Composition for promoting decomposition of protein aggregates, and pharmaceutical composition for preventing or treating neurodegenerative diseases associated with formation of protein aggregates

Abstract

The technical problem of the present disclosure is to provide: a composition for promoting the decomposition of protein aggregates; and a pharmaceutical composition for preventing or treating neurodegenerative diseases associated with the formation of protein aggregates. The technical problem is solved by a compound represented by general formula (I).

Description

TECHNICAL FIELD

[0001] The present application relates to a composition for promoting decomposition of a protein aggregate, a pharmaceutical composition for preventing or treating a neurodegenerative disease accompanied by formation of a protein aggregate, and a novel compound or a salt thereof and a method for producing the same. BACKGROUND

[0002] Neurodegenerative diseases typified by Alzheimer's disease and Parkinson's disease are diseases in which nerve cells are gradually destroyed. In the nerve cells that are degenerated, accumulation of aggregates of proteins is generally observed pathologically. Such aggregates of proteins are not observed in brain regions other than the lesion. This suggests that the formation of aggregates of proteins is one of the causes of neurodegenerative diseases, and that a therapeutic drug for neurodegenerative diseases in general can be developed by inhibiting the accumulation of aggregates of proteins.

[0003] In diseases such as Alzheimer's disease (AD), a part of frontotemporal lobar degeneration (FTLD), progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), and the like, accumulation of aggregates of hyperphosphorylated Tau protein is pathologically confirmed, and is collectively referred to as a Tauopathy. On the other hand, in diseases such as Parkinson's disease (PD), multiple sclerosis (MS), dementia with Lewy bodies (DLB), rapid eye movement sleep behavior disorder (RBD), and the like, alpha synuclein forms aggregates, and is collectively referred to as a synucleinopathy. In addition, TDP-43, which is considered to be the cause of frontotemporal lobar degeneration (FTLD), amyotrophic lateral sclerosis (ALS), and the like, and prion protein (PrP), which is the cause of Creutzfeldt-Jakob disease (CJD), bovine spongiform encephalopathy (BSE), also form intracellular aggregates of diseases. These diseases have in common that, as the disease progresses, the degenerative protein that forms aggregates becomes a template, converts normal proteins into a degenerative form, thereby propagating aggregates between cells, and thereby expanding the lesion area of the disease.

[0004] The protein aggregate is decomposed in the lysosome by aggregate-selective autophagy. The process of recognizing the aggregate and transporting it to the lysosome is particularly called aggregate autophagy. In the aggregate, polyubiquitin chain is attached, and the autophagy receptor recognizes the polyubiquitin chain, whereby the aggregate is enclosed in the autophagosome (refer to Figure 9 ). The present inventors et al. reported that phosphorylation of the serine residue at position 403 (S403) of the most ubiquitous p62 / SQSTM1 protein in the autophagy receptor, thereby binding to the polyubiquitin chain with high affinity, promotes the efficiency of engulfment by the autophagosome (Non-patent Literatures 1, 2).

[0005] Prior Art Documents

[0006] Non-patent Literatures

[0007] Non-patent Literature 1: Matsumoto, G., et al., (2011) Serine 403 phosphorylation of p62 regulates selective autophagic clearance of ubiquitinated protein. Mol. Cell 44, 279-289

[0008] Non-patent Literature 2: Matsumoto, G., et al., (2015) TBK1 controls autophagic engulfment of Parkin-recruited depolarized mitochondria through p62 phosphorylation. Hum Mol Genet, 24, 4429-4442 SUMMARY

[0009] (1) Technical Problem to be Solved

[0010] The technical problem of the present application is to provide a compound that promotes phosphorylation of the serine at position 403 of human p62 / SQSTM1 shown in SEQ ID NO: 1, promotes decomposition of a protein aggregate, and to provide a medicament for the prophylaxis or treatment of a neurodegenerative disease accompanied by the formation of a protein aggregate, which contains the compound as an effective ingredient. In addition, the technical problem of the present application is also to provide a novel compound or a salt thereof and a manufacturing method thereof.

[0011] (2) Technical Solution

[0012] The present application includes each of the following inventions in order to solve the above technical problem.

[0013] [1] A decomposition-promoting composition of a protein aggregate, characterized by containing a compound represented by the following general formula (I) or a salt thereof.

[0014] [Chemical Formula 1]

[0015]

[0016] (In Formula (I), R 1 each independently selected from the group consisting of a halogen atom, a C 1-6 alkyl group, a C 2-6 alkenyl group, a C 2-6 alkynyl group, a C 1-6 alkoxy group, a C 3-8 cycloalkyl group, a C 1-6 halogenated alkyl group, a C 1-6 halogenated alkoxy group, a C 1-6 alkylaminoamido group, a carboxyl group, an amino group, a nitro group, a C 1-6 alkylthio group, a C 1-6 halogenated alkylthio group, a C 1-6 alkylsulfinyl group, a C 1-6 halogenated alkylsulfinyl group, a C 1-6 alkylsulfonyl group, and a C 1-6 halogenated alkylsulfonyl group,

[0017] R 2 is a hydrogen atom, a halogen atom, a C 1-6 alkyl group, a C 2-6 alkenyl group, a C 2-6 alkynyl group, a C 1-6 alkoxy group, a C 3-8 cycloalkyl group, a C 1-6 halogenated alkyl group, a C 1-6 halogenated alkoxy group, a cyano group, a C(=S)NH2 group, an amido group, or an SF5 group,

[0018] R 3 each independently selected from the group consisting of a halogen atom, a C 1-6 alkyl group, a C 2-6 alkenyl group, a C 2-6 alkynyl group, a C 1-6 alkoxy group, a C 3-8 cycloalkyl group, a C 1-6 halogenated alkyl group, a C 1-6 halogenated alkoxy group, a C 1-6 alkylamino group, a C 1-6 alkoxyamino group, a carboxyl group, and an amino group,

[0019] R 4 is selected from the group consisting of a halogen atom, a C 1-6 alkyl group, a C 1-6 halogenated alkyl group, a hydroxyl group, a hydroxy C 1-6 alkyl group, a carboxyl group, a C 1-6 alkylamino group, an amino group, and

[0020] [Chemical Formula 2]

[0021]

[0022] (wherein, R is a halogen atom, a C 1-6 alkyl group, a C 1-6 halogenated alkyl group, a C 3-8 cycloalkyl group, a C 1-6 alkylamino group, a C 1-6 halogenated alkylamino group, a C 1-6 alkylamido group, a C 1-6 halogenated alkylamido group, or a phenyl group optionally substituted with a halogen atom, a C 1-6 alkyl group, or a C 1-6 halogenated alkyl group)

[0023] L is -0-, -S-, -NH-, a C 1-6 alkylene group optionally substituted with R, a C 2-6 alkenylene group optionally substituted with R, a C 2-6 alkynylene group, or a bond,

[0024] X and Y are optionally the same or different, N, CH, or CR 3 ,

[0025] A ring is an aromatic hydrocarbon having 5 to 10 carbon atoms or a five- or six-membered aromatic heterocycle containing 1 to 4 heteroatoms selected from the group consisting of a nitrogen atom, a sulfur atom, and an oxygen atom,

[0026] B ring is an aromatic hydrocarbon having 5 to 10 carbon atoms or a five- or six-membered aromatic heterocycle containing 1 to 4 heteroatoms selected from the group consisting of a nitrogen atom, a sulfur atom, and an oxygen atom, the heteroatoms containing at least one nitrogen atom,

[0027] p is 0, 1, 2, 3, 4, or 5,

[0028] q is 0, 1, or 2,

[0029] r is 0, 1, 2, or 3,

[0030] when p, q, and / or r is 2 or more, two or more R 1 , R 3 , and / or R 4 optionally form a ring together with a part of the ring to which each is substituted,

[0031] m and n are optionally the same or different, 1, 2, or 3,

[0032] R 1 , R 3and one or more of R is optionally substituted with biotin or a derivative thereof.

[0033] [2] The composition according to the above [1], characterized in that the B ring is selected from the group consisting of phenyl, naphthyl, oxazolyl, thiazolyl, imidazolyl, pyrrolyl, pyrazolyl, isoxazolyl, isothiazolyl, 1,2,4-oxadiazol-5-yl, 1,2,4-oxadiazol-3-yl, 1,3,4-oxadiazolyl, 1,2,5-oxadiazolyl, 1,2,3-oxadiazolyl, 1,2,4-thiadiazol-5-yl, 1,2,4-thiadiazol-3-yl, 1,2,5-thiadiazolyl, 1,3,4-thiadiazolyl, 1,2,3-thiadiazolyl, 1,2,4-triazolyl, 1,2,3-triazolyl, and tetrazolyl.

[0034] [3] The composition according to the above [1], characterized in that the B ring is any of the following structures.

[0035] [Chemical Formula 3]

[0036]

[0037] (in the formula, R 4 is the same as the above [1]).

[0038] [4] The composition according to the above [1], characterized in that R 4 is the following structure.

[0039] [Chemical Formula 4]

[0040]

[0041] (in the formula, R

[0042] [5] The composition according to the above [1], characterized in that the composition is

[0043] [Chemical Formula 5]

[0044]

[0045] (in the formula, Hal is optionally the same or different, and is halogen or C 1-6 haloalkyl).

[0046] [6] The composition according to the above [1], characterized in that X and Y are both CH.

[0047] [7] A pharmaceutical composition for the prophylaxis or treatment of a neurodegenerative disease accompanied by formation of protein aggregates, containing the composition according to any one of the above [1] to [6].

[0048] [8] The pharmaceutical composition according to the above-mentioned [7], wherein the neurodegenerative disease accompanied by formation of protein aggregates is selected from the group consisting of Alzheimer's disease, progressive supranuclear palsy, basal ganglia degeneration, frontotemporal lobar degeneration, Parkinson's disease, multiple system atrophy, Lewy body dementia, rapid eye movement sleep behavior disorder, striatonigral degeneration, Creutzfeldt-Jakob disease, Gastman syndrome, amyotrophic lateral sclerosis, Huntington's disease, spinocerebellar degeneration, and dentatorubral-pallidoluysian atrophy.

[0049] [9] A composition for promoting phosphorylation of p62 / SQSTMl, which contains a compound represented by the general formula (I) or a salt thereof according to the above-mentioned [1].

[0050]

[10] The composition according to the above-mentioned [8], wherein the phosphorylation promoting site is a serine at position 403 of the amino acid sequence of human p62 / SQSTMl shown in SEQ ID NO: 1, or a serine corresponding to the serine at position 403 of SEQ ID NO: 1 in the amino acid sequence of p62 / SQSTMl of a non-human animal.

[0051]

[11] A compound represented by the following general formula (II) or a salt thereof.

[0052] [Chemical Formula 6]

[0053]

[0054] (In the formula (II), R 1 is independently selected from the group consisting of a halogen atom, C 1-6 alkyl group, C 2-6 alkenyl group, C 2-6 alkynyl group, C 1-6 alkoxy group, C 3-8 cycloalkyl group, C 1-6 haloalkyl group, C 1-6 haloalkoxy group, C 1-6 alkylaminoamido group, carboxyl group, amino group, nitro group, C 1-6 alkylthio group, C 1-6 haloalkylthio group, C 1-6 alkylsulfinyl group, C 1-6 haloalkylsulfinyl group, C 1-6 alkylsulfonyl group, and C 1-6 haloalkylsulfonyl group,

[0055] R 2 is a hydrogen atom, halogen atom, C 1-6 alkyl group, C 2-6 alkenyl group, C 2-6 alkynyl group, C 1-6 alkoxy group, C 3-8 cycloalkyl group, C1-6 halogen atom, C 1-6 halogen atom, C

[0056] R 3 halogen atom, C 1-6 alkyl group, C 2-6 alkenyl group, C 2-6 alkynyl group, C 1-6 alkoxy group, C 3-8 cycloalkyl group, C 1-6 halogen atom, C 1-6 halogen atom, C 1-6 alkylamino group, C 1-6 alkoxyamino group, carboxyl group, and amino group,

[0057] R 4 halogen atom, C 1-6 alkyl group, C 1-6 halogen atom, C 1-6 alkyl group, carboxyl group, C 1-6 alkylamino group, amino group, and

[0058] [Chemical Formula 7]

[0059]

[0060] (wherein R is a halogen atom, C 1-6 alkyl group, C 1-6 halogen atom, C 3-8 cycloalkyl group, C 1-6 alkylamino group, C 1-6 halogen atom, C 1-6 alkylaminoacyl group, C 1-6 halogen atom, or a phenyl group optionally substituted with C 1-6 alkyl group, C 1-6 halogen atom, or a halogen atom)

[0061] L is -0-, -S-, -NH-, -NR-, C 1-6 alkylene group optionally substituted with R, C 2-6 alkenylene group optionally substituted with R, C 2-6 alkynylene group, or a chemical bond,

[0062] A 1 , A 2 , and A 3 are optionally the same or different, and are independently selected from the group consisting of a sulfur atom, a nitrogen atom, CR 4 (wherein R 4halogen atom, C 1-6 alkyl, C 1-6 haloalkyl, hydroxy, hydroxyC 1-6 alkyl, carboxyl, amino) and CH,

[0063] p is 1, 2 or 3,

[0064] q is 0 or 1,

[0065] m and n are optionally the same or different and are 1, 2 or 3

[0066] (wherein, the following compounds are excluded: (i) A 1 and A 2 is a nitrogen atom, A 3 is an oxygen atom, R 4 is a compound in which R 1 and A 2 is a nitrogen atom, A 3 is a sulfur atom, R 4 is a compound in which R

[0067]

[12] A compound represented by the following formula or a salt thereof.

[0068] [Chemical Formula 8]

[0069]

[0070] [Chemical Formula 9]

[0071] .

[0072]

[13] A compound represented by the following formula or a salt thereof,

[0073] [Chemical Formula 10]

[0074] .

[0075] (III) Beneficial Effects

[0076] According to the present application, a compound which promotes phosphorylation of the serine at position 403 of human p62 / SQSTMl shown in SEQ ID NO: 1, promotes decomposition of protein aggregates can be provided. Furthermore, a medicament for the prophylaxis or treatment of a neurodegenerative disease accompanied by formation of protein aggregates, which contains the compound of the present application as an active ingredient, can be provided. Furthermore, novel compounds or salts thereof and a method for producing them can be provided. BRIEF DESCRIPTION OF DRAWINGS

[0077] Figure 1is a graph showing the results of evaluating the intracellular accumulation amount of S403 phosphorylated p62 in cultured cells treated with an ADI derivative (compound of the present application) by Western blotting, (A) is the results of N2a cells, and (B) is the results of HEK293 cells.

[0078] Figure 2 is a graph showing the results of evaluating the intracellular accumulation amount of S403 phosphorylated p62 in N2a cells stably expressing mouse p62 protein (RFP-GFP-p62) in which red fluorescent protein (RFP) and green fluorescent protein (GFP) are linked in a straight line, treated with an ADI derivative alone, an ADI derivative and bafilomycin A, or an ADI derivative and BX795, by Western blotting, in order to investigate the mechanism of the phosphorylation promotion action of the ADI derivative.

[0079] Figure 3 is a graph showing the results of measuring the expression amount of genes expected to increase in expression amount by quantitative PCR in N2a cells treated with an ADI derivative.

[0080] Figure 4 is a graph showing the results of measuring the expression amount of the same genes as in Figure 3 by quantitative PCR in the hippocampus collected from mice orally administered an ADI derivative for two weeks.

[0081] Figure 5 is a graph showing images obtained by photographing cells at the time of "time 0" and the same cells (including daughter cells) after 2 days when a self-made Tau aggregation cell line was treated with or without an ADI derivative.

[0082] Figure 6 is a graph showing the time course of the average number of aggregates per 1 hour in (A) and the average value of the proportion of the field of view occupied by cells as the cell density, with the state in which the entire field of view is occupied being set to 100, in (B) in the same experiment as in Figure 5

[0083] Figure 7 is a graph showing the results of immunostaining of tissue sections of the brain with an anti-phosphorylated Tau antibody in 36-week-old PS19 mice, which are model animals of neurodegenerative diseases in which amyloid protein aggregates are formed, orally administered an ADI derivative three times a week for 10 weeks.

[0084] Figure 8 is a graph showing the time course of the average number of aggregates per 1 hour in (A) and the average value of the proportion of the field of view occupied by cells as the cell density, with the state in which the entire field of view is occupied being set to 100, in (B) in the same experiment as in Figure 7 ​In the same experiment, a graph of the results of measuring the thickness of the CA1 nerve cell layer of the hippocampus, (A) is an image of a tissue section of the brain subjected to fluorescent immunostaining with an anti-NeuN monoclonal antibody, and (B) is the results of measuring the width of the CA1 nerve cell layer.

[0085] Figure 9 is an explanatory diagram of the molecular mechanism of aggregate autophagy. DETAILED DESCRIPTION

[0086] [Compounds used in the present invention and salts thereof]

[0087] In the present specification, the compounds of the present invention are sometimes referred to as ADI derivatives or NUT compounds. The compounds are sometimes written as "ADI-X" or "NUT-X", with the same integer of 1 to 100 or so added to "X". For example, ADI-14 (the same compound as NUT-14) and NUT-29 (the same compound as ADI-29) are sometimes written. Note that the hyphen before X is sometimes omitted.

[0088] The compounds preferably used in the present invention are as described in [1] to

[13] above.

[0089] Further, a compound represented by the following general formula (I) or a salt thereof.

[0090] [Chemical Formula 11]

[0091]

[0092] (In the formula, R 1 each independently selected from the group consisting of a halogen atom, a C 1-6 alkyl group, a C 2-6 alkenyl group, a C 2-6 alkynyl group, a C 1-6 alkoxy group, a C 3-8 cycloalkyl group, a C 1-6 haloalkyl group, a C 1-6 haloalkoxy group, a C 1-6 alkylaminoamido group, a carboxyl group, an amino group, a nitro group, a C 1-6 alkylthio group, a C 1-6 haloalkylthio group, a C 1-6 alkylsulfinyl group, a C 1-6 haloalkylsulfinyl group, a C 1-6 alkylsulfonyl group, and a C 1-6 haloalkylsulfonyl group,

[0093] R 2 is a hydrogen atom, a halogen atom, a C 1-6 alkyl group, a C 2-6 alkenyl group, a C 2-6 alkynyl group, a C1-6 Alkoxy, C 3-8 Cycloalkyl, C 1-6 Halogenated alkyl, C 1-6 a haloalkoxy group, a cyano group, a C(=S)NH2 group, an amide group or a SF5 group,

[0094] R 3 are independently selected from the group consisting of: halogen atoms, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-6 Alkoxy, C 3-8 Cycloalkyl, C 1-6 Halogenated alkyl, C 1-6 Halogenated alkoxy, C 1-6 Alkylamino, C 1-6 Alkoxyamino, carboxyl and amino groups,

[0095] R 4 Selected from the group consisting of: halogen atoms, C 1-6 Alkyl, C 1-6 Haloalkyl, hydroxy, hydroxy C 1-6 Alkyl, carboxyl, C 1-6 Alkylamino, amino and

[0096] [Chemical Formula 12]

[0097]

[0098] (wherein, R is a halogen atom, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 3-8 Cycloalkyl, C 1-6 Alkylamino, C 1-6 Haloalkylamino, C 1-6 Alkylamide, C 1-6 a haloalkylamide group or a phenyl group, the phenyl group being optionally substituted by a halogen atom, a C 1-6 Alkyl or C 1-6 (substituted with haloalkyl)

[0099] L is -O-, -S-, -NH-, C optionally substituted by R 1-6 Alkylene, C optionally substituted by R 2-6 Alkenylene, C optionally substituted by R 2-6 Alkyne group or chemical bond,

[0100] X and Y are optionally the same or different and are N, CH or CR 3 ,

[0101] Ring A is an aromatic hydrocarbon having 5 to 10 carbon atoms or a five-membered or six-membered aromatic heterocyclic ring containing 1 to 4 heteroatoms selected from the group consisting of nitrogen atoms, sulfur atoms, and oxygen atoms,

[0102] Ring B is an aromatic hydrocarbon ring having 5 to 10 carbon atoms or a five-membered or six-membered aromatic heterocyclic ring containing 1 to 4 heteroatoms selected from the group consisting of nitrogen atoms, sulfur atoms, and oxygen atoms, wherein the heteroatoms include at least one nitrogen atom.

