A molecular marker primer combination for identifying large fragment deletion of cdS-Rnase gene of vietnamese camellia oleifera and application thereof
By designing CvS-RNase-1 primer combinations and PCR amplification methods, the deletion of the CdS-RNase gene in Camellia oleifera var. chinensis was identified, which solved the problem of self-incompatibility, improved the self-pollination fruit setting rate, and optimized the germplasm resource matching.
Patent Information
- Application Number
- CN202511281595.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-09
- Publication Date
- 2025-12-23
- Estimated Expiration
- 2045-09-09
AI Technical Summary
Vietnamese Camellia oleifera suffers from self-incompatibility, resulting in flowering but no fruit set and a low fruit set rate. Existing technologies make it difficult to effectively identify and utilize large-fragment deletion mutants of the CdS-RNase gene.
A specific molecular marker primer combination, CvS-Rnase-1, was designed to identify a 508bp deletion in the CdS-RNase gene of Camellia oleifera in Vietnam. CdSm2-RNase mutants were rapidly screened through PCR amplification, agarose gel electrophoresis, and sequencing verification, combined with self-pollination experiments.
This method enables rapid screening of CdSm2-RNase mutants, improves the self-pollination fruit set rate of Camellia oleifera in Vietnam, guides the optimal matching of germplasm resources, and improves the current situation of low self-pollination fruit set rate.
Smart Images

Figure CN120758672B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of molecular markers, and relates to a molecular marker primer combination for identifying a large fragment deletion of a CdS-RNase gene of Camellia vietnamensis and application thereof. BACKGROUND
[0002] Camellia vietnamensis has strict self-incompatibility characteristics, that is, after the pistil of a plant recognizes the same genotype of pollen, the pollen cannot normally germinate, the pollen tube cannot pass through the stigma, or the pollen tube can pass through the stigma but cannot normally grow and enter the ovule to form complete fertilization, resulting in the phenomenon of flowers but no fruits, low fruit setting rate and low yield in Camellia vietnamensis production. The S locus pistil determinant gene controlling the self-incompatibility of Camellia vietnamensis has been identified. Cds-RNase The deletion mutation of the S gene is divided into amino acid translation errors caused by cDNA single base deletion, single amino acid deletion mutation and large fragment deletion mutation, and these mutations can cause the inactivation of S protein, so that the function of the S gene is lost. When the S gene is abnormal, it may cause the self-incompatibility to change to self-compatibility. CdS-RNase The large fragment deletion of the S gene is an important mutant of the S gene, which is beneficial to improve the self-pollination fruit setting rate and cross-pollination fruit setting rate of Camellia vietnamensis germplasm, and is helpful to understand the mating compatibility between individuals of Camellia vietnamensis. CdS m2 -RNase The large fragment deletion of the S gene is an important mutant of the S gene, which is beneficial to improve the self-pollination fruit setting rate and cross-pollination fruit setting rate of Camellia vietnamensis germplasm, and is helpful to understand the mating compatibility between individuals of Camellia vietnamensis. Cds-RNase SUMMARY
[0003] The application obtains the mutant with a deletion of 508 bp by comparing and analyzing the nucleotide sequences of the pistil of Camellia vietnamensis containing the S gene and the pistil of Camellia vietnamensis containing the S gene. CdS-RNase The nucleotide sequence of the large fragment deletion region is shown as SEQ ID NO. 1, and the primer is designed according to the deleted nucleotide sequence. CdS m2 -RNase The nucleotide sequence of the large fragment deletion region is shown as SEQ ID NO. 1, and the primer is designed according to the deleted nucleotide sequence. CdS-RNase The application provides, in one aspect, a molecular marker primer combination for identifying whether Camellia vietnamensis is self-compatible or not, and the primer is named CvS-Rnase-1, and the nucleotide sequence of the primer is as follows.
[0004] Forward primer (5'-3'): CAATGCCTAGCAGTTCTC;
[0005] Reverse primer (5'-3'): ATAGTCGATGAATGATGGTT.
[0006] Reverse primer (5'-3'): ATAGTCGATGAATGATGGTT.
