Molecular marker related to chicken carcass traits and meat quality traits, amplification primer pair and application

Abstract

The invention discloses a molecular marker related to chicken carcass traits and meat quality traits, an amplification primer pair and application, and belongs to the technical field of biology. The nucleotide sequence of the molecular marker is as shown in SEQ ID NO.3; sNP1 with C / T mutation exists at a basic group at the 112th site of the sequence shown in SEQ ID NO.3; sNP2 with C / T mutation exists at the 177th basic group; sNP3 with A / C mutation exists at the basic group at the 194th site; sNP4 with T / C mutation exists at the 203th basic group; sNP5 with A / G mutation exists at the 442nd basic group; sNP6 with T / A mutation exists at the basic group at the 681st site. According to the invention, a plurality of SNP loci on the PPM1K gene are found to be obviously related to chicken carcass traits and meat quality traits, a new SNP molecular marker is provided for molecular marker-assisted selection, and a scientific basis is provided for chicken breeding.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a molecular marker related to chicken carcass traits and meat quality traits, an amplification primer pair and applications. Background Art

[0002] Due to the impact of diseases like avian influenza, the sale of fresh poultry has become a mainstream market trend. Given this backdrop, poultry carcass characteristics and meat quality have become crucial factors influencing consumer spending. Effectively improving these characteristics will be beneficial for the further development of the chicken farming industry.

[0003] Single nucleotide polymorphism (SNP) refers to variations in DNA sequences caused by the insertion, deletion, inversion, and conversion of a single nucleotide within a genome. As a common form of heritable variation in animals, SNPs are widely distributed throughout the animal genome, possess stable genetic characteristics, and are easily detectable. In animal production, the use of SNPs for molecular marker-assisted selection (MAS) can overcome the limitations of traditional breeding, improving the accuracy of selection and the success of targeted traits.

[0004] Mg 2+ / Mn 2+ Mg-dependent protein phosphatase 1K gene (protein phosphatase, Mg 2+ / Mn 2+ The protein PPM1K (PPM1K) is involved in protein dephosphorylation, and the protein it encodes plays a crucial role in regulating mitochondrial function. Mitochondria are crucial for muscle and bone development. However, there are currently no reports linking the poultry PPM1K gene to chicken carcass traits or meat quality. Summary of the Invention

[0005] The present invention aims to provide molecular markers, amplification primer pairs, and applications related to chicken carcass and meat quality traits to address the aforementioned problems in the prior art. The present invention discovered multiple SNPs in the PPM1K gene that are significantly associated with chicken carcass and meat quality traits. Molecular markers based on these SNPs were developed. The molecular markers provided by the present invention can accurately identify chicken carcass and meat quality traits, thereby providing a scientific basis for chicken breeding.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a molecular marker related to chicken carcass traits and meat quality traits, the nucleotide sequence of the molecular marker is shown as SEQ ID NO.3;

[0008] In the sequence shown in SEQ ID NO.3, there is SNP1 with a C / T mutation at the 112th base; SNP2 with a C / T mutation at the 177th base; SNP3 with an A / C mutation at the 194th base; SNP4 with a T / C mutation at the 203rd base; SNP5 with an A / G mutation at the 442nd base; and SNP6 with a T / A mutation at the 681st base.

[0009] The present invention also provides a primer pair for amplifying the above molecular marker, comprising an upstream primer of the sequence shown in SEQ ID NO.1 and a downstream primer of the sequence shown in SEQ ID NO.2.

[0010] The present invention also provides a kit for identifying chicken carcass traits and meat quality traits, wherein the kit comprises the primer pair.

[0011] The present invention also provides an application of the above-mentioned primer pair or the above-mentioned kit in identifying chicken carcass traits and meat quality traits, wherein the chicken carcass traits and meat quality traits include cooking loss rate, wing weight, tibia length, slaughter rate, leg muscle weight, leg muscle a value, leg muscle rate, chest width, leg muscle b value, tibia circumference, intermuscular fat width, leg muscle L value and chest muscle b value.