[0103] p is 0, 1, 2, 3, 4, or 5,

[0104] q is 0, 1, or 2,

[0105] r is 0, 1, 2, or 3,

[0106] When p, q and / or r are 2 or more, two or more R 1 、R 3 and / or R 4 optionally together with a portion of the respective substituted ring to form a ring,

[0107] m and n are optionally the same or different and are 1, 2 or 3,

[0108] R 1 、R 3 and R are optionally substituted with biotin or a derivative thereof), in the above definition, when p, q and / or r are 2 or more, wherein two R 1 、R 3 and / or R 4 Optionally, a ring is formed together with a portion of the ring in which each substituent is present (ie, the A ring, the six-membered ring containing X and Y, and the B ring).

[0109] As such R 1 、R 3 and / or R 4 Examples of the ring formed include, but are not limited to, saturated or unsaturated three- to six-membered rings optionally containing 1 to 3 heteroatoms selected from the group consisting of nitrogen atoms, sulfur atoms, and oxygen atoms, preferably saturated five- to six-membered rings optionally containing 1 to 2 heteroatoms. Specifically, the following rings are included, but are not limited to these.

[0110] [Chemical Formula 13]

[0111]

[0112] CR in X and / or Y 3 In the case that X and / or Y in R 3 The number of is not included in q.

[0113] The symbol "Hal" in the chemical formulae in the present specification means halogen or C 1-6 halogen, more preferably, halogen.

[0114] Further, in the present specification, the description of "a compound represented by General Formula (I)", "a compound represented by General Formula (I) or a salt thereof", and the like can include a compound represented by General Formula (II), a salt thereof, and a compound manufactured in the Examples described later.

[0115] In the present application, the term "alkyl" is preferably C1-C6 alkyl, but is not limited thereto. As such alkyl, for example, straight-chain or branched-chain alkyl such as methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, pentyl, isopentyl, neopentyl, 2,3-dimethylpropyl, benzyloxy, and the like can be exemplified, but is not limited thereto.

[0116] Note that the above description also applies to the alkyl moiety in "…alkyl" (e.g., haloalkyl, alkoxyalkyl, hydroxyalkyl, p-aminobenzenesulfonylalkyl), "alkyl…" (e.g., alkylthio, alkyl p-aminobenzenesulfonyl, alkylsulfonyl, alkylaminoacylamino, alkylamino, and the like). The same applies to the following descriptions of each term.

[0117] The term "alkenyl" is preferably C2-C6 alkenyl, but is not limited thereto. As such alkenyl, for example, straight-chain or branched-chain alkenyl such as ethenyl, allyl, isopropenyl, 1-butenyl, 2-butenyl, and the like can be exemplified, but is not limited thereto.

[0118] The term "alkynyl" is preferably C2-C6 alkynyl, but is not limited thereto. As such alkynyl, for example, straight-chain or branched-chain alkynyl such as ethynyl, 1-propynyl, 2-propynyl, 1-butynyl, 2-butynyl, and the like can be exemplified, but is not limited thereto.

[0119] The term "halogen" is preferably a chlorine atom, a bromine atom, an iodine atom, or a fluorine atom, more preferably a chlorine atom or a fluorine atom, but is not limited thereto.

[0120] The term "alkylene" is a divalent substituent obtained by further removing one hydrogen atom at an arbitrary position from the "alkyl" defined above. The term "alkenylene" is a divalent substituent obtained by further removing one hydrogen atom at an arbitrary position from the "alkenyl" defined above. The term "alkynylene" is a divalent substituent obtained by further removing one hydrogen atom at an arbitrary position from the "alkynyl" defined above.

[0121] The term "cycloalkyl" is preferably C3-C8 cycloalkyl, but is not limited thereto. As such cycloalkyl, for example, cyclic alkyl such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclooctyl, and the like can be exemplified, but is not limited thereto.

[0122] The term "alkoxy" is preferably a C1-C6alkoxy, but is not limited thereto. As such an alkoxy, for example, a linear or branched alkoxy such as methoxy, ethoxy, propoxy, isopropoxy, butoxy, t-butoxy, pentoxy, isopentoxy, neopentoxy, and the like, but is not limited thereto.

[0123] The term "aromatic hydrocarbon" is preferably an aromatic hydrocarbon having 5 to 10 carbon atoms, more preferably a phenyl group, a naphthyl group, and further preferably a phenyl group, but is not limited thereto.

[0124] The term "aromatic heterocycle" is preferably a five- or six-membered aromatic heterocycle containing 1 to 4 heteroatoms selected from the group consisting of a nitrogen atom, a sulfur atom, and an oxygen atom, more preferably a five- or six-membered aromatic heterocycle containing 2 to 3 heteroatoms, and further preferably a five-membered aromatic heterocycle containing 3 heteroatoms, but is not limited thereto. As such an aromatic hydrocarbon, for example, oxazolyl, thiazolyl, imidazolyl, pyrrolyl, pyrazolyl, isoxazolyl, isothiazolyl, 1,2,4-oxadiazol-5-yl, 1,2,4-oxadiazol-3-yl, 1,3,4-oxadiazolyl, 1,2,5-oxadiazolyl, 1,2,3-oxadiazolyl, 1,2,4-thiadiazol-5-yl, 1,2,4-thiadiazol-3-yl, 1,2,5-thiadiazolyl, 1,3,4-thiadiazolyl, 1,2,3-thiadiazolyl, 1,2,4-triazolyl, 1,2,3-triazolyl, tetrazolyl, and the like, more preferably 1,2,4-oxadiazol-5-yl, 1,2,4-oxadiazol-3-yl, 1,3,4-oxadiazolyl, 1,2,5-oxadiazolyl, 1,2,3-oxadiazolyl, 1,2,4-thiadiazol-5-yl, 1,2,4-thiadiazol-3-yl, 1,2,5-thiadiazolyl, 1,3,4-thiadiazolyl, 1,2,3-thiadiazolyl, and further preferably 1,2,4-thiadiazol-5-yl, 1,2,4-thiadiazol-3-yl, 1,2,5-thiadiazolyl, 1,3,4-thiadiazolyl, 1,2,3-thiadiazolyl, but is not limited thereto.

[0125] [Composition for promoting phosphorylation of p62 / SQSTM1]

[0126] The present application provides a composition for promoting phosphorylation of p62 / SQSTM1 containing a compound represented by the general formula (I) or a salt thereof. p62 / SQSTM1 (hereinafter simply referred to as "p62") is a receptor protein that recognizes a ubiquitin chain and directs specific proteins and organelles to autophagy, and is also known as sequestosome-1, p62, A170.

[0127] The phosphorylation-promoting composition of the present application can promote phosphorylation of the serine at position 403 from the N terminus of the amino acid sequence of human p62 shown in SEQ ID NO: 1. In addition, the phosphorylation-promoting composition of the present application can promote phosphorylation of the serine in the amino acid sequence of p62 of a non-human animal corresponding to the serine at position 403 of SEQ ID NO: 1. The serine of p62 of a non-human animal corresponding to the serine at position 403 of SEQ ID NO: 1 can be determined by aligning the amino acid sequence of SEQ ID NO: 1 with the amino acid sequence of p62 of a non-human animal.

[0128] The serine at position 403 from the N terminus of the amino acid sequence of human p62 shown in SEQ ID NO: 1 can also be referred to as the serine at position 38 from the C terminus of the amino acid sequence of human p62 shown in SEQ ID NO: 1. Therefore, the phosphorylation-promoting composition of the present application can promote phosphorylation of the serine in the amino acid sequence of p62 of a non-human animal corresponding to the serine at position 38 from the C terminus of SEQ ID NO: 1. The serine of p62 of a non-human animal corresponding to the serine at position 38 from the C terminus of SEQ ID NO: 1 can be determined by aligning the amino acid sequence of SEQ ID NO: 1 with the amino acid sequence of p62 of a non-human animal.

[0129] The amino acid sequence of p62 of a non-human animal can be obtained from a publicly known database such as NCBI. For example, in the amino acid sequence of p62 of a mouse (NCBI Reference Sequence: NP_035148.1), phosphorylation of the serine at position 405 from the N terminus, the serine at position 38 from the C terminus is promoted, in the amino acid sequence of p62 of a rat (NCBI Reference Sequence: NP_787037.2), phosphorylation of the serine at position 402 from the N terminus, the serine at position 38 from the C terminus is promoted, in the amino acid sequence of p62 of a cow (NCBI Reference Sequence: NP_788814.1), phosphorylation of the serine at position 403 from the N terminus, the serine at position 38 from the C terminus is promoted, and in the amino acid sequence of p62 of a monkey (NCBI Reference Sequence: NP_001253287.1), phosphorylation of the serine at position 402 from the N terminus, the serine at position 38 from the C terminus is promoted.

[0130] Phosphorylation of the serine at position 403 from the N terminus of the amino acid sequence of human p62 shown in SEQ ID NO: 1 can be confirmed, for example, by extracting proteins from cells contacted with a compound represented by General Formula (I) or a salt thereof and cells not contacted with a compound represented by General Formula (I) or a salt thereof, respectively, and performing Western blotting using an antibody that specifically binds to p62 in which the serine at position 403 is phosphorylated.

[0131] [Protein aggregate decomposition-promoting composition]

[0132] As described above, the compound represented by General Formula (I) is capable of promoting phosphorylation of the serine at the 403rd position of the amino acid sequence of human p62 shown in SEQ ID NO: 1, and as a result, is capable of activating autophagy of protein aggregates (aggrephagy) to promote decomposition of protein aggregates (refer to Figure 9 ). Thus, the present application provides a composition for promoting decomposition of protein aggregates, which contains the compound represented by General Formula (I) or a salt thereof. The composition for promoting decomposition of protein aggregates of the present application can be referred to as an aggrephagy activator containing the compound represented by General Formula (I) or a salt thereof.

[0133] The composition for promoting decomposition of protein aggregates of the present application is capable of promoting decomposition of protein aggregates present in the cytoplasm that have been modified with polyubiquitin (ubiquitinated protein aggregates). As ubiquitinated protein aggregates, for example, there can be mentioned: Tau protein aggregates, alpha-synuclein protein aggregates, prion protein aggregates, TDP-43 aggregates in the cytoplasm, and the like.

[0134] Promotion of decomposition of protein aggregates can be confirmed, for example, by observing cells that have been contacted with the compound represented by General Formula (I) or a salt thereof and cells that have not been contacted with the compound represented by General Formula (I) or a salt thereof, using the Tau aggregate cell strain used in the Examples described later.

[0135] [Pharmaceutical composition]

[0136] The composition for promoting decomposition of protein aggregates of the present application can be implemented as a pharmaceutical composition. That is, the present application provides a pharmaceutical composition for the prophylaxis or treatment of a neurodegenerative disease accompanied by formation of protein aggregates, which contains the above-mentioned composition for promoting decomposition of protein aggregates of the present application. The pharmaceutical composition of the present application can be referred to as a pharmaceutical composition for the prophylaxis or treatment of a neurodegenerative disease accompanied by formation of protein aggregates, which contains the compound represented by General Formula (I) or a salt thereof as an active ingredient.

[0137] As the neurodegenerative disease accompanied by formation of protein aggregates for which the pharmaceutical composition of the present application is suitable, there can be mentioned, for example: Alzheimer's disease, progressive supranuclear palsy, basal ganglia degeneration, frontotemporal lobar degeneration, and the like, which are Tau protein diseases, Parkinson's disease, multiple system atrophy, Lewy body dementia, rapid eye movement sleep behavior disorder, and the like, which are synuclein diseases, Creutzfeldt-Jakob disease, Gerstmann-Straussler-Scheinker syndrome, and the like, which are prion diseases, amyotrophic lateral sclerosis, Huntington's disease, spinocerebellar degeneration, dentatorubral pallidoluysian atrophy, and the like.

[0138] As the salt of the compound represented by General Formula (I), a pharmaceutically acceptable salt can be preferably used. The pharmaceutically acceptable salt is not particularly limited as long as it maintains the efficacy of the active ingredient and does not adversely affect the human body, and examples thereof include salts with acids such as acetic acid, propionic acid, butyric acid, formic acid, trifluoroacetic acid, maleic acid, tartaric acid, citric acid, stearic acid, succinic acid, ethylsuccinic acid, malonic acid, lactobionic acid, gluconic acid, glucoheptanoic acid, benzoic acid, methanesulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid (tosic acid), laurylsulfuric acid, malic acid, aspartic acid, glutamic acid, adipic acid, cysteic acid, N-acetylcysteic acid, hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, hydroiodic acid, nicotinic acid, oxalic acid, picric acid, thiocyanic acid, undecanoic acid, acrylic acid polymers, carboxyvinyl polymers, and the like; salts with inorganic bases such as lithium salts, sodium salts, potassium salts, calcium salts, and the like; salts with organic amines such as morpholine, piperidine, and the like; salts with amino acids, and the like.

[0139] The pharmaceutical composition of the present application can be formulated according to a conventional method. Specifically, tablets, coated tablets, pills, powders, granules, capsules, liquids, suspensions, emulsions, and the like for oral administration; injections, infusions, suppositories, ointments, patches, and the like for non-oral administration can be prepared. The mixing ratio of the carriers or additives can be appropriately set based on the range generally used in the pharmaceutical field. The carriers or additives that can be mixed are not particularly limited, and examples thereof include various carriers such as water, physiological saline, other aqueous solvents, aqueous or oily bases, and the like; various additives such as excipients, binders, pH adjusters, disintegrants, absorption accelerators, lubricants, diluents, thickening agents, wetting agents, emulsifiers, preservatives, coloring agents, flavoring agents, spices, and the like.

[0140] As an additive capable of being mixed in tablets, capsules, etc., for example, the following can be used: a binder such as gelatin, corn starch, tragacanth gum, gum arabic; an excipient such as crystalline cellulose; a bulking agent such as corn starch, gelatin, alginic acid, etc.; a lubricant such as magnesium stearate; a sweetening agent such as sucrose, lactose or saccharin; a flavoring agent such as peppermint, orange oil or cherry, etc. When the dosage unit form is a capsule, a liquid carrier such as oil can further be contained in the above-mentioned types of materials. A sterile composition for injection can be formulated by a usual preparation procedure such as dissolving or suspending the active substance in a vehicle such as water for injection, natural product vegetable oil such as sesame oil, coconut oil, etc. As an aqueous liquid for injection, for example, physiological saline, an isotonic solution containing glucose, other auxiliary agents (e.g., D-sorbitol, D-mannitol, sodium chloride, etc.), etc. can be used, and can also be used in combination with a suitable solubilizing agent such as an alcohol (e.g., ethanol), a polyol (e.g., propylene glycol, polyethylene glycol), a nonionic surfactant (e.g., polysorbate 80, HCO-50), etc. As an oily liquid, for example, olive oil, sesame oil, soybean oil, etc. can be used, and can also be used in combination with benzyl benzoate, benzyl alcohol, etc. as a dissolving auxiliary agent. In addition, a buffer (e.g., phosphate buffer, sodium acetate buffer), an analgesic agent (e.g., benzalkonium chloride, procaine hydrochloride, etc.), a stabilizer (e.g., human serum albumin, polyethylene glycol, etc.), a preservative (e.g., benzyl alcohol, phenol, etc.), an antioxidant, etc. can also be combined.

[0141] The content of the compound represented by General Formula (I) or a salt thereof in the composition or one preparation can be 0.001 mg to 1000 mg, or 0.01 mg to 100 mg. The thus obtained composition or preparation is safe and low in toxicity, and thus, for example, can be administered to humans, mammals (e.g., rats, mice, rabbits, sheep, pigs, cows, cats, dogs, monkeys, etc.).

[0142] The amount of the active ingredient of the pharmaceutical composition of the present application to be administered is appropriately set in consideration of the purpose, the kind of disease, the severity of disease, the age, body weight, sex, medical history of the patient, the kind of active ingredient, etc. In the case where an average person having a body weight of about 65 to 70 kg is the target, about 0.02 mg to 5000 mg per day is preferred, and about 0.1 mg to 200 mg per day is more preferred. The total amount of administration per day can be a single administration amount or a divided administration amount.

[0143] The present application includes each of the following inventions.

[0144] A method for preventing or treating a neurodegenerative disease accompanied by formation of protein aggregates, characterized by administering to a mammal an effective amount of a compound represented by General Formula (I) or a salt thereof.

[0145] A method for promoting decomposition of a protein aggregate, characterized by administering to a mammal an effective amount of a compound represented by general formula (I) or a salt thereof.

[0146] A method for promoting phosphorylation of p62 / SQSTM1, characterized by administering to a mammal an effective amount of a compound represented by general formula (I) or a salt thereof.

[0147] A compound represented by general formula (I) or a salt thereof for use in the prophylaxis or treatment of a neurodegenerative disease accompanied by formation of a protein aggregate.

[0148] A compound represented by general formula (I) or a salt thereof for use in the promotion of decomposition of a protein aggregate.

[0149] A compound represented by general formula (I) or a salt thereof for use in the promotion of phosphorylation of p62 / SQSTM1.

[0150] Use of a compound represented by general formula (I) or a salt thereof, wherein the compound or salt is used for the manufacture of a medicament for the prophylaxis or treatment of a neurodegenerative disease accompanied by formation of a protein aggregate.

[0151] Use of a compound represented by general formula (I) or a salt thereof, wherein the compound or salt is used for the manufacture of a promoter of decomposition of a protein aggregate.

[0152] Use of a compound represented by general formula (I) or a salt thereof, wherein the compound or salt is used for the manufacture of a promoter of phosphorylation of p62 / SQSTM1.

[0153] A compound represented by general formula (I) or a salt thereof, a composition comprising the same, a preparation, and a method for manufacturing the same.

[0154] A compound represented by general formula (II) or a salt thereof, a composition comprising the same, a preparation, and a method for manufacturing the same.

[0155] The present application is described in detail below by way of examples, but the present application is not limited to these.

[0156] Further, the present application is described in detail below by way of manufacturing examples, reference examples, test examples, and the like, but the present application is not limited to these.