[0007] The application provides, in one aspect, a molecular marker primer combination for identifying whether Camellia vietnamensis is self-compatible or not, and the primer is named CvS-Rnase-1, and the nucleotide sequence of the primer is as follows.
[0008] Further, the application approach is to identify the self-compatibility of Camellia vietnamensis by CdS-RNase the nucleotide sequence of the deletion fragment is shown as SEQ ID NO. 1, the nucleotide sequence of the gene is shown as SEQ ID NO. 2. Cds-RNase the nucleotide sequence of the deletion fragment is shown as SEQ ID NO. 1, the nucleotide sequence of the gene is shown as SEQ ID NO. 2.
[0009] The third aspect of the present application provides a method for identifying the self-compatibility of Camellia vietnamensis, comprising the following steps:
[0010] (1) Extracting cDNA of the sample to be analyzed: extracting RNA of the Camellia vietnamensis pistil (pistil) to be tested and reverse transcribing into cDNA;
[0011] (2) PCR amplification reaction: performing PCR amplification reaction on the cDNA extracted in (1) by using the above primer combination;
[0012] The reaction system of the PCR amplification of step (2) is 20 μL: 2xPhanta Max MasterMix (high-fidelity enzyme) 10 μL, 10 μM concentration of forward and reverse primers each 0.5 μL, cDNA template 1 μL, and ddH2O to make up the total volume of 20 μL; the reaction program of the PCR amplification of step (2) is 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 53°C annealing for 15 s, 72°C extension for 3 s, 35 cycles; and finally 72°C extension for 5 min.
[0013] (3) The product of step (2) is subjected to agarose gel detection and gel cutting recovery by using a PCR recovery kit, and the recovered product is connected to a blunt-end sequencing vector;
[0014] The agarose gel in step (3) refers to electrophoresis on a 0.8%-1.2% agarose gel (containing 8% Goldv-iew nucleic acid dye) at a voltage of 120V in a 0.5xTBE buffer for 30 min.
[0015] (4) The connection product is introduced into E. coli competent cells and coated in solid LB medium containing 50ug / mL Kan antibiotic, and incubated at 37°C overnight;
[0016] (5) 10 colonies are picked and added into 1 mL liquid LB medium containing Kan antibiotic, and incubated at 37°C, 200 r / min for 2 h, and colony PCR verification is performed;
[0017] (6) Selecting positive clones for Sanger first-generation routine sequencing;
[0018] (7) Result determination: when the sample of Camellia vietnamensis to be analyzed isCds-RNase The gene has a 508 bp deletion fragment, and the sample has high self-compatibility and high self-pollination rate. Cds-RNase The nucleotide sequence of the gene is shown as SEQ ID NO. 2, and the nucleotide sequence of the deletion fragment is shown as SEQ ID NO. 1.
[0019] The fourth aspect of the present application provides a self-pollination rate verification experiment scheme of Vietnamese camellia oleifera with large fragment deletion of the gene. CdS-RNase The fourth aspect of the present application provides a self-pollination rate verification experiment scheme of Vietnamese camellia oleifera with large fragment deletion of the gene.
[0020] (1) Self-pollination:
[0021] The self-pollination work of camellia oleifera is carried out on sunny days, and 10 plants containing normal CdS-RNase genes and 10 plants containing CdS m2 -RNase Vietnamese camellia oleifera individuals, 50 flower buds are selected in each Vietnamese camellia oleifera, and the bag is taken out to make self-pollination pollen fall on the self-pollination stigma after the next day, and then the bag is re-packed.
[0022] (2) Self-pollination rate detection:
[0023] The bag is taken out one month after pollination, and the fruit setting rate is counted.
