Construction of a viral vector specifically overexpressing zer1 in myocardial cells and application in treatment of heart failure
By specifically overexpressing ZER1 in cardiomyocytes and using an adeno-associated virus vector to degrade DVL2 protein, the problem of poor treatment efficacy for heart failure was solved, and effective prevention and treatment of cardiac dysfunction were achieved.
Patent Information
- Application Number
- CN202511286097.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-10
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2045-09-10
AI Technical Summary
Existing treatments for heart failure have limited effectiveness, and global morbidity and mortality remain high, with a lack of effective prevention and treatment strategies.
A tissue-specific expression vector targeting cardiomyocytes was developed. By linking the nucleotide sequence encoding ZER1 with a cardiomyocyte-specific promoter, an adeno-associated virus vector was constructed for the specific overexpression of ZER1 in vivo, degradation of DVL2 protein, and prevention of cardiac hypertrophy and fibrosis.
By overexpressing ZER1 in cardiomyocytes, it effectively protects the heart from hypertrophy caused by stress overload, prevents or treats cardiac remodeling, cardiomyocyte hypertrophy, myocardial fibrosis, myocardial hypertrophy, cardiac hypertrophy and heart failure, and significantly improves cardiac function.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of gene therapy and cardiovascular diseases. In particular, the present application relates to an expression vector comprising a nucleotide sequence encoding ZER1 and use thereof in the preparation of a medicament for preventing or treating cardiac dysfunction. BACKGROUND
[0002] Cardiac hypertrophy is an adaptive response of the heart to hemodynamic stress. However, long-term hypertrophy can lead to pathological remodeling and eventually develop into heart failure. Despite various clinical treatment methods, the global incidence and mortality of heart failure remain alarmingly high. Therefore, it is imminent to develop more effective treatment strategies for heart failure. SUMMARY
[0003] The present application develops a tissue-specific expression vector targeting cardiomyocytes for specifically overexpressing ZER1 in vivo to achieve intervention and treatment of cardiac dysfunction, thereby providing a new strategy for the prevention and treatment of heart failure.
[0004] In some embodiments, the present application provides an expression vector, wherein the expression vector comprises a nucleotide sequence encoding ZER1, which is operably linked to a myocardium-specific promoter.
[0005] In some embodiments, the present application provides a pharmaceutical composition comprising the expression vector of the first aspect and a pharmaceutically acceptable ingredient.
[0006] In some embodiments, the present application provides use of the expression vector of the first aspect or the pharmaceutical composition of the second aspect in the preparation of a medicament for preventing or treating cardiac dysfunction.
[0007] In some embodiments, the present application can include the inventions described in the following.
[0008] 1. An expression vector, wherein the expression vector comprises a nucleotide sequence encoding ZER1, which is operably linked to a myocardium-specific promoter.
[0009] 2. The expression vector according to item 1, wherein the expression vector is selected from any one of the following: an adeno-associated viral vector, an adenoviral vector, a retroviral vector, and a lentiviral vector.
[0010] 3. The expression vector according to item 2, wherein the adeno-associated viral vector is a serotype 9, 2, 1, 6, 8, or 5 adeno-associated viral vector.
[0011] 4. The expression vector of item 3, wherein the adeno-associated viral vector is a serotype 9 adeno-associated viral vector.
[0012] 5. The expression vector of item 1, wherein the cardiac muscle-specific promoter is a cardiac troponin T promoter (cTnT), a myosin heavy chain alpha promoter (aMHC), or a creatine kinase promoter (MCK).
[0013] 6. The expression vector of item 5, wherein the cardiac muscle-specific promoter is a cardiac troponin T promoter (cTnT).
[0014] 7. A method of preparing the expression vector of any one of items 1-6, comprising the step of operably linking a nucleotide sequence encoding ZER1 to a cardiac muscle-specific promoter.
[0015] 8. A pharmaceutical composition comprising the expression vector of any one of items 1-6 and a pharmaceutically acceptable ingredient.
[0016] 9. Use of the expression vector of any one of items 1-6 or the pharmaceutical composition of item 8 in the preparation of a medicament for preventing or treating cardiac dysfunction.
[0017] 10. The use of item 9, wherein the cardiac dysfunction is cardiac remodeling, cardiomyocyte hypertrophy, myocardial fibrosis, myocardial hypertrophy, cardiac hypertrophy, cardiac fibrosis, or heart failure.