[0157] Note that, as for the compounds, reagents, etc. of the production examples, examples, test examples, etc. used in the present application, commercially available products can be used as they are. For example, they can be purchased from reagent manufacturers such as Aldrich, FUJIFILM Wako Pure Chemical Corporation, Kanto Chemical Co., Inc., Nacalai Tesque, or Tokyo Chemical Industry Co., Ltd. Column chromatography was performed using silica gel (50-200 µm, Fuji Silysia Chemical). One-dimensional NMR spectra were measured using Varian 500 PS, JEOL JNM-Al400, and Varian Gemini300. Chemical shifts were recorded in ppm with solvent resonance or TMS as an internal standard. Multiplicity was indicated by (s = singlet, d = doublet, t = triplet, dd = doublet of doublets, dt = doublet of triplets, m = multiplet, br = broad) and the like.

[0158] The abbreviations used in the present specification represent the following meanings.

[0159] DMF: N,N-dimethylformamide.

[0160] THF: tetrahydrofuran.

[0161] Et3N: triethylamine.

[0162] iPr2NEt: diisopropylethylamine.

[0163] DBU: diazabicycloundecene.

[0164] DMAP: 4-dimethylaminopyridine.

[0165] Pd2(dpa)3: tris(dibenzylideneacetone)dipalladium(0).

[0166] Xantophos: 4,5-bis(diphenylphosphino)-9,9-dimethylxanthene.

[0167] S-phos: 2-dicyclohexylphosphino-2',6'-dimethoxy-1,1'-biphenyl.

[0168] EDCI: 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride.

[0169] TFA: trifluoroacetic acid.

[0170] BiotinNHS: 6aR-hexahydro-2-oxo-2,5-dioxo-1-pyrrolidinyl-1H-thieno[3aS,4d]imidazole-4S-pentan.

[0171] LAH: lithium aluminum hydride.

[0172] [Manufacturing method]

[0173] The compound 3 having the following structure can be manufactured, for example, by the method described in the following scheme or the like. In the compound 3, it is preferable that X=Y be N=C and N=N, but is not limited thereto.

[0174] <Scheme 1>

[0175] [Chemical Formula 14]

[0176]

[0177] (In the formula, each symbol represents the same meaning as described above.)

[0178] The compound 3 can be manufactured by reacting the above-described compound 1 and the compound 2 in the presence of a base in a solvent which does not adversely affect the reaction. As the solvent which does not adversely affect the reaction, for example, methanol, ethanol, acetonitrile, DMF, THF, 1,4-dioxane, or the like can be exemplified, but is not limited thereto. As the base, for example, Et3N, iPr2NEt, DBU, alkali metal (Li, Na, K, Cs) carbonates and hydroxides, or the like can be exemplified, but is not limited thereto. The amount of the base used is generally about 0.5 molar equivalent to about 5.0 molar equivalent, preferably about 1 molar equivalent to about 2 molar equivalent, with respect to the compound 1, but is not limited thereto. The reaction temperature is generally room temperature to about 150°C, preferably room temperature to about 120°C, but is not limited thereto. Note that, as the room temperature in the present specification, it is generally about 10 to about 30°C, but is not limited thereto. The reaction time is generally about 5 minutes to about 48 hours, preferably about 10 minutes to about 24 hours, but is not limited thereto.

[0179] [Reference Production Example 1] Production of methyl 6-(4-(2-(trifluoromethyl)phenoxy)piperidin-1-yl)pyridazine-3-carboxylate

[0180] Methyl 6-chloropyridazine-3-carboxylate (1.5 g) and 4-(2-(trifluoromethyl)phenoxy)piperidine (1.1 g) were dissolved in acetonitrile (80 mL), iPr2NEt (1.3 mL) was added, and the reaction was performed by stirring at 120°C for 12 hours. The solution after the reaction was diluted with water and extracted with ethyl acetate. The extracted solution was washed with water and saturated brine in this order, and dried over magnesium sulfate. Further, after distilling off the solvent under reduced pressure, the residue was purified by column chromatography (developing agent: ethyl acetate: hexane = 1:2) to obtain the labeled target product (1.4 g, yield 63%).

[0181] 1H NMR (500 MHz, CDC13) δ 7.89 (d, J = 9.8 Hz, 1H), 7.60 (d, J = 8.1 Hz, 1H), 7.50 (t, 8.1 Hz, 1H), 7.04-7.02 (m, 2H), 6.91 (d, J = 9.8 Hz, 1H), 4.84-4.81 (m, 1H), 4.12-4.08 (m, 2H), 4.00 (s, 3H), 3.86-3.81 (m, 2H), 2.08-1.99 (m, 4H).

[0182] The scheme generalizing this Reference Production Example 1 is described, for example, as follows.

[0183] <Scheme 2>

[0184] [Chemical Formula 15]

[0185]

[0186] (In the formula, each symbol represents the same meaning as described above.)

[0187] [Reference Production Example 2] Production of methyl 6-(4-(2-chloro-5- fluorophenoxy)piperidin-1-yl)pyridazine-3-carboxylate

[0188] Using 4-(2-chloro-5-fluorophenoxy)piperidine (1.1 g), reaction treatment was performed according to the method described in Reference Production Example 1 to obtain the labeled target (2.2 g, yield 60%).

[0189] 1 1H NMR (500 MHz, CDC13) δ 7.90 (d, J = 9.5 Hz, 2H), 7.34 (dd, J = 6.1, 8.8 Hz, 1H), 6.92 (d, J = 9.5 Hz, 2H), 6.73 (dd, J = 2.7, 10.1 Hz, 1H), 6.70-6.66 (m, 1H), 4.68 (quint., 1H), 4.12-3.93 (m, 4H), 4.00 (s, 3H), 2.06-2.00 (m, 4H).

[0190] [Reference Production Example 3] Production of methyl 6-(4-cyano-4-(4- (trifluoromethyl)phenyl)piperidin-1-yl)pyridazine-3-carboxylate

[0191] Using methyl 6-chloropyridazine-3-carboxylate (438 mg), 4-(4- (trifluoromethyl)phenyl)piperidine-4-carbonitrile (645 mg), iPr2NEt (530 µL), and acetonitrile (50 mL), reaction treatment was performed according to the method described in Reference Production Example 1 to obtain the labeled target (547 mg, yield 56%).

[0192] 1H NMR (500 MHz, CDC13) δ 7.97 (d, J = 9.6 Hz, 2H), 7.70 (d, J = 8.8 Hz, 2H), 7.63 (d, J = 8.6 Hz, 2H), 7.00 (d, J = 9.8 Hz, 1H), 4.82-4.79 (m, 2H), 4.03 (s, 3H), 3.59-3.53 (m, 2H), 2.30 (d, J = 13.7 Hz, 2H), 2.14 (dt, J = 4.2, 13.2 Hz, 2H).

[0193] [Reference Production Example 4] Production of methyl 6-(4-(2-chloro-5- fluorophenoxy)-4-cyanopiperidin-1-yl)pyridazine-3-carboxylate

[0194] Using methyl 6-chloropyridazine-3-carboxylate (300 mg), 4-(2-chloro-5- fluorophenoxy)piperidine-4-carbonitrile (440 mg), iPr2NEt (362 µL), and DMF (10 mL), reaction treatment was performed according to the method described in Reference Production Example 1 to obtain the labeled target (551 mg, yield 81%).

[0195] [Reference Production Example 5] Production of methyl 6-(4-(2-chloro-5- fluorophenoxy)piperidin-1-yl)nicotinate

[0196] Using methyl 6-chloronicotinate (340 mg), 4-(2-chloro-5-fluorophenoxy)piperidine (508 mg), iPr2NEt (420 µL), and DMF (15 mL), reaction treatment was performed according to the method described in Reference Production Example 1 to obtain the labeled target (634 mg, yield 87%).

[0197] 1H NMR (500 MHz, CDC13) δ 8.81 (d, J = 2.2 Hz, 1H), 8.03 (dd, J = 2.2, 9.1 Hz, 1H), 7.33 (dd, J = 6.1, 8.8 Hz, 1H), 6.74 (dd, J = 3.0, 10.3 Hz, 1H), 6.69-6.64 (m, 2H), 4.65-4.61 (m, 1H), 3.94-3.80 (m, 7H), 2.04-1.93 (m, 4H).

[0198] [Reference Production Example 6] Production of methyl 6-(4-(2-chlorophenoxy)piperidin-1-yl)pyridazine-3-carboxylate

[0199] Using 6-chloropyridazine-3-carboxylic acid methyl ester (693 mg), 4-(2- chlorophenoxy)piperidine (850 mg), iPr2NEt (1.1 mL), and acetonitrile (60 mL), the reaction treatment was performed according to the method described in Reference Production Example 1 to obtain the labeled target (1.0 g, yield 72%).

[0200] 1H NMR (500 MHz, CDCl3) δ 7.89 (d, J = 9.6 Hz, 1H), 7.40 (dd, J = 1.7, 8.1 Hz, 1H), 7.28-7.21 (m, 1H), 7.01 (d, J = 8.1 Hz, 1H), 6.95 (t, J = 7.8 Hz, 1H), 6.92 (d, J = 9.8 Hz, 1H), 4.71 (quint., J = 4.6 Hz, 1H), 4.07-3.98 (m, 7H), 2.05-2.02 (m, 4H).

[0201] [Reference Production Example 7] Production of 6-(4-(2,6-dichlorophenoxy)piperidin-1-yl)pyridazine-3-carboxylic acid methyl ester

[0202] Using 6-chloropyridazine-3-carboxylic acid methyl ester (596 mg), 4-(2,6- dichlorophenoxy)piperidine (850 mg), iPr2NEt (733 µL), and acetonitrile (50 mL), the reaction treatment was performed according to the method described in Reference Production Example 1 to obtain the labeled target (750 mg, yield 56%).

[0203] 1H NMR (500 MHz, CDCl3) δ 7.90 (d, J = 9.8 Hz, 1H), 7.33 (d, J = 8.1 Hz, 2H), 7.01 (t, J = 7.8 Hz, 1H), 6.92 (d, J = 9.5 Hz, 1H), 4.57 (quint., J = 5.5 Hz, 1H), 4.33-4.28 (m, 2H), 4.01 (s, 3H), 3.69-3.64 (m, 2H), 2.09-2.06 (m, 4H).

[0204] [Reference Production Example 8] Production of 4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)benzoic acid methyl ester

[0205] Methyl 4-bromobenzoate (1.0 g) and 4-(2-chloro-5-fluorophenoxy)piperidine (1.0 g) were dissolved in 1,4-dioxane (25 mL), Pd2(dpa)3(39 mg), Xantphos (62 mg) and cesium carbonate (2.2 g) were added, and stirring was performed at 100°C for 12 hours. After the reaction, the reaction solution was diluted with water and extracted with ethyl acetate. The extract was washed with water and saturated brine in this order, and dried over magnesium sulfate. After the solvent was removed by distillation under reduced pressure, the residue was purified by column chromatography (developing solvent: ethyl acetate:hexane = 1:4) to obtain the labeled target substance (820 mg, yield 43%).

[0206] 1 HNMR (500 MHz, CDC13) δ 7.93 (d, J = 9.3 Hz, 2H), 7.33 (dd, J = 2.7, 8.8 Hz, IH), 6.90 (d, J = 9.1 Hz, 2H), 6.72 (dd, J = 3.0, 10.3 Hz, IH), 6.66 (ddd, J = 2.7, 7.8, 8.8 Hz, IH), 4.60-4.56 (m, IH), 3.88 (s, 3H), 3.67-3.62 (m, 2H), 3.43-3.39 (m, 2H), 2.10-1.97 (m, 4H).

[0207] The scheme generalizing this Reference Production Example 8 is described below.

[0208] <Scheme 3>

[0209] [Chemical Formula 16]

[0210]

[0211] (In the formula, each symbol represents the same meaning as described above.)

[0212] [Reference Production Example 9] Production of methyl 4-(4-(2-chlorophenoxy)piperidin-l-yl)benzoate

[0213] Using methyl 4-bromobenzoate (932 mg), 4-(2-chlorophenoxy)piperidine (850 mg), Pd2(dpa)3(37 mg), Xantphos (58 mg) and cesium carbonate (2.0 g), reaction treatment was performed according to the method described in Reference Production Example 8 to obtain the labeled target substance (762 mg, yield 55%).

[0214] 1HNMR (500 MHz, CDC13) δ 7.93 (d, J = 9.1 Hz, 2H), 7.39 (dd, J = 1.7, 7.8 Hz, IH), 7.24-7.20 (m, IH), 7.00 (dd, J = 1.0, 8.3 Hz, IH), 6.94 (dt, J = 1.3, 7.9 Hz, IH), 6.90 (d, J = 7.1 Hz, 2H), 4.63-4.59 (m, IH), 3.88 (s, 3H), 3.69-3.64 (m, 2H), 3.41-3.37 (m, 2H), 2.09-1.98 (m, 4H).

[0215] [Reference Production Example 10] Production of methyl 4-(4-(2,6-dichlorophenoxy)piperidin-l-yl)benzoate

[0216] Using methyl 4-bromobenzoate (932 mg), 4-(2,6-dichlorophenoxy)piperidine (850 mg), Pd2(dpa)3(37 mg), Xantphos (58 mg), and cesium carbonate (1.7 g), reaction treatment was performed according to the method described in Reference Production Example 8 to obtain the labeled target (734 mg, yield 58%).

[0217] 1 HNMR (500 MHz, CDC13) δ 7.93 (d, J = 9.1 Hz, 2H), 7.39 (dd, J = 1.7, 7.8 Hz, IH), 7.24-7.20 (m, IH), 7.00 (dd, J = 1.0, 8.3 Hz, IH), 6.94 (dt, J = 1.3, 7.9 Hz, IH), 6.90 (d, J = 7.1 Hz, 2H), 4.63-4.59 (m, IH), 3.88 (s, 3H), 3.69-3.64 (m, 2H), 3.41-3.37 (m, 2H), 2.09-1.98 (m, 4H).

[0218] Hereinafter, a scheme generalizing the production examples of the compound of the embodiment of the present application is shown.

[0219] <Scheme 4>

[0220] [Chemical Formula 17]

[0221]

[0222] (In the formula, each symbol represents the same meaning as described above.)

[0223] Hereinafter, the procedures (a), (b), and (c) in the above Scheme 4 are described in detail.

[0224] Step (a): Compound (4) can be produced by reacting compound (3) with hydrazine monohydrate in a solvent which does not adversely affect the reaction. As the solvent which does not adversely affect the reaction, for example, methanol, ethanol and the like can be mentioned, but are not limited thereto. The amount of hydrazine monohydrate used is usually about 1 mole equivalent to about 50 mole equivalents, preferably about 10 mole equivalents to about 50 mole equivalents, relative to compound (4), but is not limited thereto. The reaction temperature is usually between room temperature and about 150°C, preferably between room temperature and about 90°C, but is not limited thereto. The reaction time is usually about 5 minutes to about 48 hours, preferably about 10 minutes to about 24 hours, but is not limited thereto.

[0225] Step (b): Compound (5) can be produced by reacting compound (4) with a carboxylic acid halide in the presence of a base in a solvent which does not adversely affect the reaction. As the solvent which does not adversely affect the reaction, for example, dichloromethane, diethyl ether and the like can be mentioned, but are not limited thereto. The carboxylic acid halide is, for example, acetyl chloride, acetoxyacetyl chloride, benzoyl chloride and the like, but is not limited thereto. The amount of carboxylic acid halide used is usually 0.5 mole equivalents to 1.5 mole equivalents, preferably 0.8 mole equivalents to 1.2 mole equivalents, but is not limited thereto. As the base, for example, Et3N, iPr2NEt and the like can be mentioned, but are not limited thereto. The amount of base used is usually about 0.5 mole equivalents to about 10 mole equivalents, preferably about 0.8 mole equivalents to about 2 mole equivalents, relative to compound (4), but is not limited thereto. The reaction temperature is usually between about -78°C and about 150°C, preferably between about -20°C and about 80°C, but is not limited thereto. The reaction time is usually about 5 minutes to about 48 hours, preferably about 10 minutes to about 24 hours, but is not limited thereto.

[0226] Step (c): Compound (6) can be produced by reacting compound (5) with a sulfurizing agent under microwave irradiation in a solvent which does not adversely affect the reaction. As the solvent which does not adversely affect the reaction, for example, THF, 1,4-dioxane and the like can be mentioned, but are not limited thereto. As the sulfurizing agent, for example, phosphorus pentasulfide, Lawesson's reagent and the like can be mentioned, but are not limited thereto. The amount of sulfurizing agent used is usually about 0.5 mole equivalents to about 10 mole equivalents, preferably about 0.8 mole equivalents to about 5 mole equivalents, relative to compound (5), but is not limited thereto. The reaction temperature is usually between room temperature and about 150°C, preferably between room temperature and about 120°C, but is not limited thereto. The reaction time is usually about 1 minute to about 1 hour, preferably about 5 minutes to about 20 minutes, but is not limited thereto.

[0227] [Example 1] Preparation of 2-(6-(4-(2-(trifluoromethyl)phenoxy)piperidin-1-yl)pyridazin-3-yl)-5-methyl-1,3,4-thiadiazole (Compound No. NUT-9)

[0228] [Chemical Formula 18]

[0229]

[0230] [Process (a) of Example 1] Production of 6-(4-(2-(trifluoromethyl)phenoxy)piperidin-1-yl)pyridazine-3-carbohydrazide

[0231] Methyl 6-(4-(2-(trifluoromethyl)phenoxy)piperidin-1-yl)pyridazine-3-carboxylate (572 mg) produced in Production Example 1 was dissolved in ethanol (8 mL), hydrazine monohydrate (3.0 mL) was added, and stirring was performed at 80°C for 12 hours. After distilling off the solvent from the reaction solution under reduced pressure, dilution with water was performed, and extraction was performed with ethyl acetate. After washing the extract with saturated brine and drying with magnesium sulfate, the crude product (570 mg, crude yield 99%) was used in the next reaction.

[0232] [Process (b) of Example 1] Production of N'-acetyl-6-(4-(2-(trifluoromethyl)phenoxy)piperidin-1-yl)pyridazine-3-carbohydrazide

[0233] The crude product of 6-(4-(2-(trifluoromethyl)phenoxy)piperidin-1-yl)pyridazine-3-carbohydrazide (570 mg) obtained in the above process (a) was dissolved in dichloromethane (10 mL), the reaction solution was cooled to 0°C, iPr2NEt (522 µL) and acetyl chloride (160 µL) were added, and stirring was performed at room temperature for 10 hours. After the reaction, the reaction solution was diluted with water and extracted with ethyl acetate. After washing the extract with saturated brine and drying with magnesium sulfate, the solvent was distilled off under reduced pressure, and the residue was purified by column chromatography (developing agent: ethyl acetate:methanol=95:5) to obtain the labeled target product (112 mg, yield 18%).

[0234] 1H NMR (500 MHz, CDCl3) δ 9.86 (br. s, NH), 8.13-8.06 (m, NH), 7.93 (d, J = 9.5 Hz, 1H), 7.61 (d, J = 7.4 Hz, 1H), 7.51 (t, J = 7.6 Hz, 1H), 7.05-7.02 (m, 2H), 7.99 (d, J = 9.6 Hz, 1H), 4.87-4.81 (m, 1H), 4.14-4.07 (m, 2H), 3.86-3.80 (m, 2H), 2.14 (s, 3H), 2.08-2.02 (m, 4H).