[0024] Advantages of the present application:
[0025] The present application is based on a newly discovered Vietnamese camellia oleifera containing a 508 bp large fragment deletion CdS m2 -RNase mutation type, and a primer pair is reasonably designed, and on the basis of optimizing the PCR system and amplification conditions, a detection method for rapidly detecting the mutation type is formed, and examples are used to show the actual effect of the method in detecting Vietnamese camellia oleifera containing a 508 bp large fragment deletion CdS m2 -RNase mutation type. CdS m2 -RNase The present application can quickly screen Vietnamese camellia oleifera germplasm resources containing CdS m2 -RNase mutation type, improve the self-pollination rate of Vietnamese camellia oleifera, and has a positive significance for guiding the matching of different CdS-RNase genotypes of Vietnamese camellia oleifera parents in the field and improving the low self-pollination rate of Vietnamese camellia oleifera. BRIEF DESCRIPTION OF DRAWINGS
[0026] Figure 1 The CdS-RNase gene and CdS m2-RNase Agarose gel of full-length PCR amplification of CDS of the gene;
[0027] Figure 2 For CdS-RNase the gene and CdS m2 -RNase Sequence alignment results of partial sequences amplified by primer CvS-Rnase-1 in 20 Camellia vietnamensis plants.
[0028] Figure 3 Sequence alignment results of partial sequences amplified by primer CvS-Rnase-1 in 20 Camellia vietnamensis plants. DETAILED DESCRIPTION
[0029] The specific embodiments of the present application are described below to enable those skilled in the art to understand the present application, but it should be clear that the present application is not limited to the scope of the specific embodiments, and that all the applications utilizing the concept of the present application are within the scope of the present application as long as various changes are obvious to those skilled in the art within the spirit and scope of the present application as defined and determined by the appended claims.
[0030] Explanation of sequences SEQ ID NO. 1 and SEQ ID NO. 2:
[0031] SEQ ID NO. 1 (CDS of the gene) CdS-RNase Gene 508 bp deletion fragment:
[0032] agtggccaggatcatactgtgacacaaggcaaagttgctgctatccaaagactggaaagcctgcagaagatttcggcattcatgggctttggcctaattataacgacggcacttacccatccagctgcgatagccgcaactcttttgatgactctgagatctcagacctcgccagtagattggaaaaagactggccaacactagcatgcccaagtggggatgggttgaagttctggggacatgaatggaataaacatgggacttgtgctgagtctgtctttgaccagcacagctacttccaaactgctcttgacctcaagagcaaagccaaccttcttcaagccctcaccactgcaggtattcgaccaaatgggaagttttaccacttagagagcatcaaagaagccattagagaaactgttggagtcaccccctacattgagtgcaatgtggatacatcaggcaaccaccagctctaccaggtttacatgtgcgtcgactcttctgg
[0033] SEQ ID NO. 2 (CDS sequence of gene C): CdS-RNase
[0034] ATGATGCCAAACCCTTCAATCTTGATCAAGCTTTTGGTGGTGCAATGCCTAGCAGTTCTCTGTGTTGCTAAGGATTTTGATTTCTTTTACTTTGTTCAACAGTGGCCAGGATCATACTGTGACACAAGGCAAAGTTGCTGCTATCCAAAGACTGGAAAGCCTGCAGAAGATTTCGGCATTCATGGGCTTTGGCCTAATTATAACGACGGCACTTACCCATCCAGCTGCGATAGCCGCAACTCTTTTGATGACTCTGAGATCTCAGACCTCGCCAGTAGATTGGAAAAAGACTGGCCAACACTAGCATGCCCAAGTGGGGATGGGTTGAAGTTCTGGGGACATGAATGGAATAAACATGGGACTTGTGCTGAGTCTGTCTTTGACCAGCACAGCTACTTCCAAACTGCTCTTGACCTCAAGAGCAAAGCCAACCTTCTTCAAGCCCTCACCACTGCAGGTATTCGACCAAATGGGAAGTTTTACCACTTAGAGAGCATCAAAGAAGCCATTAGAGAAACTGTTGGAGTCACCCCCTACATTGAGTGCAATGTGGATACATCAGGCAACCACCAGCTCTACCAGGTTTACATGTGCGTCGACTCTTCTGGGTCCAACTTCATCAAATGCCCAGTTCTACCCCATAGTCACCCTTGCGGCTCTAAAATCGAATTCCCTTCCTTCTCAGATCACTCAAACTCGAAGAATGATGAACTCTGA
[0035] Example 1 CdS-RNase Development of primers for amplification of the 508 bp deletion fragment of the gene
[0036] Extraction of RNA from normal CdS-RNase Gene Vietnamese Camellia oleifera and from Vietnamese Camellia oleifera containing CdS m2 -RNase RNA from Vietnamese Camellia oleifera pistil was reverse transcribed into cDNA and amplified with the previously identified primers for CvS-RNase-2 CdS-RNase Gene and CdS m2 -RNaseThe CDS full length of the gene, the primer sequence is: forward primer (SEQ ID NO. 3): 5'-TCCGAACACTGCGTTTGCTG-3'; reverse primer (SEQ ID NO. 4): 5'-ACAACTAAATCGCCCACGCATA-3'.