[0018] The present invention protects the heart from hypertrophy caused by pressure overload by specifically expressing a gene encoding ZER1 in cardiomyocytes, thereby being useful for preventing or treating cardiac hypertrophy and heart failure. BRIEF DESCRIPTION OF DRAWINGS
[0019] Figure 1This document presents the construction and overexpression efficiency validation results of the AAV9-cTnT-ZER1 overexpression vector. A shows a schematic diagram of the AAV9-cTnT-ZER1 vector; B shows immunofluorescence staining of heart sections from mice 3 weeks after tail vein injection of the overexpression vector; C shows the mRNA expression of ZER1 in the heart of mice 3 weeks after tail vein injection of either the AAV9-cTnT-ZER1 vector or the control vector AAV9-cTnT-Vector, detected by RT-qPCR; D shows a representative Western blot analysis of ZER1 in heart tissue extracts 3 weeks after tail vein injection of either the AAV9-cTnT-ZER1 vector or the control vector AAV9-cTnT-Vector; and E shows the quantitative analysis of ZER1 levels in heart tissue extracts 3 weeks after tail vein injection of either the AAV9-cTnT-ZER1 vector or the control vector AAV9-cTnT-Vector using Western blot. All data represent mean ± SEM, and ***P < 0.001.
[0020] Figure 2 The therapeutic overexpression of ZER1 in cardiomyocytes was used to prevent cardiac hypertrophy and fibrosis caused by stress overload. In this study, A represents the experimental timeline of AAV9-cTnT-ZER1 overexpression vector treatment. One week after TAC surgery, C57BL / 6 mice were intravenously injected with either the AAV9-cTnT-ZER1 vector or the control vector AAV9-cTnT-Vector (5 × 10⁻⁶). 11 A) One is a vector genome copy [Vg] / mouse, and monitoring continues for 3 weeks; B) is the histological analysis of heart sections collected 4 weeks after TAC or sham surgery, in which hematoxylin and eosin (H&E) staining is used to assess overall morphology (scale bar, 1 mm), wheat germ lectin (WGA) staining is used to delineate cell boundaries (scale bar, 50 μm), and Masson trichrome staining (MTT) is used to assess cardiac fibrosis (scale bar, 50 μm); C) is the ratio of heart weight (hereinafter referred to as heart weight) to body weight (HW / BW) in mice treated with vector AAV9-cTnT-ZER1 or control vector AAV9-cTnT-Vector for 3 weeks after TAC or sham surgery (n=7 independent biological replicates); D) is the quantification of cardiomyocyte cross-sectional area (CSA) based on WGA staining, CSA is measured using ImageJ software, 5 independent heart samples are analyzed in each group, and 10 regions are randomly selected from each sample; and E) is as follows. Figure 2 Quantitative analysis of the fibrotic region shown in B (n=5 independent biological replicates). Data represent mean ± SEM, and ***P<0.001.
[0021] Figure 3Therapeutic overexpression of ZER1 in cardiomyocytes alleviates pressure overload-induced cardiac dysfunction. Among them, A is a representative M-mode echocardiogram image of mice treated with vector AAV9-cTnT-ZER1 or control vector AAV9-cTnT-Vector for 3 weeks after TAC or sham operation; B to L are quantitative analysis of echocardiogram parameters of mice treated with vector AAV9-cTnT-ZER1 or control vector AAV9-cTnT-Vector for 3 weeks after TAC or sham operation, the measurement indexes include ejection fraction (EF), fractional shortening (FS), left ventricular mass, and left ventricular internal diameter (LVIDs and LVIDd), posterior wall thickness (LVPWs and LVPWd), anterior wall thickness (LVAWs and LVAWd), and left ventricular volume (LV Vols and LV Vold) in systole and diastole (n=7 independent biological replicates). Among them, the data represent mean ± SEM, and *P<0.05, **P<0.01, ***P<0.001.
[0022] Figure 4 Therapeutic overexpression of ZER1 in cardiomyocytes inhibits pressure overload-induced hypertrophic gene expression by degrading DVL2 protein. Among them, A is a representative Western blot analysis of ZER1, DVL2 protein, p-HDAC4 (Ser246), total HDAC4, p-CaMKII (Thr287), and total CaMKII in heart tissue extracts of mice treated with vector AAV9-cTnT-ZER1 or control vector AAV9-cTnT-Vector for 3 weeks after TAC or sham operation; B to E are Western blot quantitative analysis of the levels of ZER1 and DVL2 protein, and the phosphorylation levels of CaMKII at Thr287 and HDAC4 at Ser246 in heart tissue lysates of mice treated with vector AAV9-cTnT-ZER1 or control vector AAV9-cTnT-Vector for 3 weeks after receiving TAC or sham operation treatment; F to H are the mRNA expression levels of atrial natriuretic peptide (ANP), brain natriuretic peptide (BNP), and β-myosin heavy chain (β-MHC) in the hearts of mice treated with vector AAV9-cTnT-ZER1 or control vector AAV9-cTnT-Vector for 3 weeks after TAC or sham operation, analyzed by RT-qPCR. The transcription level is standardized by Gapdh and expressed as relative expression value (n=5 independent biological replicates). Among them, the data represent mean ± SEM, and *P<0.05, **P<0.01, ***P<0.001.