[0235] [Example 1, step (c)] Preparation of 2-(6-(4-(2-(trifluoromethyl)phenoxy)piperidin-l-yl)pyridazin-3-yl)-5-methyl-l,3,4-thiadiazole

[0236] The N'-acetyl-6-(4-(2-(trifluoromethyl)phenoxy)piperidin-l-yl)pyridazine-3-carbohydrazide (112 mg) obtained in the above step (b) was dissolved in THF (4 mL), and phosphorus pentasulfide (124 mg) was added, and irradiated with a microwave at 150°C for 20 minutes. After the reaction, the solvent was distilled off from the reaction solution under reduced pressure, and the residue was purified by column chromatography (developing solvent: ethyl acetate: hexane = 1:1) to obtain the labeled target product (43 mg, yield 40%).

[0237] 1 HNMR (500 MHz, CDC13) δ 8.15 (d, J = 9.8 Hz, 1H), 7.60 (d, J = 7.8 Hz, 1H), 7.49 (t, J = 7.3 Hz, 1H), 7.05-7.01 (m, 3H), 4.84-4.81 (m, 1H), 4.08-4.03 (m, 2H), 3.86-3.81 (m, 2H), 2.81 (s, 3H), 2.09-2.02 (m, 4H).

[0238] [Example 2] Preparation of 2-(6-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)pyridazin-3-yl)-5-methyl-l,3,4-thiadiazole (Compound No. NUT-10)

[0239] [Chemical Formula 19]

[0240]

[0241] [Example 2, step (a)] Preparation of 6-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)pyridazine-3-carboxylic acid methyl ester

[0242] Using the 6-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)pyridazine-3-carboxylic acid methyl ester (549 mg) prepared in Reference Production Example 2, the reaction treatment was performed according to the method described in Example 1, step (a), to obtain the crude product of the labeled target product (550 mg, crude yield 99%).

[0243] [Example 2, step (b)] Preparation of N'-acetyl-6-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)pyridazine-3-carbohydrazide

[0244] To the crude product of 6-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)pyridazine-3- carbohydrazide (550 mg) obtained in the above procedure (a), iPr2NEt (522 μL) and acetyl chloride (160 μL) were added, and the reaction was carried out according to the method described in procedure (b) of Example 1, to give the labeled target (123 mg, yield 20%).

[0245] 1 HNMR (300 MHz, CDC13) δ 9.85 (br. s, NH), 8.03 (br. s, NH), 7.94 (d, J = 9.4 Hz, 1H), 7.01 (d, J = 9.4 Hz, 1H), 6.76-6.65 (m, 2H), 4.72-4.65 (m, 1H), 4.03-3.89 (m, 4H), 2.14 (s, 3H), 2.07-2.02 (m, 4H).

[0246] [Procedure (c) of Example 2] Production of 2-(6-(4-(2-chloro-5-fluorophenoxy)piperidin-l- yl)pyridazin-3-yl)-5-methyl-l,3,4-thiadiazole

[0247] To N'-acetyl-6-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)pyridazine-3-carbohydrazide (123 mg) obtained in the above procedure (b) and phosphorus pentasulfide (143 mg) were added, and the reaction was carried out according to the method described in procedure (c) of Example 1, to give the labeled target (47 mg, yield 40%).

[0248] 1 HNMR (500 MHz, CDC13) δ 8.17 (d, J = 9.5 Hz, 1H), 7.34 (dd, J = 6.1, 8.8 Hz, 1H), 7.06 (d, J = 9.6 Hz, 1H), 6.74 (dd, J = 2.7, 10 Hz, 1H), 6.68 (dt, J = 2.7, 8.6 Hz, 1H), 4.69 (quint, J = 4.2 Hz, 1H), 3.98-3.96 (m, 4H), 2.83 (s, 3H), 2.07-2.05 (m, 4H).

[0249] [Example 3] Production of (5-(6-(4-(2-(trifluoromethyl)phenoxy)piperidin-l-yl)pyridazin-3-yl)-l,3,4-thiadiazol-2-yl)methyl acetate (Compound No. NUT-13)

[0250] [Chemical Formula 20]

[0251]

[0252] [Preparation of 2-(2-(6-(4-(2-(trifluoromethyl)phenoxy)piperidin-l-yl)pyridazine-3-carbonyl)hydrazino)2-oxoethyl acetate]

[0253] Using 6-(4-(2-(trifluoromethyl)phenoxy)piperidin-l-yl)pyridazine-3-carbohydrazide (572 mg) obtained in the procedure (1) of Example 3, iPr2NEt (452 μL), and acetoxyacetyl chloride (244 μL), the reaction treatment was performed according to the method described in the procedure (b) of Example 1, to obtain the labeled target (385 mg, yield 63%).

[0254] 1 HNMR (500 MHz, CDC13) δ 9.84 (br. s, NH), 8.61 (br. s, NH), 7.94 (d, J = 9.6 Hz, IH), 7.61 (d, J = 7.6 Hz, IH), 7.51 (d, J = 7.4 Hz, IH), 7.05-7.00 (m, 2H), 4.87-4.83 (m, IH), 4.73 (s, 2H), 4.12-4.08 (m, 2H), 3.86-3.82 (m, 2H), 2.22 (s, 3H), 2.11-2.08 (m, 4H).

[0255] [Preparation of (5-(6-(4-(2-(trifluoromethyl)phenoxy)piperidin-l-yl)pyridazin-3-yl)-l,3,4-thiadiazol-2-yl)methyl acetate]

[0256] Using 2-(2-(6-(4-(2-(trifluoromethyl)phenoxy)piperidin-l-yl)pyridazine-3-carbonyl)hydrazino)2-oxoethyl acetate (340 mg) obtained in the procedure (1) above and phosphorus pentasulfide (345 mg), the reaction treatment was performed according to the method described in the procedure (c) of Example 1, to obtain the labeled target (155 mg, yield 46%).

[0257] 1H NMR (500 MHz, CDC13) δ 8.18 (d, J = 9.6 Hz, IH), 7.62 (d, J = 7.8 Hz, IH), 7.51 (d, J = 7.6 Hz, IH), 7.64-7.03 (m, 2H), 5.53 (s, 2H), 4.86-4.83 (m, IH), 4.09 (dt, J = 4.4, 13.7 Hz, 2H), 3.88-3.82 (m, 2H), 2.18 (s, 3H), 2.11-2.02 (m, 4H).

[0258] [Example 4] Production of (5-(6-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)pyridazin-3-yl)-1,3,4-thiadiazol-2-yl)methyl acetate (Compound No. NUT-14 (ADI-14))

[0259] [Chemical Formula 21]

[0260]

[0261] [Example 4, Step (1)] Production of 2-(2-(6-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)pyridazine-3-carbonyl)hydrazino)-2-oxoethyl acetate

[0262] Using 6-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)pyridazine-3-carbohydrazide (250 mg) obtained in Step (a) of Example 2, iPr2NEt (238 μL), and acetoxyacetyl chloride (111 μL), reaction treatment was performed according to the method described in Step (b) of Example 1, to obtain the labeled target (137 mg, yield 43%).

[0263] 1H NMR (500 MHz, CDC13) δ 9.84 (br. s, NH), 8.58 (br. s, NH), 7.95 (d, J = 9.6 Hz, 1H), 7.35 (dd, J = 6.1, 8.8 Hz, 1H), 7.01 (d, J = 9.5 Hz, 1H), 7.64 (dd, J = 2.7, 10.0 Hz, 1H), 6.71-6.67 (m, 1H), 4.76 (s, 2H), 4.70-4.69 (m, 1H), 4.03-3.92 (m, 4H), 2.22 (s, 3H), 2.07-2.04 (m, 4H).

[0264] [Example 4, Step (2)] Production of (5-(6-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)pyridazin-3-yl)-1,3,4-thiadiazol-2-yl)methyl acetate

[0265] Using 2-(2-(6-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)pyridazine-3-carbonyl)hydrazino)-2-oxoethyl acetate (137 mg) obtained in Step (1) above and phosphorus pentasulfide (143 mg), reaction treatment was performed according to the method described in Step (c) of Example 1, to obtain the labeled target (73 mg, yield 54%).

[0266] 1H NMR (500 MHz, CDCl3) δ 8.19 (d, J = 9.5 Hz, IH), 7.35 (dd, J = 6.2, 8.8 Hz, IH), 7.06 (d, J = 9.6 Hz, IH), 6.74 (dd, J = 2.7, 10.0 Hz, IH), 6.70-6.67 (m, IH), 5.53 (s, 2H), 4.69 (quint., 4.4 Hz, IH), 4.02-3.96 (m, 4H), 2.19 (s, 3H), 2.06-2.05 (m, 4H).

[0267] [Example 5] Production of (5-(6-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)pyridazin-3-yl)-l,3,4-oxadiazol-2-yl)methyl acetate (Compound No. NUT-19)

[0268] [Formula 22]

[0269]

[0270] To 2-(2-(6-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)pyridazine-3-carbonyl)hydrazino)2- oxoethyl acetate (230 mg) obtained in the procedure (1) of Example 4 was added phosphoryl chloride (4 mL) and stirred at 100°C for 6 hours. To the reaction solution was added ice, and after dilution with an aqueous potassium carbonate solution, extraction was performed with ethyl acetate. The extract was washed with saturated brine and dried over magnesium sulfate. After distilling off the solvent under reduced pressure, the residue was purified by column chromatography (developing agent: ethyl acetate:methanol = 95:5) to obtain the labeled target compound (92 mg, yield 42%).

[0271] 1 1H NMR (500 MHz, CDCl3) δ 8.03 (d, J = 9.5 Hz, IH), 7.32 (dd, J = 5.9, 8.8 Hz, IH), 7.03 (d, J = 9.8 Hz, IH), 6.72 (dd, J = 3.0, 10.3 Hz, IH), 6.70-6.67 (m, IH), 5.36 (s, 2H), 4.69-4.67 (m, IH), 4.04-3.92 (m, 4H), 2.16 (s, 3H), 2.06-2.03 (m, 4H).

[0272] The scheme generalizing this Example 5 is, for example, as follows.

[0273] [Scheme 5]

[0274] [Formula 23]

[0275]

[0276] (In the formula, each symbol represents the same meaning as described above.)

[0277] [Example 6] Production of (5-(6-(4-cyano-4-(trifluoromethyl)phenyl)piperidin-1-yl)pyridazin-3-yl)-1,3,4-thiadiazol-2-yl)methyl acetate (Compound No. NUT-21)

[0278] [Chemical Formula 24]

[0279]

[0280] [Example 6, Step (a)] Production of 6-(4-cyano-4-(4-(trifluoromethyl)phenyl)piperidin-1-yl)pyridazine-3-carbohydrazide

[0281] Using methyl 6-(4-cyano-4-(4-(trifluoromethyl)phenyl)piperidin-1-yl)pyridazine-3-carboxylate (547 mg) obtained in Reference Production Example 3, the reaction treatment was performed according to the method described in Step (a) of Example 1, to obtain the crude product of the target substance (545 mg, crude yield 99%).

[0282] [Example 6, Step (b)] Production of 2-(2-(6-(4-cyano-4-(4-(trifluoromethyl)phenyl)piperidin-1-yl)pyridazine-3-carbonyl)hydrazino)-2-oxoethyl acetate

[0283] Using the crude product of 6-(4-cyano-4-(4-(trifluoromethyl)phenyl)piperidin-1-yl)pyridazine-3-carbohydrazide (545 mg) produced in the above Step (a), iPr2NEt (489 µL), and acetoxyacetyl chloride (228 µL), the reaction treatment was performed according to the method described in Step (b) of Example 1, to obtain the target substance (56 mg, yield 8%).

[0284] 1 HNMR (500 MHz, CDC13) δ 9.58 (br. d, NH), 8.00 (d, J = 9.6 Hz, 1H), 7.71 (d, J = 8.3 Hz, 2H), 7.64 (d, J = 8.6 Hz, 2H), 7.08 (d, J = 9.6 Hz, 1H), 5.14 (br. s, 2H), 5.04 (br. s, NH), 4.89 (d, J = 14.0 Hz, 2H), 3.60 (t, J = 13.5 Hz, 2H), 2.32 (d, J = 13.2 Hz, 2H), 2.21-2.14 (m, 5H).

[0285] [Example 6, step (c)] Preparation of (5-(6-(4-cyano-4-(trifluoromethyl)phenyl)piperidin-l-yl)pyridazin-3-yl)-l,3,4-thiadiazol-2-yl)methyl acetate

[0286] Using 2-(2-(6-(4-cyano-4-(4-(trifluoromethyl)phenyl)piperidin-l-yl)pyridazine-3-carbonyl)hydrazino)-2-oxoethyl acetate (56 mg) produced in the above-described step (b) and phosphorus pentasulfide (56 mg), reaction treatment was performed according to the method described in step (c) of Example 1, to obtain the labeled target (22 mg, yield 40%).

[0287] 1 HNMR (500 MHz, CDC13) δ 8.24 (d, J = 9.6 Hz, IH), 7.70 (d, J = 8.3 Hz, 2H), 7.63 (d, J = 8.3 Hz, 2H), 7.13 (d, J = 9.6 Hz, IH), 5.54 (s, 2H), 4.77 (d, J = 14.2 Hz, 2H), 3.60-3.54 (m, 2H), 2.31 (d, J = 13.7 Hz, 2H), 2.19-2.13 (m, 5H).

[0288] [Example 7] Preparation of (5-(6-(4-(2-chloro-5-fluorophenoxy)-4-cyanopiperidin-l-yl)pyridazin-3-yl)-l,3,4-thiadiazol-2-yl)methyl acetate (compound No. NUT-25) and

[0289] [Chemical Formula 25]

[0290]

[0291] [Example 7, by-product] Preparation of (5-(6-(4-thiocarbamoyl-4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)pyridazin-3-yl)-l,3,4-thiadiazol-2-yl)methyl acetate (compound No. NUT-26)

[0292] [Chemical Formula 26]

[0293]

[0294] [Example 7, step (a)] Preparation of 6-(4-(2-chloro-5-fluorophenoxy)-4-cyanopiperidin-l-yl)pyridazine-3-carbohydrazide

[0295] Using 6-(4-(2-chloro-5-fluorophenoxy)-4-cyanopiperidin-1-yl)pyridazine-3-carboxylic acid methyl ester (508 mg) produced in Reference Production Example 4, reaction treatment was performed according to the method described in the procedure (a) of Example 1 to obtain a crude product of the target substance (300 mg, crude yield 59%).

[0296] [Procedure (b) of Example 7] Production of 2-(2-(6-(4-(2-chloro-5-fluorophenoxy)-4-cyanopiperidin-1-yl)pyridazine-3-carbonyl)hydrazino)-2-oxoethyl acetate

[0297] Using a part of the crude product of 6-(4-(2-chloro-5-fluorophenoxy)-4-cyanopiperidin-1-yl)pyridazine-3-carbohydrazide (195 mg) produced in the above procedure (a), iPr2NEt (100 µL), and acetyloxyacetyl chloride (54 µL), reaction treatment was performed according to the method described in the procedure (b) of Example 1 to obtain the target substance (158 mg, yield 64%).

[0298] 1 HNMR (500 MHz, CDC13) δ 9.84 (br. s, NH), 8.60 (br. s, NH), 8.02 (d, J = 9.5 Hz, 1H), 7.42 (dd, J = 5.9, 8.8 Hz, 1H), 7.34 (dd, J = 3.0, 9.3 Hz, 1H), 7.04 (d, J = 9.6 Hz, 1H), 6.90 (ddd, J = 2.7, 7.6, 8.8 Hz, 1H), 4.76 (s, 2H), 4.24-4.19 (m, 2H), 3.84-3.80 (m, 2H), 2.38-2.33 (m, 4H), 2.23 (s, 3H).

[0299] [Procedure (c) of Example 7] Production of (5-(6-(4-(2-chloro-5-fluorophenoxy)-4-cyanopiperidin-1-yl)pyridazine-3-yl)-1,3,4-thiadiazol-2-yl)methyl acetate

[0300] Using 2-(2-(6-(4-(2-chloro-5-fluorophenoxy)-4-cyanopiperidin-1-yl)pyridazine-3-carbonyl)hydrazino)-2-oxoethyl acetate (157 mg) produced in the above procedure (b) and phosphorus pentasulfide (156 mg), reaction treatment was performed according to the method described in the procedure (c) of Example 1 to obtain the target substance (41 mg, yield 26%).

[0301] 1HNMR (500 MHz, CDC13) δ 8.24 (d, J = 9.6 Hz, IH), 7.41 (dd, J = 5.9, 8.8 Hz, IH), 7.33 (dd, J = 2.7, 9.3 Hz, IH), 7.09 (d, J = 9.8 Hz, IH), 6.89 (ddd, J = 2.9, 7.6, 9.0 Hz, IH), 5.53 (s, 2H), 4.25-4.20 (m, 2H), 3.84-3.79 (m, 2H), 2.40-2.33 (m, 4H), 2.18 (s, 3H).

[0302] In addition, as a by-product of the reaction of the above procedure (c), (5-(6-(4- thiocarbamoyl-4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)pyridazin-3-yl)-l,3,4- thiazol-2-yl)methyl acetate (20 mg, yield 12%) was also obtained.

[0303] 1 HNMR (500 MHz, CDC13) δ 8.24 (d, J = 9.6 Hz, IH), 7.41 (dd, J = 5.9, 8.8 Hz, IH), 7.33 (dd, J = 2.7, 9.3 Hz, IH), 7.09 (d, J = 9.8 Hz, IH), 6.89 (ddd, J = 2.9, 7.6, 9.0 Hz, IH), 5.53 (s, 2H), 4.25-4.20 (m, 2H), 3.84-3.79 (m, 2H), 2.40-2.33 (m, 4H), 2.18 (s, 3H).

[0304] [Example 8] (5-(6-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)pyridin-3-yl)-l,3,4- thiazol-2-yl)methyl acetate (Compound No. NUT-27)

[0305] [Chemical Formula 27]

[0306]

[0307] [Procedure (a) of Example 8] Production of 6-(4-cyano-(2-chloro-5-fluorophenyl)piperidin-l-yl)nicotinohydrazide

[0308] Using 6-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)nicotinic acid methyl ester (547 mg) produced in Reference Production Example 5, reaction treatment was performed according to the method described in procedure (a) of Example 1, to obtain a crude product of the labeled target (85 mg, crude yield 16%).

[0309] [Step (b) of Example 8] Production of 2-(2-(6-(4-(2-chloro-5-fluorophenyl)piperidin-1-yl)nicotinoyl)hydrazino-2-oxoethyl acetate

[0310] The crude product of 6-(4-cyano-(2-chloro-5-fluorophenyl)piperidin-1-yl)nicotinamide (85 mg) produced in step (a) above, iPr2NEt (49 µL), and acetoxyacetyl chloride (258 µL) were reacted according to the method described in step (b) of Example 1 to obtain the labeled target (56 mg, 52% yield).

[0311] 1 HNMR(500MHz, CDCl3) δ8.93(br.s,NH), 8.66(d,J=2.2Hz,1H), 7.89(dd,J=2.7,9.1Hz,1H), 7.34(dd,J=5.6,8.8Hz,1H), 6.73( dd,J=3.0,10.3Hz,1H), 6.69-6.65(m,2H), 4.74(s,2H), 4.66-4.62(m,1H), 3.93-3.82(m,4H), 2.22(s,3H), 2.02-1.97(m,4H).