[0012] The present invention also provides a method for identifying chicken carcass traits and meat quality traits, comprising the following steps:

[0013] Using the chicken genomic DNA to be tested as a template, PCR amplification is performed using the above primer pair or the above kit to obtain an amplified product; sequencing the amplified product to detect the genotype of the corresponding SNP site;

[0014] At the SNP1 locus, the cooking loss rate of individuals with CT genotype was higher than that of individuals with TT genotype;

[0015] At SNP2, the cooking loss rate of individuals with CT genotype was higher than that of individuals with TT genotype;

[0016] At SNP3, the wing weight and shin length of CC and AC genotype individuals were lower than those of AA genotype individuals; the leg muscle a value of CC and AC genotype individuals was higher than that of AA genotype individuals; the dressing percentage and leg muscle weight of AA genotype individuals were higher than those of CC genotype individuals; the leg muscle rate of AA genotype individuals was lower than that of CC genotype individuals;

[0017] At SNP4, the chest width of CC and TC genotype individuals was greater than that of TT genotype individuals; the b value of leg muscle of TT genotype individuals was greater than that of CC genotype individuals;

[0018] At SNP5, the chest width and tibia circumference of individuals with GG and AG genotypes were greater than those of individuals with AA genotypes.

[0019] At SNP6, the intermuscular fat width of individuals with AA genotype was greater than that of individuals with TT genotype; the intermuscular fat width of individuals with TA genotype was less than that of individuals with TT genotype; the tibia circumference, leg muscle weight and chest width of individuals with AA and TA genotypes were greater than those of individuals with TT genotype; the pectoral muscle b value of individuals with AA and TA genotypes was less than that of individuals with TT genotype; the leg muscle L value of individuals with AA genotype was greater than that of individuals with TT genotype.

[0020] Optionally, the reaction system for PCR amplification is: 2 μL of template DNA, 15 μL of 2x Rapid Taq Master Mix, 1.2 μL of upstream primer, 1.2 μL of downstream primer, and 10.6 μL of ddH2O.

[0021] Optionally, the reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 15 s, 34 cycles; final extension at 72°C for 5 min; and storage at 4°C.

[0022] The present invention also provides an application of the primer pair or the kit in chicken molecular marker-assisted breeding.

[0023] The present invention discloses the following technical effects:

[0024] This study, through analysis of the PPM1K gene, discovered multiple SNPs significantly associated with chicken carcass and meat quality traits. This provides new SNP molecular markers for marker-assisted selection (MAS). Experiments also verified the correlations between six SNPs and chicken carcass and meat quality traits. The molecular markers provided by this study can accurately identify chicken carcass and meat quality traits, providing a scientific basis for chicken breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0026] Figure 1The figure shows the paired positions of PCR primers on the PPM1K gene;

[0027] Figure 2 This is the genotyping diagram of 7 SNP sites;

[0028] Figure 3 This is the result of haplotype analysis. DETAILED DESCRIPTION

[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0031] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0032] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0033] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0034] Example 1

[0035] 1. Materials and Methods

[0036] 1.1 Animal samples

[0037] A total of 325 49-day-old small white broilers, slow-growing yellow broilers, and fast-growing large white broilers were selected. 2 mL of subcutaneous venous blood was collected and stored at -80°C for DNA extraction. Traits such as breast angle, breast depth, breast width, live weight, shank length, shank circumference, body oblique length, keel length, crown height, carcass weight, subcutaneous fat thickness, intermuscular fat width, half-eviscerated weight, full-length weight, abdominal fat weight, wing weight, breast muscle weight, leg muscle weight, foot weight, breast muscle shear force, leg muscle shear force, drip loss rate, cooking loss rate, breast muscle pH value, leg muscle pH value, breast muscle L value, breast muscle a value, breast muscle b value, leg muscle L value, leg muscle a value, leg muscle b value, slaughter rate, half-eviscerated rate, full-length rate, abdominal fat percentage, breast muscle percentage, and leg muscle percentage were recorded.

[0038] 1.2 Main Reagents

[0039] Blood sample DNA extraction kit (brand: OMEGA; product number: D3392; Guangzhou Feiyang Bioengineering Co., Ltd.), 2xRapid Taq Master Mix (Dye) (brand: Novozymes; product number: P222-01; Nanjing Novozymes Biotechnology Co., Ltd.), DNA marker (brand: Quanshijin; product number: BM101-01; Beijing Quanshijin Biotechnology Co., Ltd.), high-purity low-electrosmotic agarose (brand: Qingke; product number: TSJ001; Beijing Qingke Biotechnology Co., Ltd.).

[0040] 1.3 Experimental methods

[0041] 1.3.1 Primer design

[0042] Primers were designed using PrimerPremier 5 based on the sequence of the PPM1K gene of red junglefowl (Gallus) published by NCBI (National Center for Biotechnology Information Search database) (NC_052535.1). Primer synthesis services were provided by Guangzhou Qingke Biotechnology Co., Ltd. The primer sequence information is shown in Table 1. The primer pairing positions on the PPM1K gene are shown in Table 1. Figure 1 shown.