[0023] In the above figures, AAV9-ZER1 represents the vector AAV9-cTnT-ZER1, and AAV9-Vec represents the control vector AAV9-cTnT-Vector. DETAILED DESCRIPTION
[0024] Disheveled (Dvl) is a key cytoplasmic mediator that plays an important positive regulatory role in canonical and non-canonical WNT signaling pathways, and plays a key role in heart development and cardiac remodeling. The calcium / calmodulin-dependent protein kinase II (CaMKII)-histone deacetylase (HDAC) signaling axis is widely recognized as a key regulatory node of cardiac hypertrophy. DVL2 protein activates CaMKII, promotes nuclear export of HDAC4, thereby activating myocyte enhancer factor 2C (MEF2C), inducing cardiac gene transcription and hypertrophy.
[0025] The ubiquitin-proteasome system (UPS) is the main protein degradation mechanism in eukaryotic cells, and its substrate selectivity is mainly determined by E3 ubiquitin ligase (E3). In most cases, E3 recognizes its substrate through a short and specific peptide motif called a degradation determinant, and the degradation pathway that recognizes the N-terminal degradation determinant is called the N-end rule pathway. One branch of the N-end rule pathway is called the Gly / N-degradation pathway, which regulates the quality control of Nt-palmitoylated and Nt-acetylated proteins by recognizing N-terminal glycine residues, and recognizes proteins with exposed N-terminal glycine through the substrate receptor ZER1 of the Cullin 2-RING E3 ubiquitin ligase (CRL2) complex.
[0026] The inventors of the present application can effectively degrade DVL2 protein and effectively prevent or treat cardiac dysfunction (e.g., cardiac remodeling, cardiomyocyte hypertrophy, myocardial fibrosis, myocardial hypertrophy, cardiac hypertrophy, cardiac fibrosis, or heart failure) by cloning a nucleotide sequence encoding the substrate receptor ZER1 of the CRL2 complex into an adeno-associated virus vector (e.g., a serum type 9 adeno-associated virus vector AAV9) and overexpressing the gene encoding ZER1 in cardiomyocytes.
[0027] The practice of the present application will employ, unless otherwise indicated, conventional techniques of genetic engineering, biology, biochemistry and analytical chemistry, which are well within the purview of the skilled artisan.
[0028] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.
[0029] Unless otherwise indicated, all experimental reagents are commercially available.
[0030] DEFINITIONS
[0031] As used herein, the term "ZER1" refers to one subunit of the Cullin 2-RING E3 ubiquitin ligase (CRL2) complex, which primarily recognizes glycine degradation signals at the N-terminus of proteins and mediates their ubiquitination degradation. ZER1 specifically recognizes un-mycotylated proteins through complex crystal structures formed with N-terminal glycine. When proteins expose glycine at their N-terminus, ZER1 marks them as targets for degradation, triggering the ubiquitination pathway. ZER1 is encoded by the zyg-11 related cell cycle regulator gene.
[0032] As used herein, the term "cardiac muscle-specific promoter" refers to a class of DNA regulatory sequences capable of driving the specific expression of foreign genes in cardiac muscle cells. Major cardiac muscle-specific promoters include, but are not limited to, cardiac troponin T promoter (cTnT), myosin heavy chain alpha promoter (aMHC), or creatine kinase promoter (MCK).
[0033] As used herein, the term "operably linked" refers to the functional relationship of polynucleotide elements. A nucleic acid is "operably linked" when it is in a functional relationship with another nucleic acid sequence. For example, a transcriptional regulatory sequence such as a promoter is operably linked to a coding sequence if it affects the transcription of the coding sequence. Operably linked means that the DNA sequences being linked are typically contiguous and, where necessary to connect two protein coding regions, are connected and in reading frame.
[0034] As used herein, the term "overexpression" refers to a technique of significantly increasing the expression level of a specific gene in a cell or organism by artificial regulatory means. In some embodiments of the present application, the gene encoding ZER1 can be overexpressed in cardiac muscle cells by administering an expression vector comprising a nucleotide sequence encoding ZER1 to an organism.
[0035] In some aspects, the present application provides an expression vector, wherein the expression vector comprises a nucleotide sequence encoding ZER1 operably linked to a cardiac muscle-specific promoter.
[0036] In one or more embodiments, the expression vector is selected from any one of the following: an adeno-associated viral vector, an adenoviral vector, a retroviral vector, and a lentiviral vector.
[0037] In one or more embodiments, the adeno-associated viral vector is a serotype 9, 2, 1, 6, 8, or 5 adeno-associated viral vector.
[0038] In one or more embodiments, the adeno-associated viral vector is a serotype 9 adeno-associated viral vector.