[0037] The reaction system of PCR amplification is 20 μL: 2xPhanta Max MasterMix (high-fidelity enzyme) 10 μL, 10 μM concentration of forward and reverse primers 0.5 μL each, cDNA template 1 μL, and ddH2O to make up the total volume to 20 μL.
[0038] The reaction program of PCR amplification is: 95°C pre-denaturation 3 min; 95°C denaturation 15 s, 53°C annealing 15 s, 72°C extension 3 s, 35 cycles; finally 72°C extension 5 min.
[0039] The PCR product is electrophoresed on a 0.8%-1.2% agarose gel (containing 8% Goldview nucleic acid dye) in 0.5xTBE buffer at 120V for 30 min. The running gel result is photographed in the gel imaging system (attached Figure 1 ).
[0040] The PCR amplification product is detected by agarose gel and recovered by a PCR recovery kit, introduced into E. coli competent cells, and coated on solid LB medium containing 50ug / mL Kan antibiotic, and cultured at 37°C overnight.
[0041] Ten colonies are picked and added to 1 mL of liquid LB medium containing Kan antibiotic, and cultured at 37°C, 200 r / min for 2 h, and subjected to colony PCR verification.
[0042] The positive clones are selected for Sanger first-generation routine sequencing (attached Figure 2 ). The CdS m2 -RNase The 508bp nucleotide sequence of the deletion of the gene; according to the obtained deletion large fragment nucleotide sequence, a primer is designed, and the primer is named CvS-Rnase-1, and the primer sequence is:
[0043] Forward primer (SEQ ID NO. 5): 5'-CAATGCCTAGCAGTTCTC-3';
[0044] Reverse primer (SEQ ID NO. 6): 5'-ATAGTCGATGAATGATGGTT-3'.
[0045] Example 2:CdS-RNase Detection of 508 bp deletion fragment of gene
[0046] Experimental procedure:
[0047] (1) 20 strains of Camellia vietnamensis stigmas were selected as experimental materials;
[0048] (2) cDNA of the sample was extracted and analyzed: total RNA of the above experimental sample was extracted by CTAB method, and cDNA was formed by reverse transcription kit;
[0049] (3) PCR amplification reaction: the extracted cDNA of Camellia vietnamensis stigma was used as amplification template, and CvS-Rnase-1 developed in Example 1 was used as amplification primer for PCR amplification. The PCR reaction system was 20 μL: 2x Phanta Max MasterMix (high-fidelity enzyme) 10 μL, 10 μM concentration of forward and reverse primers 0.5 μL each, cDNA template 1 μL, and ddH2O was added to a total volume of 20 μL. The reaction program of PCR amplification was: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 53°C annealing for 15 s, 72°C extension for 3 s, 35 cycles; finally 72°C extension for 5 min;
[0050] (4) PCR amplification product detection: the PCR amplification product was detected by agarose gel and cut by gel recovery kit, and was introduced into E. coli competent cells and coated on solid LB medium containing 50 ug / mL Kan antibiotic, and was cultured at 37°C for overnight.
[0051] 10 colonies were selected and added to 1 mL of liquid LB medium containing Kan antibiotic, and were cultured at 37°C, 200 r / min for 2 h, and colony PCR verification was performed.
[0052] Positive clones were selected for Sanger first-generation routine sequencing (attached Figure 3 ).
[0053] Example 3: CdS-RNase Correlation analysis of 508 bp deletion fragment of gene and self-incompatibility
[0054] (1) Self-pollination:
[0055] Camellia oleifera self-pollination was carried out on sunny days, and 10 strains of Camellia oleifera containing normal CdS-RNase gene and containing CdS m2 -RNase Camellia oleifera individuals, and 50 flower buds were selected from each Camellia oleifera and were bagged, and the bag was removed the next day to allow self-pollen to fall on the self-stigma, and the bag was re-bagged.