[0312] [Step (c) of Example 8] Production of (5-(6-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)pyridin-3-yl)-1,3,4-thiadiazol-2-yl)methyl acetate

[0313] Using 2-(2-(6-(4-(2-chloro-5-fluorophenyl)piperidin-1-yl)nicotinoyl)hydrazino-2-oxoethyl acetate (56 mg) produced in the above step (b), phosphorus pentasulfide (56 mg), and THF (2 mL), a reaction was carried out according to the method described in step (c) of Example 1 to obtain the labeled target compound (32 mg, 49% yield).

[0314] 1 HNMR (500MHz, CDCl3) δ8.65(d,J=2.4Hz,1H), 8.10(dd,J=2.5,9.0Hz,1H), 7.33(dd,J=6.1,8.8Hz,1H), 6.76-6.72(m,2H), 6.68-6.65(m,1H), 5.50(s,2H), 4.66-4.62(m,1H), 3.92-3.88(m,2H), 3.84-3.80(m,1H), 2.17(s,3H), 2.05-1.97(m,4H).

[0315] [Example 9] Production of (5-(6-(4-(2-chlorophenoxy)piperidin-1-yl)pyridazin-3-yl)-1,3,4-thiadiazol-2-yl)methyl acetate (Compound No. NUT-33)

[0316] [Chemical Formula 28]

[0317]

[0318] [Example 9, Step (a)] Production of 6-(4-(2-chlorophenoxy)piperidin-1-yl)pyridazine-3-carbohydrazide

[0319] Using 6-(4-(2-chlorophenoxy)piperidin-1-yl)pyridazine-3-carboxylic acid methyl ester (1.0 g) and hydrazine monohydrate (5 mL) produced in Reference Production Example 6, the reaction treatment was performed according to the method described in Step (a) of Example 1, to obtain the crude product of the target substance (347 mg, crude yield 80%).

[0320] [Example 9, Step (b)] Production of 2-(2-(6-(4-(2-chlorophenoxy)piperidin-1-yl)pyridazine-3-carbonyl)hydrazino)2-oxoethyl acetate

[0321] Using the crude product of 6-(4-(2-chlorophenoxy)piperidin-1-yl)pyridazine-3-carbohydrazide (347 mg) produced in the above Step (a), iPr2NEt (210 µL), and acetoxyacetyl chloride (119 µL), the reaction treatment was performed according to the method described in Step (b) of Example 1, to obtain the target substance (348 mg, yield 78%).

[0322] 1 HNMR (500 MHz, CDC13) δ 9.83 (br. s, NH), 8.60 (br. s, NH), 7.94 (d, J = 9.6 Hz, 1H), 7.41 (dd, J = 1.7, 7.8 Hz, 1H), 7.23 (dt, J = 1.7, 8.3 Hz, 1H), 7.01 (d, J = 8.8 Hz, 2H), 6.96 (dt, J = 1.5, 8.1 Hz, 1H), 4.76 (s, 2H), 4.73 (quint., J = 4.4 Hz, 1H), 4.02-3.94 (m, 4H), 2.22 (s, 3H), 2.06-2.02 (m, 4H).

[0323] [Example 9, Step (c)] Production of (5-(6-(4-(2-chlorophenoxy)piperidin-1-yl)pyridazin-3-yl)-1,3,4-thiadiazol-2-yl)methyl acetate

[0324] Using 2-(2-(6-(4-(2-chlorophenoxy)piperidin-l-yl)pyridazine-3-carbonyl)hydrazino)-2- oxoethyl acetate (143 mg) produced in the above procedure (b) and phosphorus pentasulfide (156 mg), reaction treatment was performed in accordance with the method described in procedure (c) of Example 1 to obtain the marked target (45 mg, yield 29%).

[0325] 1 HNMR (500 MHz, CDC13) δ 8.16 (d, J = 9.5 Hz, IH), 7.39 (dd, J = 1.5, 7.8 Hz, IH), 7.22 (dt, J = 1.5, 7.9 Hz, IH), 7.05 (d, J = 9.8 Hz, IH), 6.99 (dd, J = 1.2, 8.3 Hz, IH), 6.94 (dt, J = 1.0, 7.6 Hz, IH), 5.51 (s, 2H), 4.71 (quint., J = 4.7 Hz, IH), 4.00-3.94 (m, 4H), 2.17 (s, 3H), 2.05-2.02 (m, 4H).

[0326] [Example 10] Production of (5-(6-(4-(2,6-dichlorophenoxy)piperidin-l-yl)pyridazin-3-yl)-l,3,4- thiazol-2-yl)methyl acetate (Compound No. NUT-34)

[0327] [Chemical Formula 29]

[0328]

[0329] [Procedure (a) of Example 10] Production of 6-(4-(2,6-dichlorophenoxy)piperidin-l-yl)hydrazinecarbodithioic acid

[0330] Using methyl 6-(4-(2,6-dichlorophenoxy)piperidin-l-yl)pyridazine-3-carboxylate (750 mg) produced in Reference Production Example 7 and hydrazine monohydrate (4 mL), reaction treatment was performed in accordance with the method described in procedure (a) of Example 1 to obtain the crude product of the marked target (591 mg, crude yield 79%).

[0331] [Procedure (b) of Example 10] Production of 2-(2-(6-(4-(2,6-dichlorophenoxy)piperidin-l-yl)pyridazine-3-carbonyl)hydrazino)-2-oxoethyl acetate

[0332] A part of the crude product of 6-(4-(2,6-dichlorophenoxy)piperidin-l-yl)pyridazine-3-carbohydrazide (382 mg) produced in the above procedure (a), iPr2NEt (210 μL), and acetoxyacetyl chloride (119 μL) were subjected to reaction treatment in accordance with the method described in procedure (b) of Example 1, to obtain the labeled target (271 mg, yield 56%).

[0333] 1 HNMR (500 MHz, CDC13) δ 9.84 (br. s, NH), 8.63 (br. s, NH), 7.95 (d, J = 9.5 Hz, IH), 7.35 (d, J = 8.3 Hz, 2H), 7.03-7.00 (m, 2H), 4.76 (s, 2H), 4.58 (quint., J = 5.2 Hz, IH), 4.30-4.25 (m, 2H), 3.71-3.66 (m, 2H), 2.22 (s, 3H), 2.11-2.05 (m, 4H).

[0334] [Procedure (c) of Example 10] Production of (5-(6-(4-(2,6-dichlorophenoxy)piperidin-l-yl)pyridazin-3-yl)-l,3,4-thiadiazol-2-yl)methyl acetate

[0335] A part of the crude product of 6-(4-(2,6-dichlorophenoxy)piperidin-l-yl)pyridazine-3-carbohydrazide (382 mg) produced in the above procedure (a), iPr2NEt (210 μL), and acetoxyacetyl chloride (119 μL) were subjected to reaction treatment in accordance with the method described in procedure (b) of Example 1, to obtain the labeled target (271 mg, yield 56%).

[0336] 1 HNMR (500 MHz, CDC13) δ 9.84 (br. s, NH), 8.63 (br. s, NH), 7.95 (d, J = 9.5 Hz, IH), 7.35 (d, J = 8.3 Hz, 2H), 7.03-7.00 (m, 2H), 4.76 (s, 2H), 4.58 (quint., J = 5.2 Hz, IH), 4.30-4.25 (m, 2H), 3.71-3.66 (m, 2H), 2.22 (s, 3H), 2.11-2.05 (m, 4H).

[0337] [Example 11] Production of (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)phenyl)-l,3,4-thiadiazol-2-yl)methyl acetate (Compound No. NUT-28 (ADI-28))

[0338] [Chemical Formula 30]

[0339]

[0340] [Example 11, step (a)] Production of 4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)benzohydrazide

[0341] Using 4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)benzoic acid methyl ester (546 mg) produced in Reference Production Example 8 and hydrazine monohydrate (2 mL), reaction treatment was performed according to the method described in Example 1, step (a), to obtain a crude product of the labeled target (476 mg, crude yield 87%).

[0342] [Example 11, step (b)] Production of 2-(2-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)benzoyl)hydrazino)-2-oxoethyl acetate

[0343] Using a part of the crude product of 4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)benzohydrazide (400 mg) produced in the above step (a), iPr2NEt (143 µL), and acetoxyacetyl chloride (108 µL), reaction treatment was performed according to the method described in Example 1, step (b), to obtain the labeled target (366 mg).

[0344] 1 HNMR (500 MHz, CDC13) δ 9.12 (br. s, NH), 8.77 (br. s, NH), 7.75 (d, J = 8.6 Hz, 2H), 7.33 (dd, J = 6.1, 8.8 Hz, 1H), 6.92 (d, J = 8.8 Hz, 2H), 6.72 (dd, J = 2.7, 10.3 Hz, 1H), 6.66 (dt, J = 2.7, 8.8 Hz, 1H), 4.72 (s, 2H), 4.61-4.56 (m, 1H), 3.66-3.61 (m, 2H), 3.43-3.39 (m, 2H), 2.21 (s, 3H), 2.09-1.99 (m, 4H).

[0345] [Example 11, step (c)] Production of (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3,4-thiadiazol-2-yl)methyl acetate

[0346] Using 2-(2-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)benzoyl)hydrazino)-2- oxoethyl acetate (296 mg) produced in the above procedure (b), phosphorus pentasulfide (313 mg), and THF (8 mL), reaction treatment was performed according to the method described in procedure (c) of Example 1, to obtain the labeled target (258 mg, yield 87%).

[0347] 1 HNMR (500 MHz, CDC13) δ 7.86 (d, J = 8.8 Hz, 2H), 7.33 (dd, J = 6.1, 8.8 Hz, IH), 7.00 (d, J = 8.8 Hz, IH), 6.73 (dd, J = 2.7, 10.3 Hz, IH), 6.67 (dt, J = 2.5, 8.1 Hz, IH), 5.50 (s, 2H), 4.62-4.57 (m, IH), 3.66-3.61 (m, 2H), 3.43-3.38 (m, 2H), 2.18 (s, 3H), 2.12-2.02 (m, 4H).

[0348] [Example 12] Production of (5-(4-(4-(2-chlorophenoxy)piperidin-l-yl)phenyl)-l,3,4- thiazol-2-yl)methyl acetate (Compound No. NUT-31)

[0349] [Chemical Formula 31]

[0350]

[0351] [Procedure (a) of Example 12] Production of 4-(4-(2-chlorophenoxy)piperidin-l-yl)benzohydrazide

[0352] Using methyl 4-(4-(2-chlorophenoxy)piperidin-l-yl)benzoate (690 mg) produced in Reference Production Example 9, hydrazine monohydrate (2.5 mL), reaction treatment was performed according to the method described in procedure (a) of Example 1, to obtain the crude product of the labeled target (345 mg, crude yield 48%).

[0353] [Procedure (b) of Example 12] Production of 2-(2-(4-(4-(2-chlorophenoxy)piperidin-l- yl)benzoyl)hydrazino)-2-oxoethyl acetate

[0354] Using the crude product of 4-(4-(2-chlorophenoxy)piperidin-l-yl)benzohydrazide (345 mg) produced in the above procedure (a), iPr2NEt (210 μL), and acetoxyacetyl chloride (119 μL), reaction treatment was performed in accordance with the method described in procedure (b) of Example 1, to obtain the labeled target (248 mg, yield 56%).

[0355] 1 HNMR (500 MHz, CDC13) δ 9.25 (br. s, NH), 8.89 (br. s, NH), 7.75 (d, J = 9.1 Hz, 2H), 7.39 (d, J = 7.8 Hz, 1H), 7.22 (t, J = 8.3 Hz, 1H), 6.99 (d, J = 8.3 Hz, 1H), 6.95-6.89 (m, 3H), 4.71 (s, 2H), 4.63-4.60 (m, 1H), 3.67-3.63 (m, 2H), 3.41-3.37 (m, 2H), 2.20 (s, 3H), 2.08-1.95 (m, 4H).

[0356] [Procedure (c) of Example 12] Production of (5-(4-(4-(2-chlorophenoxy)piperidin-l-yl)phenyl)-l,3,4-thiadiazol-2-yl)methyl ethanoate

[0357] Using 2-(2-(4-(4-(2-chlorophenoxy)piperidin-l-yl)benzoyl)hydrazino)-2-oxoethyl ethanoate (143 mg) produced in the above procedure (b), phosphorus pentasulfide (156 mg), and THF (4 mL), reaction treatment was performed in accordance with the method described in procedure (c) of Example 1, to obtain the labeled target (76 mg, yield 54%).

[0358] 1 HNMR (500 MHz, CDC13) δ 9.25 (br. s, NH), 8.89 (br. s, NH), 7.75 (d, J = 9.1 Hz, 2H), 7.39 (d, J = 7.8 Hz, 1H), 7.22 (t, J = 8.3 Hz, 1H), 6.99 (d, J = 8.3 Hz, 1H), 6.95-6.89 (m, 3H), 4.71 (s, 2H), 4.63-4.60 (m, 1H), 3.67-3.63 (m, 2H), 3.41-3.37 (m, 2H), 2.20 (s, 3H), 2.08-1.95 (m, 4H).

[0359] [Example 13] Production of (5-(4-(4-(2,6-dichlorophenoxy)piperidin-l-yl)phenyl)-l,3,4-thiadiazol-2-yl)methyl ethanoate (Compound No. NUT-32)

[0360] [Chemical Formula 32]

[0361]

[0362] Production of 4-(4-(2,6-dichlorophenoxy)piperidin-1-yl)benzohydrazide

[0363] Using 4-(4-(2,6-dichlorophenoxy)piperidin-1-yl)benzoic acid methyl ester (734 mg) produced in Reference Production Example 10 and hydrazine monohydrate (2.5 mL), reaction treatment was performed according to the method described in the procedure (a) of Example 1, to obtain a crude product of the labeled target (343 mg, crude yield 47%).

[0364] Production of 2-(2-(4-(4-(2,6-dichlorophenoxy)piperidin-1-yl)benzoyl)hydrazino)-2-oxoethyl acetate

[0365] Using the crude product of 4-(4-(2,6-dichlorophenoxy)piperidin-1-yl)benzohydrazide (340 mg) produced in the above procedure (a), iPr2NEt (188 µL), and acetoxyacetyl chloride (106 µL), reaction treatment was performed according to the method described in the procedure (b) of Example 1, to obtain the labeled target (348 mg, yield 81%).

[0366] 1 HNMR (500 MHz, CDCl3) δ 9.30 (br. s, NH), 8.96 (br. s, NH), 7.75 (d, J = 9.1 Hz, 2H), 7.32 (d, J = 8.1 Hz, 2H), 7.00 (t, J = 8.1 Hz, 1H), 6.90 (d, J = 9.1 Hz, 1H), 4.70 (s, 2H), 4.48 (quint., J = 6.4 Hz, 1H), 3.85-3.80 (m, 2H), 3.22-3.16 (m, 2H), 2.19 (s, 3H), 2.08-2.05 (m, 4H).

[0367] Production of (5-(4-(4-(2,6-dichlorophenoxy)piperidin-1-yl)phenyl)-1,3,4-thiadiazol-2-yl)methyl acetate

[0368] Using 2-(2-(4-(4-(2,6-dichlorophenoxy)piperidin-l-yl)benzoyl)hydrazino)-2- oxoethyl acetate (154 mg) manufactured in the above procedure (b), phosphorus pentasulfide (156 mg), and THF (8 mL), reaction treatment was performed according to the method described in procedure (c) of Example 1 to obtain the marked target (258 mg, yield 52%).

[0369] 1 HNMR (500 MHz, CDC13) δ 7.82 (d, J = 8.6 Hz, 2H), 7.30 (d, J = 8.1 Hz, 2H), 7.02-6.94 (m, 3H), 5.48 (s, 2H), 4.46 (quint., J = 5.4 Hz, IH), 3.85-3.79 (m, 2H), 3.21-3.14 (m, 2H), 2.16 (s, 3H), 2.09-2.07 (m, 4H).

[0370] [Example 14] Production of 2-(4-(4-(2,6-dichlorophenoxy)piperidin-l-yl)phenyl)-5- butyl-l,3,4-thiadiazole (Compound No. NUT-51)

[0371] [Chemical Formula 33]

[0372]

[0373] Using 2-(2-(4-(4-(2,6-dichlorophenoxy)piperidin-l-yl)benzoyl)hydrazino)-2- oxoethyl acetate (154 mg) manufactured in the above procedure (b), phosphorus pentasulfide (156 mg), and THF (8 mL), reaction treatment was performed according to the method described in procedure (c) of Example 1 to obtain the marked target (258 mg, yield 52%).

[0374] 1 HNMR (500 MHz, CDC13) δ 7.82 (d, J = 8.6 Hz, 2H), 7.30 (d, J = 8.1 Hz, 2H), 7.02-6.94 (m, 3H), 5.48 (s, 2H), 4.46 (quint., J = 5.4 Hz, IH), 3.85-3.79 (m, 2H), 3.21-3.14 (m, 2H), 2.16 (s, 3H), 2.09-2.07 (m, 4H).

[0375] [Example 15] Production of (5-(6-(4-(2-(trifluoromethyl)phenoxy)piperidin-l-yl)pyridazin-3-yl)-l,3,4-thiadiazol-2-yl)methanol (Compound No. NUT-11)

[0376] [Formula 34]

[0377]

[0378] (5-(6-(4-(2-(trifluoromethyl)phenoxy)piperidin-l-yl)pyridazin-3-yl)-l,3,4-thiadiazol-2-yl)methyl acetate (80 mg) produced in Example 3 was suspended in a mixture of THF (3 mL) and water (3 mL), lithium hydroxide monohydrate (35 mg) was added, and stirring was performed at room temperature for 12 hours. After the reaction, the reaction solution was diluted with water and extracted with ethyl acetate. The extract was washed with saturated brine and dried over magnesium sulfate. After the solvent was distilled off under reduced pressure, drying under reduced pressure was performed to obtain the marker target substance (48 mg, yield 66%).

[0379] 1 HNMR (500 MHz, CDC13) δ 8.18 (d, J = 9.8 Hz, IH), 7.62 (d, J = 7.8 Hz, IH), 7.51 (t, J = 8.6 Hz, IH), 7.07-7.03 (m, 3H), 5.13 (s, 2H), 4.86-4.83 (m, IH), 4.10-4.06 (m, 2H), 3.88-3.82 (m, 2H), 2.11-2.02 (m, 4H).

[0380] [Example 16] Production of (5-(6-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)pyridazin-3-yl)-l,3,4-thiadiazol-2-yl)methanol (Compound No. NUT-12)

[0381] [Formula 35]

[0382]

[0383] Using 5-(6-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)pyridazin-3-yl)-l,3,4-thiadiazol-2-yl)methyl acetate (130 mg) produced in Example 4, lithium hydroxide monohydrate (66 mg), and performing the reaction treatment according to the method described in Example 15, the marker target substance was obtained (125 mg, yield 93%).

[0384] 1HNMR (500 MHz, CDC13) δ 8.18 (d, J = 9.5 Hz, 1H), 7.35 (dd, J = 5.9, 8.8 Hz, 1H), 7.07 (d, J = 9.8 Hz, 1H), 6.74 (dd, J = 2.7, 10.0 Hz, 1H), 6.68 (dt, J = 2.7, 7.8 Hz, 1H), 5.14 (s, 2H), 4.69 (quint., J = 4.2 Hz, 1H), 4.02 - 3.93 (m, 4H), 2.86 (br. s, OH), 2.08 - 2.04 (m, 4H).