[0039] In one or more embodiments, wherein the adeno-associated viral vector is a recombinant adeno-associated viral vector, a commonly used recombinant adeno-associated viral vector is a hybrid viral vector produced by combining a serotype 2 adeno-associated viral vector with different capsid proteins, generally labeled as rAAV2 / N (N is the different capsid serotype). The recombinant adeno-associated viral vector has the stable expression and gene integration ability of AAV2 type, while obtaining the tissue infective tropism of different serotypes, showing certain organ targeting specificity. In one or more embodiments, the recombinant adeno-associated viral vector rAAV2 / 9 is used, and rAAV2 / 9 and AAV9 can be used interchangeably.
[0040] In one or more embodiments, the nucleotide sequence encoding ZER1 present in the expression vector according to the present application can be derived from any zyg-11 -related cell cycle regulator gene or ZER1 coding sequence, preferably from a zyg-11 -related cell cycle regulator gene or ZER1 coding sequence from human or mouse; or a mutated zyg-11 -related cell cycle regulator gene or ZER1 coding sequence, preferably from human or mouse; or a codon-optimized zyg-11 -related cell cycle regulator gene or ZER1 coding sequence, preferably from human or mouse.
[0041] In one or more embodiments, the exemplary nucleotide sequence encoding ZER1 encodes the amino acid sequence set forth in UniProtKB Accession No. Q7Z7L7 or Q80ZJ6, or an amino acid sequence that is at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identical to the amino acid sequence set forth in UniProtKB Accession No. Q7Z7L7 or Q80ZJ6. The amino acid sequence set forth in UniProtKB Accession No. Q7Z7L7 represents the amino acid sequence of human ZER1. The amino acid sequence set forth in UniProtKB Accession No. Q80ZJ6 represents the amino acid sequence of mouse ZER1. In one or more embodiments, the nucleotide sequence encoding ZER1 present in the expression vector according to the present application is as set forth in NCBI Gene Accession No. 10444 (derived from human) or 227693 (derived from mouse), or a nucleotide sequence that is at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identical to the nucleotide sequence set forth in NCBI Gene Accession No. 10444 (derived from human) or 227693 (derived from mouse).
[0042] In one or more embodiments, the heart muscle-specific promoter is a cardiac troponin T promoter (cTnT), a myosin heavy chain alpha promoter (aMHC), or a creatine kinase promoter (MCK).
[0043] In one or more embodiments, the heart muscle specific promoter is a cardiac troponin T promoter (cTnT). In one or more embodiments, the cTnT can be a cTnT known to one of skill in the art.
[0044] In one or more embodiments, the expression vector further comprises a nucleotide sequence encoding a fluorescent marker protein GdGreen for labeling expression. In one or more embodiments, the coding sequence and amino acid sequence of the fluorescent marker protein GdGreen are known to one of skill in the art.
[0045] In one or more embodiments, the expression vector further comprises a nucleotide sequence encoding a P2A self-cleaving peptide that can enable co-expression of ZER1 and the fluorescent marker protein GdGreen. In one or more embodiments, the coding sequence and amino acid sequence of the P2A self-cleaving peptide are known to one of skill in the art.
[0046] In one or more embodiments, the expression vector further comprises a transcription termination signal tWPA. In one or more embodiments, the tWPA can be a tWPA known to one of skill in the art.
[0047] In one or more embodiments, the expression vector further comprises an inverted terminal repeat (ITR) for AAV packaging. In one or more embodiments, the ITR can be an ITR known to one of skill in the art.
[0048] In one or more embodiments, the expression vector is based on a backbone of pAAV-cTnT-GdGreen-tWPA.
[0049] In one or more embodiments, the expression vector targets heart muscle cells. In one or more embodiments, the expression vector overexpresses a gene encoding ZER1 in heart muscle cells.
[0050] In one or more embodiments, the overexpression of the ZER1 reduces the stability and / or promotes the degradation of Dishevelled 2 (DVL2) to reduce the level of DVL2 in heart muscle cells.
[0051] In some aspects, the present application provides a method of making an expression vector, wherein the expression vector comprises a nucleotide sequence encoding ZER1 operably linked to a heart muscle specific promoter, wherein the method comprises the step of operably linking the nucleotide sequence encoding ZER1 to the heart muscle specific promoter.
[0052] In one or more embodiments, the method of the present application reduces the level of Dishevelled 2 (DVL2) in a cardiomyocyte by reducing the stability and / or promoting the degradation of DVL2 through expression or overexpression of ZER1 in the cardiomyocyte. Accordingly, in one or more embodiments, the method of the present application can further comprise the step of detecting the level of DVL2 in the cardiomyocyte.
[0053] In some aspects, the present application provides a pharmaceutical composition comprising the expression vector of the first aspect and a pharmaceutically acceptable ingredient.
[0054] In one or more embodiments, the pharmaceutically acceptable ingredient comprises a pharmaceutically acceptable carrier, filler, preservative, solubilizer, vehicle, diluent and / or excipient. Accordingly, the one or more pharmaceutically acceptable ingredients can be selected from the group consisting of a pharmaceutically acceptable carrier, filler, preservative, solubilizer, vehicle, diluent and / or excipient.