[0056] (2) Self-pollination fruit setting rate detection:
[0057] After one month of pollination, the bag was removed, and the fruit setting rate was counted. The results are shown in Table 1.
[0058] Table 1 Self-pollination fruit setting rate
[0059]
[0060] The primers of the application can quickly identify normal CdS-RNase genes and genes containing CdS m2 -RNase The self-pollination fruit setting rates of the Vietnamese camellia oleifera individuals were 1.4%±0.0164 and 10.2%±0.0147, respectively, indicating that the plant individuals identified by the application can indirectly improve the self-pollination fruit setting rate of camellia oleifera.
[0061] The above specific embodiments further illustrate the purpose, technical solutions and beneficial effects of the application. It should be understood that the above description is only a specific embodiment of the application and is not intended to limit the protection scope of the application. Any modification, equivalent replacement, improvement, etc. within the spirit and principles of the application should be included in the protection scope of the application.
Claims
1. The application of a molecular marker primer combination in identifying the self-compatibility of Camellia oleifera in Vietnam, characterized in that, The nucleotide sequence of the molecular marker primer combination is shown below: Forward primer: 5'-CAATGCCTAGCAGTTCTC-3'; Reverse primer: 5'-ATAGTCGATGAATGATGGTT-3'; The molecular marker is Cds-RNase A 508 bp deletion fragment of the gene, the nucleotide sequence of which is shown in SEQ ID NO.
1. Cds-RNase The nucleotide sequence of the gene is shown in SEQ ID NO.2; The Vietnamese camellia oil sample to be analyzed Cds-RNase The gene has a 508bp deletion segment. This sample has high self-compatibility and high self-fertility.
2. A method for determining whether Vietnamese Camellia oleifera is self-compatible, characterized in that, Includes the following steps: (1) Extracting cDNA from the Vietnamese Camellia oleifera sample to be analyzed: RNA was extracted from the flower style of the Vietnamese Camellia oleifera to be tested and reverse transcribed into cDNA; (2) PCR amplification reaction: The extracted cDNA was amplified by PCR using the molecular marker primer combination described in claim 1; (3) The product from step (2) was subjected to agarose gel electrophoresis and then excised using a PCR recovery kit. The recovered product was then ligated into a blunt-end sequencing vector. (4) The ligation product was introduced into competent E. coli cells and spread on solid LB medium containing 50 μg / mL Kan antibiotic and incubated overnight at 37°C with the cells inverted. (5) Pick 10 colonies, add 1 mL of liquid LB medium containing Kan antibiotic, and incubate at 37°C with shaking at 200 r / min for 2 h, and perform colony PCR verification. (6) Five positive clones were selected for Sanger first-generation sequencing. (7) Result determination: When the Vietnamese camellia oil sample to be analyzed... Cds-RNase The gene contained a 508bp deletion. This sample exhibited high self-compatibility and a high self-pollination fruit set rate. Cds-RNase The nucleotide sequence of the gene is shown in SEQ ID NO.2, and the nucleotide sequence of the deleted fragment is shown in SEQ ID NO.
1.
3. The method according to claim 2, characterized in that, In step (2), the PCR amplification reaction system is 20 μL: 10 μL of 2×Phanta Max MasterMix, 0.5 μL each of 10 μM forward and reverse primers, 1 μL of cDNA template, and ddH2O to bring the total volume to 20 μL; the PCR amplification reaction program is: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 53℃ annealing for 15 s, 72℃ extension for 3 s, 35 cycles; and finally 72℃ extension for 5 min.
4. The method according to claim 2, characterized in that, In step (3), the agarose gel electrophoresis is performed on a 0.8%-1.2% agarose gel containing 8% Goldview nucleic acid dye, and the electrophoresis is carried out in 0.5×TBE buffer at 120V for 30 minutes.
Citation Information
Patent Citations
Method for identifying self-incompatible female determinant S gene of camellia oleifera and matched kit
CN116144821A
Detection method for insertion mutation of self-incompatible pistil determinant CdS-RNase gene of Vietnam camellia oleifera
CN118652916A