[0385] [Example 17] Production of (5-(6-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)pyridazin-3-yl)-1,3,4-thiadiazol-2-yl)methyl 3-(5-((3aS,4S,6aR)-2-oxooctahydrocyclopenta[d]imidazol-4-yl)pentanamidyl)propanoate (Compound No. NUT-38)

[0386] [Chemical Formula 36]

[0387]

[0388] (5-(6-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)pyridazin-3-yl)-1,3,4-thiadiazol-2-yl)methanol (60 mg) produced by the same method as Example 16 was dissolved in DMF (3 mL), 3-((tert-butoxycarbonyl)amino)propanoic acid (40 mg), DMAP (26 mg), and EDCI (41 mg) were added, and stirring was performed at room temperature for 12 hours. After the reaction, the solvent was distilled off under reduced pressure, and the residue was purified by column chromatography (developing agent: ethyl acetate) to obtain a condensate (75 mg). This was dissolved in dichloromethane (1 mL), TFA (150 µL) was added, and stirring was performed at room temperature for 6 hours. After the reaction, saturated aqueous sodium bicarbonate solution was added to make the reaction solution alkaline, and extraction was performed with dichloromethane. The extract was washed with water and saturated brine in this order, and dried over magnesium sulfate. After the solvent was distilled off under reduced pressure, drying under reduced pressure was performed to obtain (5-(6-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)pyridazin-3-yl)-1,3,4-thiadiazol-2-yl)methyl-3-aminopropanoate (63 mg). This was dissolved in DMF (1 mL), and further Biotin NHS (46 mg) was added, and stirring was performed at room temperature for 12 hours. After the reaction, the solvent was distilled off under reduced pressure, and the residue was purified by column chromatography (developing agent: dichloromethane:methanol = 95:5) to obtain the labeled target (29 mg, yield 34%).

[0389] 1H NMR (400 MHz, CDC13) δ 8.16 (d, J = 9.6 Hz, 1H), 7.34 (dd, J = 6.2, 8.8 Hz, 1H), 7.06 (d, J = 9.8 Hz, 1H), 6.96 (br. t, 1H), 6.73 (dd, J = 2.4, 10.0 Hz, 1H), 6.69 - 6.66 (m, 1H), 6.51 (br. s, 1H), 5.66 (br. s, 1H), 5.55 (s, 2H), 4.69 - 4.68 (m, 1H), 4.52 - 4.50 (m, 1H), 4.32 - 4.30 (m, 1H), 3.99 - 3.94 (m, 4H), 3.57 - 3.54 (m, 2H), 3.15 - 3.11 (m, 1H), 2.90 (dd, J = 4.6, 12.7 Hz, 1H), 2.73 (d, J = 12.9 Hz, 1H), 2.70 - 2.67 (m, 2H), 2.21 (t, J = 7.4 Hz, 2H), 2.09 - 2.01 (m, 4H), 1.72 - 1.63 (m, 4H), 1.42 - 1.39 (m, 2H).

[0390] [Example 18] Production of (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)phenyl)-l,3,4-thiadiazol-2-yl)methanol (Compound No. NUT-45)

[0391] [Chemical Formula 37]

[0392]

[0393] Using 5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)phenyl)-l,3,4-thiadiazol-2-yl)methyl acetate (258 mg) produced in Example 11 and lithium hydroxide monohydrate (117 mg), reaction treatment was performed according to the method described in Example 15, to obtain the labeled target (190 mg, yield 81%).

[0394] 1 H NMR (400 MHz, DMSO-d6) δ 7.78 (d, J = 8.9 Hz, 2H), 7.47 (dd, J = 6.2, 8.9 Hz, 1H), 7.28 (dd, J = 2.8, 11.0 Hz, 1H), 7.08 (d, J = 9.2 Hz, 2H), 6.83 (dt, J = 3.0, 8.2 Hz, 1H), 4.85 - 4.80 (m, 3H), 3.65 - 3.69 (m, 2H), 3.39 - 3.28 (m, 2H), 2.05 - 1.98 (m, 2H), 1.78 - 1.73 (m, 2H).

[0395] [Example 19] Production of (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3-thiazol-2-yl)methanol (Compound No. NUT-63)

[0396] [Chemical Formula 38]

[0397]

[0398] [Example 19, Step (a)] Production of ethyl 2-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)thiazole-4-carboxylate

[0399] Ethyl 2-(4-bromophenyl)thiazole-4-carboxylate (600 mg) and 4-(2-chloro-5-fluorophenoxy)piperidine (440 mg) were dissolved in 1,4-dioxane (15 mL), Pd2(dpa)3 (18 mg), Xantphos (28 mg), and cesium carbonate (963 mg) were added, and stirring was performed at 100°C for 12 hours. After the reaction, the reaction solution was diluted with water and extracted with ethyl acetate. The extract was washed with water and saturated brine in this order, and dried over magnesium sulfate. After the solvent was removed by distillation under reduced pressure, the residue was purified by column chromatography (developing agent: ethyl acetate:hexane = 1:4) to obtain the labeled target substance (124 mg, yield 14%).

[0400] 1 HNMR (500 MHz, CDC13) δ 8.06 (s, 1H), 7.91 (d, J = 8.8 Hz, 2H), 7.33 (dd, J = 6.1, 8.8 Hz, 1H), 6.96 (d, J = 8.8 Hz, 2H), 6.72 (dd, J = 2.7, 10.3 Hz, 1H), 6.66 (dt, J = 2.7, 7.8 Hz, 1H), 4.59-4.55 (m, 1H), 4.45 (q, J = 7.1 Hz, 2H), 3.64-3.59 (m, 2H), 3.39-3.34 (m, 2H), 2.13-2.01 (m, 4H), 1.44 (t, J = 7.1 Hz, 3H).

[0401] [Example 19, Step (b)] Production of (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3-thiazol-2-yl)methanol

[0402] The ethyl 2-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)phenyl)thiazole-4- carboxylate (100 mg) obtained in the above procedure (a) was dissolved in THF (2 mL), the reaction solution was cooled to 0°C, LAH (12 mg) was added, and the mixture was stirred at room temperature for 1 hour. After the reaction, the reaction solution was quenched with 10% aqueous sodium bicarbonate solution and extracted with ethyl acetate. After the extract was washed with saturated brine, the residue was purified by column chromatography (developing solvent: ethyl acetate: hexane = 1 : 1) and dried over magnesium sulfate. After the solvent was distilled off under reduced pressure, the labeled target compound (80 mg, yield 88%) was obtained.

[0403] 1 HNMR (500 MHz, CDC13) δ 7.82 (d, J = 8.8 Hz, 2H), 7.33 (dd, J = 6.1, 8.6 Hz, IH), 7.06 (s, IH), 6.95 (d, J = 8.8 Hz, 2H), 6.72 (dd, J = 2.7, 10.0 Hz, IH), 6.66 (dt, J = 2.7, 8.1 Hz, IH), 4.80 (s, 2H), 4.57-4.54 (m, IH), 3.61-3.54 (m, 2H), 3.35-3.30 (m, 2H), 2.10-2.01 (m, 4H).

[0404] Hereinafter, a general scheme of the example in which the compound having the B ring substituted with "R(C=0)0-CH2- group" is produced from the compound having the B ring substituted with methanol, etc. is described below.

[0405] <Scheme 6>

[0406] [Chemical Formula 39]

[0407]

[0408] (In the formula, each symbol represents the same meaning as described above.)

[0409] As details and specific examples thereof, the following Examples 20 to 29, etc. are cited for explanation.

[0410] [Example 20] Production of 5-(6-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)pyridazin-3-yl)-l,3,4-thiadiazol-2-yl)methyl isobutyrate (Compound No. NUT-20)

[0411] [Chemical Formula 40]

[0412]

[0413] (5-(6-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)pyridazin-3-yl)-1,3,4-thiadiazol-2-yl)methanol (125 mg) manufactured by the same method as in Example 16 was dissolved in dichloromethane (3 mL), the reaction solution was cooled to 0°C, iPr2NEt (78 µL), DMAP (4 mg), and isobutyl chloride (37 µL) were added, and stirring was performed at room temperature for 10 hours. After the reaction, the reaction solution was diluted with water and extracted with ethyl acetate. The extract was washed with saturated brine in this order and dried over magnesium sulfate. After the solvent was distilled off under reduced pressure, the residue was purified by column chromatography (developing agent: ethyl acetate: hexane = 1:1) to obtain the labeled target substance (92 mg, yield 62%).

[0414] 1 HNMR (500 MHz, CDC13) δ 8.18 (d, J = 9.6 Hz, 1H), 7.34 (dd, J = 6.1, 8.8 Hz, 1H), 7.06 (d, J = 9.8 Hz, 1H), 6.73 (dd, J = 2.7, 10.0 Hz, 1H), 6.67 (dt, J = 2.7, 8.6 Hz, 1H), 5.54 (s, 2H), 4.69 (quint., J = 4.4 Hz, 1H), 4.02-3.93 (m, 4H), 2.62 (sept., J = 6.9 Hz, 1H), 2.09-2.02 (m, 4H), 1.23 (d, J = 7.1 Hz, 6H).

[0415] [Example 21] Production of (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3,4-thiadiazol-2-yl)methyl isobutyrate (compound No. NUT-29 (ADI-29))

[0416] [Formula 41]

[0417]

[0418] Using (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3,4-thiadiazol-2-yl)methanol (140 mg) manufactured by the same method as in Example 18, iPr2NEt (81 µL), DMAP (10 mg), and isobutyl chloride (81 µL), reaction treatment was performed according to the method described in Example 20 to obtain the labeled target substance (148 mg, yield 97%).

[0419] 1HNMR (500 MHz, CDC13) δ 7.86 (d, J = 8.8 Hz, 2H), 7.33 (dd, J = 6.4, 8.8 Hz, 1H), 6.98 (d, J = 8.8 Hz, 2H), 6.73 (dd, J = 3.0, 10.3 Hz, 1H), 6.69-6.65 (m, 1H), 5.51 (s, 2H), 4.61-4.56 (m, 1H), 3.66-3.61 (m, 2H), 3.42-3.38 (m, 2H), 2.67 (sept., J = 7.1 Hz, 1H), 2.12-2.01 (m, 4H), 1.23 (d, J = 6.9 Hz, 6H).

[0420] [Example 22] Production of (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3,4-thiadiazol-2-yl)methyl propanoate (Compound No. NUT-46)

[0421] [Chemical Formula 42]

[0422]

[0423] Using (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3,4-thiadiazol-2-yl)methanol (27 mg) manufactured in the same manner as in Example 18, iPr2NEt (18 μL), DMAP (2 mg), and propionyl chloride (7 μL), reaction treatment was performed in the same manner as described in Example 20 to obtain the target product (24 mg, yield 78%).

[0424] 1 HNMR (500 MHz, CDC13) δ 7.85 (d, J = 8.6 Hz, 2H), 7.33 (dd, J = 6.1, 8.6 Hz, 1H), 6.97 (d, J = 8.6 Hz, 2H), 6.73 (dd, J = 2.7, 10.3 Hz, 1H), 6.66 (dt, J = 2.4, 8.6 Hz, 1H), 5.51 (s, 2H), 4.61-4.57 (m, 1H), 3.65-3.60 (m, 2H), 3.42-3.37 (m, 2H), 2.45 (q, J = 7.6 Hz, 2H), 2.11-2.00 (m, 4H), 1.20 (t, J = 7.6 Hz, 3H).

[0425] [Example 23] Production of (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3,4-thiadiazol-2-yl)methyl butanoate (Compound No. NUT-65)

[0426] [Chemical Formula 43]

[0427]

[0428] Using (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3,4-thiadiazol-2-yl)methanol (27 mg) manufactured in the same manner as in Example 18, iPr2NEt (18 μL), DMAP (2 mg), and butyryl chloride (7 μL), reaction treatment was performed in the same manner as described in Example 20, to obtain the labeled target (21 mg, yield 71%).

[0429] 1 HNMR (500 MHz, CDC13) δ 7.84 (d, J = 8.8 Hz, 2H), 7.33 (dd, J = 6.1, 8.8 Hz, 1H), 6.97 (d, J = 9.0 Hz, 2H), 6.72 (dd, J = 2.7, 10.0 Hz, 1H), 6.66 (dt, J = 2.7, 8.3 Hz, 1H), 5.50 (s, 2H), 4.59-4.57 (m, 1H), 3.65-3.60 (m, 2H), 3.41-3.37 (m, 2H), 2.40 (t, J = 7.3 Hz, 2H), 2.11-2.01 (m, 4H), 1.71 (q, J = 7.6 Hz, 2H), 0.98 (t, J = 7.4 Hz, 3H).

[0430] [Example 24] Production of (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3,4-thiadiazol-2-yl)methyl valerate (compound no.: NUT-47)

[0431] [Chemical Formula 44]

[0432]

[0433] Using (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3,4-thiadiazol-2-yl)methanol (27 mg) manufactured in the same manner as in Example 18, iPr2NEt (18 μL), DMAP (2 mg), and valeryl chloride (10 μL), reaction treatment was performed in the same manner as described in Example 20, to obtain the labeled target (26 mg, yield 80%).

[0434] 1HNMR (500 MHz, CDC13) δ 7.85 (d, J = 8.8 Hz, 2H), 7.33 (dd, J = 6.1, 8.8 Hz, 1H), 6.97 (d, J = 8.6 Hz, 2H), 6.72 (dd, J = 2.7, 10.3 Hz, 1H), 6.66 (dt, J = 3.0, 8.8 Hz, 1H), 5.50 (s, 2H), 4.60-4.54 (m, 1H), 3.65-3.60 (m, 2H), 3.41-3.37 (m, 2H), 2.42 (t, J = 7.4 Hz, 2H), 2.11-1.99 (m, 4H), 1.78-1.63 (m, 2H), 1.40-1.34 (m, 2H), 0.93 (t, J = 7.4 Hz, 3H).

[0435] [Example 25] Production of 5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3,4-thiadiazol-2-yl)methylcyclobutanecarboxylate (Compound No. NUT-48)

[0436] [Chemical Formula 45]

[0437]

[0438] Using (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3,4-thiadiazol-2-yl)methanol (27 mg) manufactured in the same manner as in Example 18, iPr2NEt (18 μL), DMAP (2 mg), and cyclobutyryl chloride (9 μL), reaction treatment was performed in the same manner as described in Example 20, to obtain the target product (24 mg, yield 75%).

[0439] 1 HNMR (500 MHz, CDC13) δ 7.85 (d, J = 8.8 Hz, 2H), 7.33 (dd, J = 6.1, 8.8 Hz, 1H), 6.97 (d, J = 8.6 Hz, 2H), 6.72 (dd, J = 2.7, 10.3 Hz, 1H), 6.66 (dt, J = 3.0, 8.8 Hz, 1H), 5.50 (s, 2H), 4.60-4.54 (m, 1H), 3.65-3.60 (m, 2H), 3.41-3.37 (m, 2H), 2.42 (t, J = 7.4 Hz, 2H), 2.11-1.99 (m, 4H), 1.78-1.63 (m, 2H), 1.40-1.34 (m, 2H), 0.93 (t, J = 7.4 Hz, 3H).

[0440] [Example 26] Production of (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3,4-thiadiazol-2-yl)methyl benzoate (Compound No. NUT-49)

[0441] [Chemical Formula 46]

[0442]

[0443] Using (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3,4-thiadiazol-2-yl)methanol (27 mg) manufactured in the same manner as in Example 18, iPr2NEt (29 μL), DMAP (2 mg), and benzoyl chloride (16 μL), reaction treatment was performed in the same manner as described in Example 20 to obtain the labeled target (29 mg, yield 88%).

[0444] 1 HNMR (500 MHz, CDC13) δ 8.10 (d, J = 8.1 Hz, 2H), 7.85 (d, J = 8.6 Hz, 2H), 7.61 (t, J = 7.6 Hz, 1H), 7.48 (t, J = 7.8 Hz, 2H), 7.32 (dd, J = 6.1, 8.6 Hz, 1H), 6.96 (d, J = 8.6 Hz, 2H), 6.72 (dd, J = 2.7, 10.3 Hz, 1H), 6.66 (dt, J = 2.2, 7.8 Hz, 1H), 5.75 (s, 2H), 4.60-4.56 (m, 1H), 3.65-3.60 (m, 2H), 3.41-3.36 (m, 2H), 2.12-2.00 (m, 4H).

[0445] [Example 27] Production of (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3,4-thiadiazol-2-yl)methyl cyclopropanecarboxylate (Compound No. NUT-50)

[0446] [Chemical Formula 47]

[0447]

[0448] Using (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3,4-thiadiazol-2-yl)methanol (30 mg) manufactured in the same manner as in Example 18, iPr2NEt (18 μL), DMAP (2 mg), and cyclopropanecarbonyl chloride (8 μL), reaction treatment was performed in the same manner as described in Example 20 to obtain the labeled target (24 mg, yield 70%).

[0449] 1 HNMR (500 MHz, CDC13) δ 7.85 (d, J = 8.8 Hz, 2H), 7.33 (dd, J = 6.1, 8.8 Hz, 1H), 6.97 (d, J = 9.1 Hz, 2H), 6.72 (dd, J = 2.7, 10.3 Hz, 1H), 6.68 - 6.65 (m, 1H), 5.50 (s, 2H), 4.62 - 4.55 (m, 1H), 3.65 - 3.60 (m, 2H), 3.42 - 3.37 (m, 2H), 2.10 - 2.07 (m, 4H), 1.75 - 1.69 (m, 1H), 1.11 - 1.08 (m, 2H), 0.98 - 0.94 (m, 2H).

[0450] [Example 28] Production of 5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3,4-thiadiazol-2-yl)methyl cyclopentanecarboxylate (Compound No. NUT-60)

[0451] [Chemical Formula 48]

[0452]

[0453] Using (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3,4-thiadiazol-2-yl)methanol (27 mg) manufactured in the same manner as in Example 18, iPr2NEt (16 μL), DMAP (2 mg), and cyclopentanecarbonyl chloride (9 μL), reaction treatment was performed in the same manner as described in Example 20 to obtain the target product (25 mg, yield 81%).

[0454] 1 HNMR (500 MHz, CDC13) δ 7.85 (d, J = 8.8 Hz, 2H), 7.33 (dd, J = 6.1, 8.8 Hz, 1H), 6.97 (d, J = 9.1 Hz, 2H), 6.72 (dd, J = 2.7, 10.3 Hz, 1H), 6.68 - 6.65 (m, 1H), 5.50 (s, 2H), 4.62 - 4.55 (m, 1H), 3.65 - 3.60 (m, 2H), 3.42 - 3.37 (m, 2H), 2.10 - 2.07 (m, 4H), 1.75 - 1.69 (m, 1H), 1.11 - 1.08 (m, 2H), 0.98 - 0.94 (m, 2H).