[0055] In one or more embodiments, the pharmaceutical composition can be present with an additional compound. The compound can aid in the delivery of the pharmaceutical composition. Suitable compounds herein are those capable of forming a complex, nanoparticle, micelle and / or liposome that delivers each ingredient as described herein through complexation with a cell membrane or capture in a vesicle or liposome. Many of these compounds are known in the art.
[0056] In some aspects, the present application provides use of the expression vector of the first aspect or the pharmaceutical composition of the second aspect in the preparation of a medicament for preventing or treating a cardiac dysfunction.
[0057] In one or more embodiments, the cardiac dysfunction is cardiac remodeling, cardiomyocyte hypertrophy, myocardial fibrosis, myocardial hypertrophy, cardiac hypertrophy, cardiac fibrosis or heart failure.
[0058] In one or more embodiments, the cardiac remodeling is a pathological structural remodeling of the heart under myocardial injury or long-term hemodynamic pressure, manifested as cardiomyocyte hypertrophy, interstitial fibrosis and abnormal morphology and function of the heart, commonly seen in the development of heart failure.
[0059] In one or more embodiments, the cardiac hypertrophy is pressure overload-induced cardiac hypertrophy.
[0060] In one or more embodiments, the expression vector of the first aspect, the pharmaceutical composition of the second aspect or the medicament for preventing or treating a cardiac dysfunction prepared from the expression vector of the first aspect or the pharmaceutical composition of the second aspect can be administered by intravenous injection.
[0061] It is to be understood that the foregoing detailed description is merely illustrative and is not intended to limit the application in any way as the scope of the application being defined in the appended claims.
[0062] The materials, reagents and the like used in the following examples were commercially available unless otherwise specified.
[0063] Example 1. Construction of AAV9-cTnT-ZER1 overexpression vector
[0064] The construction of the adenovirus-associated vector was commissioned to Genbio Technology (Shanghai) Co., Ltd. First, the downstream gene was expressed under the driving of the cTnT heart-specific promoter. The AAV9-ZER1 sequence was cloned into the plasmid containing the cTnT promoter, and then the P2A self-cleavage peptide sequence was connected downstream to realize the co-expression of multiple proteins. The fluorescent reporter gene GdGreen was connected after P2A to mark the expression, and finally the transcription termination signal tWPA was connected. The ITR sequence required for AAV packaging was retained at both ends (A part in Figure 1 The vector was constructed by conventional molecular cloning technology, and after sequencing verification, it was used for AAV9 virus packaging and in vivo injection experiments.
[0065] The nucleotide sequence of the cTnT heart-specific promoter is:
[0066] GGGATAAAAGCAGTCTGGGCTTTCACATGACAGCATCTGGGGCTGCGGCAGAGGGTCGGGTCCGAAGCGCTGCCTTATCAGCGTCCCCAGCCCTGGGAGGTGACAGCTGGCTGGCTTGTGTCAGCCCCTCGGGCACTCACGTATCTCCGTCCGACGGGTTTAAAATAGCAAAACTCTGAGGCCACACAATAGCTTGGGCTTATATGGGCTCCTGTGGGGGAAGGGGGAGCACGGAGGGGGCCGGGGCCGCTGCTGCCAAAATAGCAGCTCACAAGTGTTGCATTCCTCTCTGGGCGCCGGGCACATTCCTGCTGGCTCTGCCCGCCCCGGGGTGGGCGCCGGGGGGACCTTAAAGCCTCTGCCCCCCAAGGAGCCCTTCCCAGACAGCCGCCGGCTTGAAAACAAACAGACAGGTTGGTCTGTTTGTATTATAAGTAAGGACTAGTGTTTATCACAGTTAAATTGCTAACGCAGTCAGTGCTTCTGACACAACAGTCTCGAACTTAAGCTGCAGAAGTTGGTCGTGAGGCACTGGGCAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAG (SEQ ID NO: 1)
[0067] The nucleotide sequence encoding ZER1 is:
[0068]
[0069] Example 2. Injection of AAV9-cTnT-ZER1 overexpression vector and verification of overexpression efficiency
[0070] Mice were injected with adeno-associated virus vector AAV9-cTnT-ZER1 (5.0 x 1011vg / mouse) via the tail vein, and sacrificed 3 weeks later; the control group was injected with the same dose of control vector AAV9-cTnT-Vector. 11 V.g / mouse), and sacrificed 3 weeks later; the control group was injected with the same dose of control vector AAV9-cTnT-Vector.