[0043] Table 1 PCR amplification primer sequences

[0044]

[0045] 1.3.2 Blood DNA extraction

[0046] Extract blood DNA according to the operating manual of the blood DNA extraction kit.

[0047] 1.3.3 PCR amplification of partial sequences of the PPM1K gene

[0048] The genomic DNA of the 325 chicken blood samples was used as a template, and the following reaction system was used: 2 μL template DNA, 15 μL 2xRapidTaq Master Mix, 1.2 μL upstream primer, 1.2 μL downstream primer, and 10.6 μL ddH2O.

[0049] The reaction procedure was as follows: initial denaturation at 95°C for 3 min; 34 cycles of denaturation at 95°C for 15 s, annealing at 58°C for 15 s, and extension at 72°C for 15 s; a final extension at 72°C for 5 min; and storage at 4°C. PCR products were submitted to Guangzhou Qingke Biotechnology Co., Ltd. for Sanger sequencing.

[0050] 1.3.4 SNP identification and genotyping

[0051] The Sanger sequencing results of the PCR products were analyzed using SnapGene software to determine the potential SNP sites. The sequencing data of each sample were then compared using this tool for genotyping.

[0052] 1.3.5 Association analysis between genotype and carcass traits

[0053] The association analysis between SNP sites and carcass trait data of individuals corresponding to genotypes was performed using SPSS27.0.

[0054] 2. Results

[0055] 2.1 PCR amplification of PPM1K gene sequence and SNP screening

[0056] The above 325 chickens were selected, and PCR amplification was performed using the blood sample DNA of each individual as a template. The obtained PCR products (nucleotide sequences are shown in SEQ ID NO. 3) were subjected to Sanger sequencing. The peak plots after sequencing were compared and analyzed. A total of 7 SNP sites were detected, namely: NC_052535.1: g.46584259C>T; NC_052535.1: g.46584324C>T; NC_052535.1: g.46584341A>C; NC_052535.1: g.46584350T>C; NC_052535.1: g.46584497G>A; NC_052535.1: g.46584589A>G; NC_052535.1: g.46584828T>A; located in SEQ ID NO. No. 3, positions 112, 177, 194, 203, 350, 442, and 681; Figure 2 shown.

[0057] SEQ ID NO. 3:

[0058] TGCGACTTCATCAACCAGTGCCACGATCCTGCTGAAGCTGCCCACGTTGTTACTGAGCAGGTAATGCTAGGGTTTCTTGAAGCATCAAAATGCCAGATCCTTGCAAGGACA C AGGGCCGTCATTTCAATTAATGTGCTTAGTTCTTGGTCCACAGAACTGCTGAGAATGTCATCAG C GTAGGCAGAAACCATC A GTTTCTCA T TGAAGGTTTTTGACAGTGGTATATCCCATGGAAAGCTCTGAAGCATGCAAGAGCCTGCAGTGTTGGAGCTGGGAGGAAGCAAAGAAGTCTCAGATCATGCTGTCCTATGTGGAGTTAGACAGTTGTTTCCCTTTCTGAGCAGGACC G TGATGCTGACAATTTATTTCTTCCTTCAGGCAATGCAGTACGGCACTGAAGATAATAGCACGGTTGTCATAGTGCCATTTGGAGCATGGGG A AAGTATAAAAATGGTGAGATCAACTTCTCCTTCAGCCGCAGTTTTGCCTCCAGTGGGAGGTGGGCGTGAAGACCTGACACAGCTATCTTTTCCTGCAATAACCTGGATACAACGTGCTATAAGAGAACACAGCCATCTGTTCATAGGTTGACTCAGTGTCTTGTCCATCTCTTCTGTTGCCAGTTATGGAAGATGCAACTGCTCCTGTGGTGCGTAATTGCTGCTTACAGCTGATCGT T TTTTAGTGTTTATTTATTCAGATCAGCACTGGGTTTCCAGTCCCAGCAGCTCCGCACACCATTTCATTTGCACAGACAAGTCTCTGGGCTTGAGCTATGACACATTGGTTTCATCCCAACTCTTGTTACCTAGCACTTAGTTACCTGGCAGCTGTGAAAGTCCGAGA.