[0455] [Example 29] Production of 2-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)phenyl)thiazol-4-yl)methyl isobutyrate (Compound No. NUT-64)

[0456] [Chemical Formula 49]

[0457]

[0458] (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)phenyl)-l,3,4-thiadiazol-2-yl)methanol (25 mg) produced by the same method as Example 18 was dissolved in dichloromethane (3 mL), the reaction solution was cooled to 0°C, iPr2NEt (16 μL), DMAP (2 mg), and isobutyl chloride (8 μL) were added, and stirring was performed at room temperature for 10 hours. After the reaction, the reaction solution was diluted with water and extracted with ethyl acetate. The extract was washed with saturated brine in this order and dried over magnesium sulfate. After the solvent was removed by distillation under reduced pressure, the residue was purified by column chromatography (developing agent: ethyl acetate: hexane = 1:2) to obtain the labeled target substance (22 mg, yield 74%).

[0459] 1 HNMR (500 MHz, CDC13) δ 7.84 (d, J = 8.3 Hz, 2H), 7.32 (dd, J = 6.1, 8.8 Hz, IH), 7.14 (s, IH), 6.96 (d, J = 8.6 Hz, 2H), 6.72 (dd, J = 2.7, 10.1 Hz, IH), 6.68-6.64 (m, IH), 5.27 (s, 2H), 4.57-4.54 (m, IH), 3.62-3.57 (m, 2H), 3.36-3.31 (m, 2H), 2.66 (sept, J = 6.8 Hz, IH), 2.12-2.00 (m, 4H), 1.22 (d, J = 6.8 Hz, 6H).

[0460] The scheme generalizing this Example 29 is described below.

[0461] [Scheme 7]

[0462] [Chemical Formula 50]

[0463]

[0464] (In the formula, each symbol represents the same meaning as described above.)

[0465] [Example 30] Production of 5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)phenyl)-l,3,4-oxadiazol-2-yl)methyl acetate

[0466] [Chemical Formula 51]

[0467]

[0468] Using 2-(2-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)benzoyl)hydrazino)-2- oxoethyl acetate (200 mg) produced in the procedure (b) of Example 11 and phosphoryl chloride (4 mL), reaction treatment was performed according to the method described in Example 5 to obtain the marked target (160 mg, yield 83%).

[0469] 1 HNMR (500 MHz, CDC13) δ 7.92 (d, J = 9.1 Hz, 2H), 7.32 (dd, J = 6.1, 8.8 Hz, IH), 6.98 (d, J = 8.8 Hz, H), 6.72 (dd, J = 3.6, 10.3 Hz, IH), 6.66 (dt, J = 2.7, 8.1 Hz, IH), 5.32 (s, 2H), 4.61-4.56 (m, IH), 3.66-3.61 (m, 2H), 3.44-3.39 (m, 2H), 2.18 (s, 3H), 2.09-2.00 (m, 4H).

[0470] [Example 31] Production of (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)phenyl)-l,3,4- oxadiazol-2-yl)methanol (Cpd. No. NUT-81)

[0471] [Chemical Formula 52]

[0472]

[0473] Using 2-(2-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)benzoyl)hydrazino)-2- oxoethyl acetate (200 mg) produced in the procedure (b) of Example 11 and phosphoryl chloride (4 mL), reaction treatment was performed according to the method described in Example 5 to obtain the marked target (160 mg, yield 83%).

[0474] 1HNMR (500 MHz, CDC13) δ 7.92 (d, J = 8.8 Hz, 2H), 7.33 (dd, J = 6.1, 8.6 Hz, 1H), 6.98 (d, J = 8.8 Hz, H), 6.72 (dd, J = 2.7, 10.1 Hz, 1H), 6.66 (dt, J = 2.9, 8.1 Hz, 1H), 4.92 (d, J = 6.6 Hz, 2H), 4.60-4.57 (m, 1H), 3.65-3.61 (m, 2H), 3.44-3.40 (m, 2H), 3.11 (br. s, OH), 2.09-1.99 (m, 4H).

[0475] [Example 32] Production of 5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3,4-oxadiazol-2-yl)methyl isobutyrate (Compound No. NUT-67)

[0476] [Chemical Formula 53]

[0477]

[0478] Using (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3,4-oxadiazol-2-yl)methanol (70 mg) produced in the same manner as in Example 31, iPr2NEt (45 μL), DMAP (5 mg), and isobutyl chloride (22 μL), reaction treatment was performed in accordance with the method described in Example 20, to obtain the target product (68 mg, yield 83%).

[0479] 1 HNMR (500 MHz, CDC13) δ 7.93 (d, J = 9.1 Hz, 2H), 7.33 (dd, J = 6.1, 8.8 Hz, 1H), 6.99 (d, J = 8.8 Hz, 2H), 6.73 (dd, J = 2.7, 10.0 Hz, 1H), 6.67 (dt, J = 2.7, 8.6 Hz, 1H), 5.33 (s, 2H), 4.61-4.58 (m, 1H), 3.67-3.62 (m, 2H), 3.45-3.40 (m, 2H), 2.68 (sept., J = 7.1 Hz, 1H), 2.12-1.99 (m, 4H), 1.23 (d, J = 6.9 Hz, 6H).

[0480] [Reference Production Example 11] Production of methyl 4-(4-(2-methylphenoxy)piperidin-1-yl)benzoate

[0481] Using methyl 4-bromobenzoate (1.0 g), 4-(2-methylphenoxy)piperidine (918 mg), Pd2(dpa)3(44 mg), Xantphos (69 mg), and cesium carbonate (2.4 g), the reaction treatment was performed according to the method described in Reference Production Example 8 to obtain the labeled target (797 mg, yield 51%).

[0482] 1 HNMR (400 MHz, CDC13) δ 7.93 (d, J = 9.1 Hz, 2H), 7.18-7.14 (m, 2H), 6.92-6.86 (m, 4H), 4.60-4.55 (m, IH), 3.88 (s, 3H), 3.64-3.59 (m, 2H), 3.41-3.35 (m, 2H), 2.25 (s, 3H), 2.11-2.04 (m, 2H), 2.00-1.94 (m, 2H).

[0483] [Reference Production Example 12] Production of methyl 4-(4-(2-fluorophenoxy)piperidin-l-yl)benzoate

[0484] Using methyl 4-bromobenzoate (959 mg), 4-(2-fluorophenoxy)piperidine (870 mg), Pd2(dpa)3(41 mg), Xantphos (65 mg), and cesium carbonate (2.2 g), the reaction treatment was performed according to the method described in Reference Production Example 8 to obtain the labeled target (1.1 g, yield 77%).

[0485] 1 HNMR (500 MHz, CDC13) δ 7.92 (d, J = 8.8 Hz, 2H), 7.12-7.02 (m, 3H), 6.98-6.95 (m, IH), 6.90 (d, J = 8.8 Hz, 2H), 4.53-4.50 (m, IH), 3.88 (s, 3H), 3.72-3.67 (m, 2H), 3.33-3.28 (m, 2H), 2.10-2.06 (m, 2H), 1.98-1.93 (m, 2H).

[0486] [Reference Production Example 13] Production of methyl 4-(4-(2-(trifluoromethyl)phenoxy)piperidin-l-yl)benzoate

[0487] Methyl 4-bromobenzoate (758 mg) and 4-(2-(trifluoromethyl)phenoxy)piperidine (1.2 g) were dissolved in 1,2-dimethoxyethane (18 mL), Pd2(dpa)3 (160 mg), S-phos (144 mg), and potassium phosphate tribasic (1.6 g) were added, and stirring was performed at 80°C for 12 hours. After the reaction, the reaction solution was diluted with water and extracted with ethyl acetate. The extract was washed with water and saturated brine in this order, and dried over magnesium sulfate. After the solvent was distilled off under reduced pressure, the residue was purified by column chromatography (developing agent: ethyl acetate: hexane = 1:4) to obtain the title compound (334 mg, yield 25%).

[0488] 1 HNMR (500 MHz, CDC13) δ 7.92 (d, J = 8.8 Hz, 2H), 7.59 (d, J = 7.9 Hz, 1H), 7.48 (t, J = 7.6 Hz, 1H), 7.02-6.99 (m, 2H), 6.69 (d, J = 8.8 Hz, 2H), 4.74-4.69 (m, 1H), 3.86 (s, 3H), 3.59-3.54 (m, 2H), 3.46-3.42 (m, 2H), 2.06-1.99 (m, 4H).

[0489] [Reference Production Example 14] Production of Methyl 4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)-2-(methoxymethoxy)benzoate

[0490] Using methyl 4-bromo-2-(methoxymethoxy)benzoate (1.43 g), 2-chloro-5-fluorophenoxy)piperidine (1.0 g), Pd2(dpa)3 (39 mg), Xantphos (62 mg), and cesium carbonate (2.2 g), reaction treatment was performed according to the method described in Reference Production Example 8 to obtain the title compound (887 mg, yield 48%).

[0491] 1 HNMR (500 MHz, CDC13) δ 7.80 (d, J = 8.8 Hz, 1H), 7.33 (dd, J = 6.2, 8.8 Hz, 1H), 6.72 (dd, J = 2.7, 10.3 Hz, 1H), 6.67-6.57 (m, 2H), 5.25 (s, 2H), 4.61-4.54 (m, 1H), 3.85 (s, 3H), 3.63-3.59 (m, 2H), 3.54 (s, 3H), 3.41-3.36 (m, 2H), 2.11-1.96 (m, 4H).

[0492] [Reference Production Example 14] Production of Methyl 4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)-2-(methoxymethoxy)benzoate

[0493] Using methyl 4-bromo-2-methoxybenzoate (1.15 g), 2-chloro-5-fluorophenoxy)piperidine (900 mg), Pd2(dpa)3(39 mg), Xantphos (62 mg), and cesium carbonate (2.2 g), reaction treatment was performed according to the method described in Reference Production Example 8 to obtain the labeled target (511 mg, yield 33%).

[0494] 1 HNMR (500 MHz, CDC13) δ 7.81 (d, J = 8.8 Hz, 1H), 7.33 (dd, J = 6.1, 8.8 Hz, 1H), 6.72 (dd, J = 2.7, 10.1 Hz, 1H), 6.66 (dt, J = 2.7, 8.1 Hz, 1H), 6.50 (dd, J = 2.2, 8.8 Hz, 1H), 6.41 (d, J = 2.2 Hz, 1H), 4.60-4.57 (m, 1H), 3.91 (s, 3H), 3.85 (s, 3H), 3.65-3.60 (m, 2H), 3.42-3.38 (m, 2H), 2.11-1.98 (m, 4H).

[0495] [Production of (5-(2-(2-aminoethoxy)-4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3,4-thiadiazol-2-yl)methyl acetate (Compound No. NUT-39)]

[0496] [Chemical Formula 54]

[0497]

[0498] [Production of 4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)-2-(methoxymethoxy)benzohydrazide in the procedure (a) of Example 33]

[0499] Using methyl 4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)-2-(methoxymethoxy)benzoate (887 mg) and hydrazine monohydrate (2.7 mL), reaction treatment was performed according to the method described in the procedure (a) of Example 1 to obtain the crude product of the labeled target (770 mg, crude yield 87%).

[0500] [Production of 2-(2-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)-2-(methoxymethoxy)benzoyl)hydrazino)-2-oxoethyl acetate in the procedure (b) of Example 33]

[0501] A portion of the crude product of 4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)-2- (methoxymethoxy)benzohydrazide produced in the above procedure (a) (700 mg), iPr2NEt (346 μL), and acetoxyacetyl chloride (180 μL) were subjected to reaction treatment in accordance with the method described in procedure (b) of Example 1, to obtain the labeled target (700 mg).

[0502] 1 HNMR (300 MHz, CDC13) δ 7.60 (d, J = 9.4 Hz, 0.5H), 7.35-7.30 (m, 1.5H), 6.73-6.56 (m, 4H), 5.46 (s, 1H), 5.33 (s, 1H), 4.63-4.53 (m, 1H), 3.68-3.60 (m, 2H), 3.46-3.37 (m, 2H), 2.18 (s, 1.5H), 2.17 (s, 1.5H), 2.11-1.93 (m, 4H).

[0503] [Procedure (c) of Example 33] Production of (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)-2-hydroxyphenyl)-l,3,4-thiadiazol-2-yl)methyl acetate

[0504] A portion of the crude product of 4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)-2- (methoxymethoxy)benzohydrazide produced in the above procedure (a) (700 mg), iPr2NEt (346 μL), and acetoxyacetyl chloride (180 μL) were subjected to reaction treatment in accordance with the method described in procedure (b) of Example 1, to obtain the labeled target (700 mg).

[0505] 1 HNMR (300 MHz, CDC13) δ 7.60 (d, J = 9.4 Hz, 0.5H), 7.35-7.30 (m, 1.5H), 6.73-6.56 (m, 4H), 5.46 (s, 1H), 5.33 (s, 1H), 4.63-4.53 (m, 1H), 3.68-3.60 (m, 2H), 3.46-3.37 (m, 2H), 2.18 (s, 1.5H), 2.17 (s, 1.5H), 2.11-1.93 (m, 4H).

[0506] Preparation of [Example 33, procedure (d)] (5-(2-(2-aminoethoxy)-4-(2-chloro-5- fluorophenoxy)piperidin-1-yl)phenyl)-1,3,4-thiadiazol-2-yl)methyl acetate

[0507] The (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)pyridazin-3-yl)-2- (2-(5-((3aS,4S,6aR)-2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl)pentanamido)ethoxy) phenyl)-1,3,4-thiadiazol-2-yl)methyl acetate (Compound No. NUT-40) was prepared according to the procedure described in Example 34.

[0508] 1 HNMR (500 MHz, CDCl3) δ 8.34 (d, J = 8.8 Hz, 1H), 7.33 (dd, J = 5.9, 8.8 Hz, 1H), 6.72 (dd, J = 2.7, 10.3 Hz, 1H), 6.68-6.65 (m, 2H), 6.48 (d, J = 2.2 Hz, 1H), 5.50 (s, 2H), 4.61-4.58 (m, 1H), 4.21 (t, J = 5.2 Hz, 2H), 3.65-3.60 (m, 2H), 3.43-3.38 (m, 2H), 3.28 (t, J = 5.2 Hz, 2H), 2.16 (s, 3H), 2.10-2.00 (m, 4H).

[0509] [Example 34] Preparation of (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)pyridazin-3-yl)-2-(2-(5-((3aS,4S,6aR)-2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl)pentanamido)ethoxy)phenyl)-1,3,4-thiadiazol-2-yl)methyl acetate (Compound No. NUT-40)

[0510] [Chemical Formula 55]

[0511]

[0512] (5-(2-(2-aminoethoxy)-4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)phenyl)-l,3,4- thiazol-2-yl)methyl acetate (55 mg) manufactured by the same method as Example 33 was dissolved in DMF (1 mL), and further Biotin NHS (46 mg) was added, and stirred at room temperature for 12 hours. After the reaction, the solvent was distilled off under reduced pressure, and the residue was purified by column chromatography (developing solvent: dichloromethane:methanol = 95:5) to obtain the labeled target (25 mg, yield 32%).

[0513] 1 HNMR (500 MHz, CDC13) δ 8.23 (d, J = 8.8 Hz, IH), 7.33 (dd, J = 6.1, 8.8 Hz, IH), 6.73 (dd, J = 2.7, 10.3 Hz, IH), 6.68-6.58 (m, 3H), 5.50 (s, 2H), 4.64-4.58 (m, IH), 4.43-4.40 (m, IH), 4.31-4.24 (m, 2H), 4.20-4.16 (m, IH), 3.80-3.77 (m, 2H), 3.67-3.61 (m, 2H), 3.44-3.40 (m, 2H), 3.05-3.01 (m, IH), 2.84 (dd, J = 4.9, 12.9 Hz, IH), 2.68 (d, J = 12.9 Hz, IH), 2.36-2.26 (m, 4H), 2.15 (s, 3H), 2.05-2.00 (m, 4H), 1.70-1.58 (m, 4H), 1.43-1.35 (m, 2H).

[0514] [Example 35] Manufacture of (5-4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)-2- methoxyphenyl)-l,3,4-thiazol-2-yl)methyl acetate (Compound No.: NUT-53)

[0515] [Chemical Formula 56]

[0516]

[0517] [Example 35] Manufacture of (5-4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)-2- methoxyphenyl)-l,3,4-thiazol-2-yl)methyl acetate (Compound No.: NUT-53)

[0518] Using methyl 4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)-2-methoxybenzoate (510 mg) manufactured in Reference Production Example 15 and hydrazine monohydrate (1.0 mL), reaction treatment was performed according to the method described in Example 1, procedure (a) to obtain the crude product of the labeled target (500 mg, crude yield 98%).

[0519] Preparation of [Example 35, step (b)] 2-(2-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)-2-methoxybenzoyl)hydrazino)-2-oxoethyl acetate

[0520] A part of the crude product of 4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)-2-methoxybenzohydrazide (400 mg) prepared in the above-mentioned step (a), iPr2NEt (262 μL), and acetoxyacetyl chloride (130 μL) were subjected to reaction treatment according to the method described in step (b) of Example 1, to obtain the labeled target (182 mg).

[0521] 1 HNMR (500 MHz, CDC13) δ 10.4 (d, J = 6.9 Hz, NH), 9.29 (d, J = 6.6 Hz, NH), 8.05 (d, J = 8.8 Hz, 1H), 7.33 (dd, J = 5.9, 8.6 Hz, 1H), 6.73-6.62 (m, 3H), 6.41 (s, 1H), 4.74 (s, 2H), 4.63-4.58 (m, 1H), 4.03 (s, 3H), 3.65-3.61 (m, 2H), 3.45-3.41 (m, 2H), 2.21 (s, 3H), 2.11-2.01 (m, 4H).

[0522] Preparation of [Example 35, step (c)] (5-4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)-2-methoxyphenyl)-l,3,4-thiadiazol-2-yl)methyl acetate

[0523] A part of the crude product of 4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)-2-methoxybenzohydrazide (400 mg) prepared in the above-mentioned step (a), iPr2NEt (262 μL), and acetoxyacetyl chloride (130 μL) were subjected to reaction treatment according to the method described in step (b) of Example 1, to obtain the labeled target (182 mg).

[0524] 1HNMR (500 MHz, CDC13) δ 8.35 (d, J = 8.8 Hz, IH), 7.33 (dd, J = 6.1, 8.8 Hz, IH), 6.73 (dd, J = 2.7, 10.3 Hz, IH), 6.68-6.64 (m, 2H), 6.49 (s, IH), 5.52 (s, 2H), 4.63-4.56 (m, IH), 4.00 (s, 3H), 3.66-3.61 (m, 2H), 3.43-3.39 (m, 2H), 2.16 (s, 3H), 2.13-2.02 (m, 4H).

[0525] [Example 36] Production of (5-4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)-2-methoxyphenyl)-l,3,4-thiadiazol-2-yl)methanol (Compound No. NUT-54)

[0526] [Formula 57]

[0527]

[0528] Using (5-4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)-2-methoxyphenyl)-l,3,4- thiadiazol-2-yl)methyl acetate (28 mg) produced in the above Example 35, process (c) and lithium hydroxide monohydrate (6 mg), reaction treatment was performed according to the method described in Example 15, to obtain the target product (20 mg, yield: 78%).

[0529] 1 HNMR (500 MHz, CDC13) δ 8.35 (d, J = 8.8 Hz, IH), 7.33 (dd, J = 6.1, 8.8 Hz, IH), 6.73 (dd, J = 2.7, 10.3 Hz, IH), 6.68-6.64 (m, 2H), 6.49 (s, IH), 5.52 (s, 2H), 4.63-4.56 (m, IH), 4.00 (s, 3H), 3.66-3.61 (m, 2H), 3.43-3.39 (m, 2H), 2.16 (s, 3H), 2.13-2.02 (m, 4H).