[0071] (1) Protein extraction and Western blot analysis
[0072] Heart tissue and cells were lysed on ice with RIPA solution (Solarbio, China) supplemented with protease / phosphatase inhibitor cocktail (Roche, Switzerland) for 30 minutes. The lysate was centrifuged at 12,000 g for 15 minutes at 4°C, and the supernatant was taken. The protein concentration was determined using a bicinchoninic acid (BCA) assay kit (Thermo Fisher Scientific, USA). Protein samples were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, USA). The membrane was incubated with 5% skim milk at room temperature for 1 hour to block non-specific binding, and then incubated with the primary antibody overnight at 4°C. After washing three times with Tris-buffered saline with 0.1% Tween-20 (TBST), the membrane was incubated with horseradish peroxidase (HRP)-conjugated secondary antibody (Bioworld Technology, China) at room temperature. Protein bands were detected using enhanced chemiluminescence (ECL) reagents (Abbkine, USA), and quantitative analysis was performed using ImageJ software (NIH).
[0073] The antibodies used were: anti-GAPDH (1:5000, Abways Technology, #AB0037), anti-ZER1 (1:1000, Proteintech, #16647-1-AP), anti-DVL2 (1:1000, Cell Signaling Technology, #3224S), anti-HDAC4 (4A3) (1:1000, Cell Signaling Technology, #5392S), anti-phospho-HDAC4 (Ser246) (1:1000, Cell Signaling Technology, #3443S), anti-CaMK2 alpha / delta (1:1000, GeneTex, #GTX52377), anti-CaMK2 beta / gamma / delta (1:1000, Phospho-Thr287, GeneTex, GTX52342), HRP-labeled goat anti-mouse IgG (H+L) (1:5000, Beyotime, #A0216), and HRP-labeled goat anti-rabbit IgG (H+L) (1:10000, Beyotime, #A0208).
[0074] (2) RNA extraction and real-time PCR
[0075] Total RNA was extracted from heart tissue and cultured cells using TRIzol reagent (Takara, Japan) according to the manufacturer’s instructions. First-strand cDNA was synthesized from 1 μg of total RNA using random hexamers and the HiScript III qRT SuperMix (+gDNA wiper) kit (Vazyme, China). Quantitative real-time PCR (qRT-PCR) was performed using the SYBR Green PCR kit (Vazyme, China) on a LightCycler system (Roche, Switzerland). The thermal cycling conditions included an initial denaturation at 95°C for 30 seconds, followed by 40 cycles of 95°C for 10 seconds and annealing / extension at 60°C for 30 seconds. The relative gene expression was calculated using the 2^-ΔΔCt method, with the housekeeping gene GAPDH as the standard, and expressed as fold change relative to the control sample. The primers (synthesized by AZENTA, USA) were as follows:
[0076] Mouse Zer1 forward primer: 5’-GGAACTGCTGTCTGACCCTC-3’ (SEQ ID NO: 3)
[0077] Reverse primer: 5’-TCGCAGTTGTCAGGTGTCTC-3’ (SEQ ID NO: 4)
[0078] Mouse Gapdh forward primer: 5'-ACTCCACTCACGGCAAATTCA-3' (SEQ ID NO: 5)
[0079] Reverse primer: 5'-GGCCTCACCCCATTTGATG-3' (SEQ ID NO: 6)
[0080] The results show that the rAAV2 / 9-cTnT-ZER1 vector labeled with the fluorescent reporter GdGreen has a high transfection efficiency in mouse cardiomyocytes (Part B in FIG. 6). Compared with the mouse heart injected with the control vector rAAV2 / 9-cTnT-Vector, the injection of the vector rAAV2 / 9-cTnT-ZER1 significantly increased the mRNA expression and protein level of ZER1 in the heart (Parts C-E in FIG. 6). Figure 1 Figure 1
[0081] Example 3. Aortic arch constriction (TAC)-induced cardiac hypertrophy model
[0082] Mice (6-8 weeks old, 22-26 g body weight) were anesthetized by intraperitoneal injection of 2,2,2-tribromoethanol (0.1 mL / 10 g body weight). Then, the animals were placed in a supine position, the proximal sternum and the first rib were incised, the pectoral muscle was bluntly separated, and the thymus was separated to expose the aortic arch. After separating the aortic arch between the un-named artery and the left common carotid artery, it was constricted with 6-0 nylon suture and tightly tied with 2 turns on a 27G blunt needle to perform TAC. The needle was immediately pulled out after ligation, and then the ribs and skin were sutured. In addition to the aortic constriction, the sham-operated mice received the same intervention measures.
[0083] Example 4. Therapeutic overexpression of ZER1 in cardiomyocytes prevents cardiac hypertrophy and fibrosis caused by pressure overload
[0084] (1) Experimental time schedule of AAV9-cTnT-ZER1 overexpression vector treatment
[0085] Mice were injected with the adeno-associated virus vector AAV9-cTnT-ZER1 (5.0 x 10 11 V / g) via the tail vein, and the control group was injected with the same dose of the control vector AAV9-cTnT-Vector. From 1 week after TAC surgery, the mice were subjected to echocardiographic imaging analysis, histological detection, and related protein and mRNA level detection at 4 weeks.