[0059] 2.2 Association analysis between PPM1K gene sequence SNPs and carcass traits

[0060] An association analysis was performed on the above 7 SNP sites and traits (chest angle, chest depth, chest width, live weight, shank length, shank circumference, body oblique length, keel length, crown height, carcass weight, subcutaneous fat thickness, intermuscular fat width, half-eviscerated weight, full-chest weight, abdominal fat weight, wing weight, breast muscle weight, leg muscle weight, chicken foot weight, breast muscle shear force, leg muscle shear force, drip loss rate, cooking loss rate, breast muscle pH value, leg muscle pH value, breast muscle L value, breast muscle a value, breast muscle b value, leg muscle L value, leg muscle a value, leg muscle b value, slaughter rate, half-eviscerated rate, full-chest rate, abdominal fat rate, breast muscle rate, and leg muscle rate).

[0061] As shown in Table 2, the results showed that the molecular marker NC_052535.1:g.46584259C>T site was significantly correlated with the cooking loss rate (p<0.05), among which the cooking loss rate of individuals with the CT heterozygous genotype was significantly higher than that of individuals with the TT mutation homozygous genotype (p<0.05).

[0062] As shown in Table 3, the results showed that the molecular marker NC_052535.1:g.46584324C>T site was significantly correlated with the cooking loss rate (p<0.05), among which the cooking loss rate of individuals with the CT heterozygous genotype was significantly higher than that of individuals with the TT mutation homozygous genotype (p<0.05).

[0063] Further analysis revealed that the NC_052535.1:g.46584259C>T locus and the NC_052535.1:g.46584259C>T locus were completely linked ( Figure 3 ), the genotype of the two loci is the same in every individual in the population.

[0064] As shown in Table 4, the results showed that the molecular marker NC_052535.1:g.46584341A>C locus was significantly associated with wing weight, shank length, dressing percentage, leg muscle weight, leg muscle a value, and leg muscle ratio (p < 0.05). Wing weight and shank length were significantly lower in individuals homozygous for the CC mutation and those heterozygous for the AC mutation than in individuals homozygous for the AA wild-type genotype (p < 0.05), but no significant difference was found between CC and AC (p > 0.05). Leg muscle a value was significantly higher in individuals homozygous for the CC mutation and those heterozygous for the AC mutation than in individuals homozygous for the AA wild-type genotype (p < 0.05), but no significant difference was found between CC and AC (p > 0.05). Dressing percentage and leg muscle weight were significantly higher in individuals homozygous for the AA wild-type genotype than in individuals homozygous for the CC mutation (p < 0.05). Leg muscle ratio was significantly lower in individuals homozygous for the AA wild-type genotype than in individuals homozygous for the CC mutation (p < 0.05).

[0065] As shown in Table 5, the results showed that the molecular marker NC_052535.1:g.46584350T>C locus was significantly associated with chest width and leg muscle b-value (p < 0.05). Individuals homozygous for the CC mutation and those heterozygous for the TC genotype had significantly greater chest width than those homozygous for the TT wild-type genotype, while no significant difference was found between TC and CC (p > 0.05). Individuals homozygous for the TT wild-type genotype had significantly greater leg muscle b-value than those homozygous for the CC mutation (p < 0.05).

[0066] As shown in Table 6, the results showed that the molecular marker NC_052535.1:g.46584589A>G locus was significantly associated with chest width and tibia circumference (p<0.05). The chest width and tibia circumference of individuals with the GG mutation homozygous genotype and the AG heterozygous genotype were significantly higher than those of individuals with the AA wild-type homozygous genotype, while there was no significant difference between AG and GG (p>0.05).

[0067] As shown in Table 7, the results showed that the molecular marker NC_052535.1:g.46584828T>A locus was significantly associated with chest width, tibial circumference, intermuscular fat width, leg muscle L value, leg muscle weight, and pectoral muscle b value (p < 0.05). Individuals homozygous for the AA mutation had significantly greater intermuscular fat width than those homozygous for the TT wild-type genotype (p < 0.05), while individuals heterozygous for the TA genotype had significantly less intermuscular fat width than those homozygous for the TT wild-type genotype (p < 0.05). Individuals homozygous for the AA mutation and TA had significantly greater tibial circumference, leg muscle weight, and chest width than those homozygous for the TT wild-type genotype (p < 0.05), while no significant differences were found between AA and TA (p > 0.05). Individuals homozygous for the AA mutation and TA had significantly lower pectoral muscle b values ​​than those homozygous for the TT wild-type genotype (p < 0.05). The leg muscle L value of the AA mutation homozygous genotype individuals was significantly higher than that of the TT wild homozygous genotype individuals (p<0.05).

