58C1.

Citation Information

Patent Citations

  • Rape multiple ALS (acetolactate synthase) inhibitor type herbicide-resistant gene based on in-vitro site-specific mutagenesis and application

    CN107058350A