[0086] (2) Staining analysis of cardiac histology after AAV9-cTnT-ZER1 overexpression vector treatment
[0087] Heart specimens were imaged using a stereomicroscope (Zeiss, Germany). Paraffin-embedded heart sections, 5 pm in thickness, were deparaffmized in xylene and rehydrated through a gradient ethanol series. Subsequently, sections were stained with hematoxylin and eosin (H&E), Masson’s trichrome (MTT), and wheat germ agglutinin (WGA). Cardiac fibrosis was evaluated using a Masson’s trichrome staining kit (Solarbio, China) according to the manufacturer’s instructions. Stained sections were observed under an upright fluorescence microscope (Leica, Germany), and fibrosis areas were quantified using ImageJ software for 5 animals per group. To measure the cross-sectional area (CSA) of cardiomyocytes, heart cross-sections were deparaffmized and heated in 0.01 M sodium citrate buffer (pH 6.0) for 15 min. Sections were then incubated with FITC-conjugated WGA (20 pg / mL) (Sigma, Germany) or iFluor-555-conjugated WGA (20 pg / mL) in a 37 °C humidified incubator for 30 min. Sections were mounted with an anti-fluorescence mounting medium containing DAPI (Beyotime, P0121) and sealed with a coverslip. Images were acquired using an upright fluorescence microscope (Leica, Germany), and CSA quantification was performed using ImageJ for 5 samples per group (10 random fields were chosen for each sample). For immunohistochemistry, sections were subjected to antigen retrieval by microwave heating in 0.01 M sodium citrate buffer (pH 6.0) for 15 min. Sections were then incubated with primary antibodies against ZER1 (1 : 100; Proteintech, Cat# 16647-1-AP) or DVL2 (1 : 100; Cell Signaling Technology, Cat# 3224S) overnight at 4 °C. Endogenous peroxidase activity was blocked with 3% hydrogen peroxide. After three washes with PBS, sections were incubated with biotinylated secondary antibodies for 1 h at room temperature, followed by color development using a DAB detection kit (Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd., China). Negative controls were prepared by omitting the primary antibody. All sections were examined under an upright fluorescence microscope (Leica, Germany).
[0088] Example 5. Therapeutic overexpression of ZER1 in cardiomyocytes alleviates pressure overload-induced cardiac dysfunction
[0089] Four weeks after TAC, mice were subjected to transthoracic two-dimensional guided M-mode echocardiography using a Vevo F2 (FujiFilm, Japan) and a 46 MHz probe (FujiFilm, Japan). Mice were anesthetized with 2% isoflurane, maintained at a concentration of 1% isoflurane, and oxygenated at 0.8 L / min. During echocardiography imaging, body temperature was controlled with a warming pad, while electrocardiogram monitoring was performed using limb electrodes. At least three heartbeats were measured per time, and left ventricular (LV) chamber size and wall thickness were measured. Left ventricular anterior wall diastolic and systolic mean thickness (LVAWd, LVAWs), left ventricular posterior wall diastolic and systolic mean thickness (LVPWd, LVPWs), and left ventricular internal diameter diastolic and systolic mean (LVIDd, LVIDs) were measured. Left ventricular fractional shortening (FS) and left ventricular ejection fraction (EF) were calculated from M-mode measurements. Studies and analyses were performed in a blinded fashion to the experimental groups. Echocardiography imaging was analyzed using Vevo LAB. All measurements were derived from at least three cardiac cycles, and the mean values of the results were used for analysis.
[0090] Echocardiography analysis showed that mice injected with the vector rAAV2 / 9-cTnT-ZER1 had a significant mitigation of the decrease in ejection fraction and fractional shortening after 4 weeks of TAC compared to mice injected with the control vector rAAV2 / 9-cTnT-Vector (parts A to C in Figure 2). Figure 3 In control vector rAAV2 / 9-cTnT-Vector mice, 4 weeks of TAC led to an increase in LV mass, systolic and diastolic LV posterior wall thickness; however, this response was significantly reduced in vector rAAV2 / 9-cTnT-ZER1 mice (parts D to L in Figure 2). Figure 3
[0091] Example 6. Therapeutic overexpression of ZER1 in cardiomyocytes inhibits hypertrophic gene expression induced by pressure overload through degradation of DVL2
[0092] (1) Protein extraction and Western blot analysis
[0093] Protein extraction and Western blot analysis were performed as described in Example 2. The antibodies used were: anti-GAPDH (1:5000, Abways Technology, #AB0037), anti-ZER1 (1:1000, Proteintech, #16647-1-AP), anti-DVL2 (1:1000, Cell Signaling Technology, #3224S), anti-HDAC4 (4A3) (1:1000, Cell Signaling Technology, #5392S), anti-phospho-HDAC4 (Ser246) (1:1000, Cell Signaling Technology, #3443S), anti-CaMK2 alpha / delta (1:1000, GeneTex, #GTX52377), anti-CaMK2 beta / gamma / delta (1:1000, Phospho-Thr287, GeneTex, GTX52342), HRP-labeled goat anti-mouse IgG (H+L) (1:5000, Beyotime, #A0216), and HRP-labeled goat anti-rabbit IgG (H+L) (1:10000, Beyotime, #A0208).