[0068] Except for the above 6 SNP sites, the correlation between NC_052535.1:g.46584497G>A site and carcass traits did not reach a significant level (p>0.05).

[0069] Table 2 Association between NC_052535.1:g.46584259C>T locus and meat quality traits

[0070]

[0071] Table 3 Association between NC_052535.1:g.46584324C>T locus and meat quality traits

[0072]

[0073] Table 4 Association of NC_052535.1:g.46584341A>C locus with carcass and meat quality traits

[0074]

[0075] Table 5 Association of NC_052535.1:g.46584350T>C locus with carcass and meat quality traits

[0076]

[0077]

[0078] Table 6 Association between NC_052535.1:g.46584589A>G locus and carcass traits

[0079]

[0080] Table 7 Association of NC_052535.1:g.46584828T>A locus with carcass and meat quality traits

[0081]

[0082] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A molecular marker associated with chicken carcass traits and meat quality traits, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.3; In the sequence shown in SEQ ID NO.3, there is SNP1 with a C / T mutation at the 112th base; SNP2 with a C / T mutation at the 177th base; SNP3 with an A / C mutation at the 194th base; SNP4 with a T / C mutation at the 203rd base; SNP5 with an A / G mutation at the 442nd base; and SNP6 with a T / A mutation at the 681st base.

2. A primer pair for amplifying the molecular marker according to claim 1, characterized in that: It includes an upstream primer with a sequence as shown in SEQ ID NO.1 and a downstream primer with a sequence as shown in SEQ ID NO.

2.

3. A kit for identifying chicken carcass traits and meat quality traits, characterized in that: The kit comprises the primer pair according to claim 2.

4. Use of the primer pair according to claim 2 or the kit according to claim 3 in identifying chicken carcass traits and meat quality traits, characterized in that: The chicken carcass traits and meat quality traits include cooking loss rate, wing weight, shank length, slaughter rate, leg muscle weight, leg muscle a value, leg muscle rate, chest width, leg muscle b value, shank circumference, intermuscular fat width, leg muscle L value and breast muscle b value.

5. A method for identifying chicken carcass traits and meat quality traits, characterized in that: The following steps are involved: Using the chicken genomic DNA to be tested as a template, PCR amplification is performed using the primer pair of claim 2 or the kit of claim 3 to obtain an amplified product; sequencing the amplified product to detect the genotype of the corresponding SNP site; At the SNP1 locus, the cooking loss rate of individuals with CT genotype was higher than that of individuals with TT genotype; At SNP2, the cooking loss rate of individuals with CT genotype was higher than that of individuals with TT genotype; At SNP3, the wing weight and shin length of CC and AC genotype individuals were lower than those of AA genotype individuals; the leg muscle a value of CC and AC genotype individuals was higher than that of AA genotype individuals; the dressing percentage and leg muscle weight of AA genotype individuals were higher than those of CC genotype individuals; the leg muscle rate of AA genotype individuals was lower than that of CC genotype individuals; At SNP4, the chest width of CC and TC genotype individuals was greater than that of TT genotype individuals; the b value of leg muscle of TT genotype individuals was greater than that of CC genotype individuals; At SNP5, the chest width and tibia circumference of individuals with GG and AG genotypes were greater than those of individuals with AA genotypes. At SNP6, the intermuscular fat width of individuals with AA genotype was greater than that of individuals with TT genotype; the intermuscular fat width of individuals with TA genotype was less than that of individuals with TT genotype; the tibia circumference, leg muscle weight, and chest width of individuals with AA and TA genotypes were greater than those of individuals with TT genotype; the pectoral muscle b-values ​​of individuals with AA and TA genotypes were less than those of individuals with TT genotype; the leg muscle L-value of individuals with AA genotype was greater than that of individuals with TT genotype.

6. The method according to claim 5, characterized in that The PCR amplification reaction system was as follows: 2 μL of template DNA, 15 μL of 2x RapidTaq Master Mix, 1.2 μL of upstream primer, 1.2 μL of downstream primer, and 10.6 μL of ddH2O.

7. The method according to claim 5, characterized in that The PCR amplification reaction procedure was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 58°C for 15 s, and extension at 72°C for 15 s, for 34 cycles; final extension at 72°C for 5 min; and storage at 4°C.

8. Use of the primer pair according to claim 2 or the kit according to claim 3 in chicken molecular marker-assisted breeding.

Images