[0094] (2) RNA extraction and real-time PCR
[0095] RNA extraction and real-time PCR were performed as described in Example 2.
[0096] Primers (synthesized by AZENTA, USA) were as follows:
[0097] Mouse ANP forward primer: 5’-TTCGGGGGTAGGATTGACAG-3’ (SEQ ID NO: 7)
[0098] Reverse primer: 5’-CACACCACAAGGGCTTAGGA-3’ (SEQ ID NO: 8)
[0099] Mouse BNP forward primer: 5’-TGTTTCTGCTTTTCCTTTATCTG-3’ (SEQ ID NO: 9)
[0100] Reverse primer: 5’-TCTTTTTGGGTGTTCTTTTGTGA-3’ (SEQ ID NO: 10)
[0101] Mouse β-MHC forward primer: 5’-CCTCAGCAGAGGAGTACAGC-3’ (SEQ ID NO: 11)
[0102] Reverse primer: 5'-GGCTGAGCCTTGGATTCTCA-3' (SEQ ID NO:12)
[0103] Mouse Gapdh forward primer: 5'-ACTCCACTCACGGCAAATTCA-3' (SEQ ID NO:5)
[0104] Reverse primer: 5'-GGCCTCACCCCATTTGATG-3' (SEQ ID NO:6)
[0105] The results showed that, compared with the mouse hearts injected with the control vector rAAV2 / 9-cTnT-Vector, the elevated DVL2 protein levels and the phosphorylation levels of CaMKII and HDAC4 after TAC were restored by injection of the vector rAAV2 / 9-cTnT-ZER1. Figure 4 (Parts A to E in the original text). The reactivation of fetal genes ANP, BNP, and β-MHC in the mouse heart was also alleviated. Figure 4 (Parts F to H in the text).
[0106] Experimental conclusion: Specific overexpression of the gene encoding ZER1 in cardiomyocytes can protect the heart from stress-induced hypertrophy, and overexpression of the gene encoding ZER1 has the potential to be used as a treatment strategy for cardiac hypertrophy and heart failure.
[0107] It is understood that although the inventions described in this application are in the specific forms described above, these inventions are not limited to the specific content described in these specific forms. It will be apparent to those skilled in the art that various equivalent changes can be made to the technical features contained in the inventions described herein without departing from the spirit of the inventions described herein, and all such changes should fall within the scope of the inventions.
Claims
1.Use of an expression vector or a pharmaceutical composition comprising the same in the preparation of a medicament for preventing or treating cardiac dysfunction, wherein the expression vector comprises a nucleotide sequence encoding ZER1 as set forth in SEQ ID NO: 2, which is operably linked to a myocardium-specific promoter; and the cardiac dysfunction is cardiac remodeling or heart failure. 2.Use of an expression vector or a pharmaceutical composition comprising the same in the preparation of a medicament for preventing or treating cardiac dysfunction, wherein the expression vector comprises a nucleotide sequence encoding ZER1 as set forth in SEQ ID NO: 2, which is operably linked to a myocardium-specific promoter; and the cardiac dysfunction is cardiac hypertrophy or cardiac fibrosis. 3.Use of an expression vector or a pharmaceutical composition comprising the same in the preparation of a medicament for preventing or treating cardiac dysfunction, wherein the expression vector comprises a nucleotide sequence encoding ZER1 as set forth in SEQ ID NO: 2, which is operably linked to a myocardium-specific promoter; and the cardiac dysfunction is myocardial hypertrophy or myocardial fibrosis. 4.The use according to any one of claims 1-3, wherein the expression vector is selected from any one of the following: an adeno-associated viral vector, an adenoviral vector, a retroviral vector and a lentiviral vector. 5.The use according to claim 4, wherein the adeno-associated viral vector is a serotype 9, 2, 1, 6, 8 or 5 adeno-associated viral vector. 6.The use according to claim 5, wherein the adeno-associated viral vector is a serotype 9 adeno-associated viral vector. 7.The use according to any one of claims 1-3, wherein the myocardium-specific promoter is a cardiac troponin T promoter (cTnT), a myosin heavy chain alpha promoter (aMHC) or a creatine kinase promoter (MCK). 8.The use according to claim 7, wherein the myocardium-specific promoter is a cardiac troponin T promoter (cTnT).