[0530] [Example 37] Production of 5-(4-(4-phenoxy piperidin-l-yl)phenyl)-l,3,4-thiadiazol-2-yl)methanol (Compound No. NUT-68)

[0531] [Formula 58]

[0532]

[0533] [Preparation of 4-(4-phenoxy-piperidin-1-yl)benzohydrazide]

[0534] Using 4-(4-phenoxy)piperidin-1-yl)benzoic acid methyl ester (800 mg) and hydrazine monohydrate (2.5 mL), reaction treatment was performed according to the method described in procedure (a) of Example 1, to obtain the crude product of the target (482 mg, crude yield 60%).

[0535] [Preparation of 2-(2-(4-(4-phenoxy-piperidin-1-yl)benzoyl)hydrazino)-2-oxo-ethyl acetate]

[0536] Using a part of the crude product of 4-(4-phenoxy-piperidin-1-yl)benzohydrazide (465 mg) prepared in the above procedure (a), iPr2NEt (312 μL), and acetoxyacetyl chloride (194 μL), reaction treatment was performed according to the method described in procedure (b) of Example 1, to obtain the target (466 mg).

[0537] 1 HNMR (500 MHz, CDC13) δ 9.23 (d, J = 5.6 Hz, 1H), 8.88 (d, J = 5.6 Hz, 2H), 7.75 (d, 8.6 Hz, 2H), 7.30 (t, J = 7.6 Hz, 2H), 6.97 (t, J = 7.3 Hz, 1H), 6.94 (d, J = 8.6 Hz, 2H), 6.91 (d, J = 8.8 Hz, 2H), 4.70 (s, 2H), 4.56-4.54 (m, 1H), 3.67-3.62 (m, 2H), 3.34-3.29 (m, 2H), 2.20 (s, 3H), 2.10-2.06 (m, 2H), 1.97-1.92 (m, 2H).

[0538] [Preparation of 2-(2-(4-(4-phenoxy-piperidin-1-yl)benzoyl)hydrazino)-2-oxo-ethyl acetate]

[0539] The 2-(2-(4-(4-phenoxy-piperidin-1-yl)benzoyl)hydrazino)-2-oxo-ethyl acetate (411 mg) prepared in the above procedure (b) was dissolved in THF (25 mL), and Lawesson's reagent (445 mg) was added, and stirred at 80°C for 12 hours. After the reaction, the solvent was distilled off under reduced pressure, and the residue was purified by column chromatography (developing solvent: ethyl acetate: hexane = 1:1) to obtain the target (121 mg, yield 29%).

[0540] 1HNMR (500 MHz, CDC13) δ 7.85 (d, J = 8.3 Hz, 2H), 7.31 (t, J = 7.6 Hz, 2H), 6.99-6.94 (m, 5H), 5.50 (s, 2H), 4.58-4.53 (m, IH), 3.67-3.63 (m, 2H), 3.34-3.29 (m, 2H), 2.17 (s, 3H), 2.13-2.08 (m, 2H), 1.98-1.94 (m, 2H).

[0541] [Example 37, step (d)] Preparation of 5-(4-(4-phenoxy-piperidin-l-yl)phenyl)-l,3,4-thiadiazol-2-yl)methanol

[0542] Using 5-(4-(4-phenoxy-piperidin-l-yl)phenyl)-l,3,4-thiadiazol-2-yl)methyl acetate (100 mg) prepared in the above step (c) and lithium hydroxide monohydrate (51 mg), the reaction treatment was performed according to the method described in Example 15 to obtain the labeled target (88 mg, yield 99%).

[0543] 1 HNMR (500 MHz, CDC13) δ 7.85 (d, J = 8.3 Hz, 2H), 7.31 (t, J = 7.6 Hz, 2H), 6.99-6.94 (m, 5H), 5.50 (s, 2H), 4.58-4.53 (m, IH), 3.67-3.63 (m, 2H), 3.34-3.29 (m, 2H), 2.17 (s, 3H), 2.13-2.08 (m, 2H), 1.98-1.94 (m, 2H).

[0544] [Example 38] Preparation of 5-(4-(4-(2-chlorophenoxy)piperidin-l-yl)phenyl)-l,3,4-thiadiazol-2-yl)methanol (Compound No. NUT-74)

[0545] [Chemical Formula 59]

[0546]

[0547] Using 5-(4-(4-(2-chlorophenoxy)piperidin-l-yl)phenyl)-l,3,4-thiadiazol-2-yl)methyl acetate (75 mg) prepared in the step (c) of Example 12 and lithium hydroxide monohydrate (36 mg), the reaction treatment was performed according to the method described in Example 15 to obtain the labeled target (50 mg, yield 74%).

[0548] 1HNMR (500 MHz, CDC13) δ 7.84 (d, J = 8.1 Hz, 2H), 7.40 (dd, J = 1.5, 7.9 Hz, 1H), 7.22 (dt, J = 1.3, 8.6 Hz, 1H), 7.01 - 6.92 (m, 4H), 5.09 (s, 2H), 3.68 - 3.63 (m, 2H), 3.39 - 3.35 (m, 2H), 2.82 (br. s, OH), 2.10 - 2.02 (m, 4H).

[0549] [Example 39] Production of (5-(4-(4-(2-methylphenoxy)piperidin-l-yl)phenyl)-l,3,4-thiadiazol-2-yl)methanol (Compound No. NUT-75)

[0550] [Chemical Formula 60]

[0551]

[0552] [Example 39, Step (a)] Production of 4-(4-(2-methylphenoxy)piperidin-l-yl)benzohydrazide

[0553] Using methyl 4-(4-(2-methylphenoxy)piperidin-l-yl)benzoate (750 mg) and hydrazine monohydrate (2.5 mL) produced in Reference Production Example 11, the reaction treatment was performed according to the method described in Step (a) of Example 1, to obtain the crude product of the target substance (485 mg, crude yield 65%).

[0554] [Example 39, Step (b)] Production of 2-(2-(4-(4-(2-methylphenoxy)piperidin-l-yl)benzoyl)hydrazino)-2-oxoethyl acetate

[0555] Using a part of the crude product of 4-(4-(2-methylphenoxy)piperidin-l-yl)benzohydrazide (485 mg) produced in Step (a) above, iPr2NEt (312 μL), and acetoxyacetyl chloride (194 μL), the reaction treatment was performed according to the method described in Step (b) of Example 1, to obtain the target substance (380 mg).

[0556] 1HNMR (400 MHz, CDC13) δ 7.85 (d, J = 9.0 Hz, 2H), 7.18-7.15 (m, 2H), 6.98 (d, J = 9.0 Hz, 2H), 6.91-6.87 (m, 2H) 5.50 (s, 2H), 4.60-4.57 (m, IH), 3.63-3.58 (m, 2H), 3.40-3.35 (m, 2H), 2.25 (s, 3H), 2.18 (s, 3H), 2.12-2.06 (m, 2H), 2.03-1.96 (m, 2H).

[0557] [Procedure (c) of Example 39] Production of 5-(4-(4-(2-methylphenoxy)piperidin-l-yl)phenyl)-l,3,4-thiadiazol-2-yl)methyl acetate

[0558] Using 2-(2-(4-(4-(2-methylphenoxy)piperidin-l-yl)benzoyl)hydrazino)-2- oxoethyl acetate (340 mg) produced in the above procedure (b) and Lawesson's reagent (355 mg), reaction treatment was performed according to the method described in procedure (c) of Example 37 to obtain the labeled target (380 mg, yield 18%).

[0559] 1 HNMR (400 MHz, CDC13) δ 7.85 (d, J = 9.0 Hz, 2H), 7.18-7.15 (m, 2H), 6.98 (d, J = 9.0 Hz, 2H), 6.91-6.87 (m, 2H) 5.50 (s, 2H), 4.60-4.57 (m, IH), 3.63-3.58 (m, 2H), 3.40-3.35 (m, 2H), 2.25 (s, 3H), 2.18 (s, 3H), 2.12-2.06 (m, 2H), 2.03-1.96 (m, 2H).

[0560] [Procedure (d) of Example 39] Production of (5-(4-(4-(2-methylphenoxy)piperidin-l-yl)phenyl)-l,3,4-thiadiazol-2-yl)methanol

[0561] Using 5-(4-(4-(2-methylphenoxy)piperidin-l-yl)phenyl)-l,3,4-thiadiazol-2-yl)methyl acetate (60 mg) produced in the above procedure (c) and lithium hydroxide monohydrate (30 mg), reaction treatment was performed according to the method described in Example 15 to obtain the labeled target (48 mg, yield 89%).

[0562] 1HNMR (400 MHz, CDC13) δ 7.85 (d, J = 8.2 Hz, 2H), 7.18-7.15 (m, 2H), 6.98 (d, J = 8.8 Hz, 2H), 6.90-6.87 (m, 2H), 5.09 (s, 2H), 4.60-4.57 (m, IH), 3.62-3.57 (m, 2H), 3.39-3.33 (m, 2H), 2.63 (br. s, OH), 2.25 (s, 3H), 2.12-2.06 (m, 2H), 2.03-1.96 (m, 2H).

[0563] [Example 40] Production of (5-(4-(4-(2-fluorophenoxy)piperidin-l-yl)phenyl)-l,3,4-thiadiazol-2-yl)methanol (Compound No. NUT-76)

[0564] [Chemical Formula 61]

[0565]

[0566] [Example 40, Step (a)] Production of 4-(4-(2-fluorophenoxy)piperidin-l-yl)benzohydrazide

[0567] Using methyl 4-(4-(2-fluorophenoxy)piperidin-l-yl)benzoate (1.0 g) and hydrazine monohydrate (3.5 mL) produced in Reference Production Example 12, and according to the method described in Step (a) of Example 1, a reaction treatment was performed to obtain a crude product of the target substance (510 mg, crude yield 51%).

[0568] [Example 40, Step (b)] Production of 2-(2-(4-(4-(2-fluorophenoxy)piperidin-l-yl)benzoyl)hydrazino)-2-oxoethyl acetate

[0569] Using a part of the crude product of 4-(4-(2-fluorophenoxy)piperidin-l-yl)benzohydrazide (494 mg) produced in Step (a) above, iPr2NEt (312 μL), and acetoxyacetyl chloride (194 μL), and according to the method described in Step (b) of Example 1, a reaction treatment was performed to obtain the target substance (537 mg).

[0570] 1HNMR (500 MHz, CDC13) δ 9.09 (br. s, NH), 8.73 (br. s, NH), 7.74 (d, J = 8.8 Hz, 2H), 7.12-7.02 (m, 3H), 6.99-6.94 (m, IH), 6.92 (d, J = 6.9 Hz, 2H), 4.72 (s, 2H), 4.54-4.50 (m, IH), 3.70-3.66 (m, 2H), 3.33-3.29 (m, 2H), 2.21 (s, 3H), 2.09-2.05 (m, 2H), 1.99-1.92 (m, 2H).

[0571] Preparation of 5-(4-(4-(2-fluorophenoxy)piperidin-l-yl)phenyl)-l,3,4-thiadiazol-2- yl)methyl acetate

[0572] Using 2-(2-(4-(4-(2-fluorophenoxy)piperidin-l-yl)benzoyl)hydrazino)-2- oxoethyl acetate (500 mg) prepared in the above procedure (b) and Lawesson's reagent (518 mg), the reaction was performed according to the method described in procedure (c) of Example 37, to give the title compound (130 mg, yield 26%).

[0573] 1 HNMR (500 MHz, CDC13) δ 9.09 (br. s, NH), 8.73 (br. s, NH), 7.74 (d, J = 8.8 Hz, 2H), 7.12-7.02 (m, 3H), 6.99-6.94 (m, IH), 6.92 (d, J = 6.9 Hz, 2H), 4.72 (s, 2H), 4.54-4.50 (m, IH), 3.70-3.66 (m, 2H), 3.33-3.29 (m, 2H), 2.21 (s, 3H), 2.09-2.05 (m, 2H), 1.99-1.92 (m, 2H).

[0574] Preparation of 5-(4-(4-(2-fluorophenoxy)piperidin-l-yl)phenyl)-l,3,4-thiadiazol-2- yl)methyl acetate

[0575] Using 5-(4-(4-(2-fluorophenoxy)piperidin-l-yl)phenyl)-l,3,4-thiadiazol-2- yl)methyl acetate (100 mg) prepared in the above procedure (c) and lithium hydroxide monohydrate (49 mg), the reaction was performed according to the method described in Example 15, to give the title compound (73 mg, yield 82%).

[0576] 1HNMR (500 MHz, CDC13) δ 7.82 (d, J = 8.4 Hz, 2H), 7.11-7.01 (m, 3H), 7.03-6.89 (m, 3H), 5.07 (s, 2H), 3.68-3.65 (m, 2H), 3.29-3.25 (m, 2H), 2.12-2.04 (m, 2H), 2.01-1.91 (m, 2H).

[0577] [Example 41] Manufacture of (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)phenyl)-l,3,4-thiadiazol-2-yl)methanamine (Compound No. NUT-79)

[0578] [Chemical Formula 62]

[0579]

[0580] [Example 41] Manufacture of (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)phenyl)-l,3,4-thiadiazol-2-yl)methanamine (Compound No. NUT-79)

[0581] The 4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)benzhydrazide (1.0 g) manufactured in the process (a) of Example 11 and (tert-butoxycarbonyl)glycine (480 mg) were dissolved in DMF (8 mL), Et3N (760 μL) and HATU (1.0 g) were added, and stirred at room temperature for 24 hours. The solution after the reaction was diluted with water and extracted with ethyl acetate. The extracted solution was washed with water, saturated brine in this order, and dried over magnesium sulfate. Further, after distilling off the solvent under reduced pressure, the residue was purified by column chromatography (developing solvent: ethyl acetate) to obtain the labeled target (1.2 g, yield 85%).

[0582] 1 HNMR (500 MHz, CDC13) δ 7.82 (d, J = 8.4 Hz, 2H), 7.11-7.01 (m, 3H), 7.03-6.89 (m, 3H), 5.07 (s, 2H), 3.68-3.65 (m, 2H), 3.29-3.25 (m, 2H), 2.12-2.04 (m, 2H), 2.01-1.91 (m, 2H).

[0583] Preparation of tert-butyl ((5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)-1,3,4-thiadiazol-2-yl)methyl)carbamate

[0584] Using tert-butyl (2-(2-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)carbonyl)hydrazino)-2-oxoethyl)carbamate (1.0 g) and Lawesson's reagent (850 mg) prepared in the above procedure (a), and following the procedure described in procedure (c) of Example 37, the reaction was carried out to give the title target (587 mg, yield 59%).

[0585] 1 HNMR (500 MHz, CDC13) δ 7.83 (d, J = 8.8 Hz, 2H), 7.33 (t, J = 6.6 Hz, 1H), 6.97 (d, J = 8.6 Hz, 2H), 6.72 (d, J = 10.0 Hz, 1H), 6.67 (t, J = 8.3 Hz, 1H), 6.30 (br. s, NH), 4.72 (d, J = 5.2 Hz, 1H), 4.62-4.52 (m, 1H), 3.68-3.57 (m, 2H), 3.42-3.32 (m, 2H), 2.15-1.97 (m, 4H), 1.49 (s, 9H).

[0586] Preparation of tert-butyl ((5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)-1,3,4-thiadiazol-2-yl)methyl)carbamate

[0587] Tert-butyl ((5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)-1,3,4-thiadiazol-2-yl)methyl)carbamate (580 mg) prepared in the above procedure (b) was dissolved in dichloromethane (5 mL), and TFA (216 µL) was added, and stirred at room temperature for 8 hours. After the reaction, saturated aqueous sodium bicarbonate solution was added to make the reaction solution alkaline, and then extracted with dichloromethane. The extract was washed with water, saturated brine in this order, and dried over magnesium sulfate. After distilling off the solvent under reduced pressure, drying under reduced pressure was performed to give the title target (339 mg, yield 72%).

[0588] 1HNMR (500 MHz, CDC13) δ 7.81 (d, J = 8.8 Hz, 2H), 7.31 (t, J = 8.6 Hz, 1H), 6.95 (d, J = 8.6 Hz, 2H), 6.71 (d, J = 10.3 Hz, 1H), 6.64 (dt, J = 2.5, 8.8 Hz, 1H), 4.61 - 4.52 (m, 1H), 4.28 (s, 2H), 3.61 - 3.57 (m, 2H), 3.42 - 3.34 (m, 2H), 2.13 - 1.87 (m, 4H).

[0589] [Example 42] Production of N-((5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3,4-thiadiazol-2-yl)methyl)isobutyramide (Compound No. NUT-52)

[0590] [Formula 63]

[0591]

[0592] Using (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3,4-thiadiazol-2-yl)methanamine (42 mg) manufactured in the same manner as in Example 41, iPr2NEt (21 μL), and isobutyl chloride (81 μL), reaction treatment was performed in accordance with the method described in Example 20, to obtain the target substance (8 mg, yield 17%).

[0593] 1 HNMR (500 MHz, CDC13) δ 7.82 (d, J = 8.6 Hz, 2H), 7.33 (dd, J = 6.4, 8.8 Hz, 1H), 6.96 (d, J = 8.8 Hz, 2H), 6.72 (dd, J = 2.5, 10.0 Hz, 1H), 6.66 (dt, J = 2.7, 8.1 Hz, 1H), 6.46 (t, J = 5.2 Hz, NH), 4.83 (d, J = 5.9 Hz, 2H), 4.62 - 4.55 (m, 1H), 3.65 - 3.60 (m, 2H), 3.41 - 3.36 (m, 2H), 2.46 (sept, J = 6.9 Hz, 1H), 2.11 - 2.00 (m, 4H), 1.20 (d, J = 6.9 Hz, 6H).

[0594] [Example 43] Production of N-((5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3,4-thiadiazol-2-yl)methyl)acetamide (Compound No. NUT-80)

[0595] [Formula 64]

[0596]

[0597] (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)phenyl)-l,3,4-thiadiazol-2- yl)methylamine (42 mg) manufactured by the same method as Example 41 was dissolved in dichloromethane (4.0 mL), acetic anhydride (11 μL) was added, and stirred at room temperature for 12 hours. After the reaction, the solvent was distilled off under reduced pressure, and the residue was purified by column chromatography (developing agent: ethyl acetate) to obtain the labeled target (16 mg, yield 35%).

[0598] 1 HNMR (500 MHz, CDC13) δ 7.79 (d, J = 8.8 Hz, 2H), 7.1 (dd, J = 5.9, 8.6 Hz, 1H), 6.94 (d, J = 8.8 Hz, 2H), 6.80 (t, J = 5.2 Hz, NH), 6.70 (dd, J = 2.7, 10.0 Hz, 1H), 6.66-6.63 (m, 1H), 4.80 (d, J = 5.9 Hz, 2H), 4.59-4.53 (m, 1H), 3.63-3.58 (m, 2H), 3.39-3.34 (m, 2H), 2.10-1.99 (m, 7H).

[0599] [Production of 5-(4-(4-(2-(trifluoromethyl)phenoxy)piperidin-l-yl)phenyl)-l,3,4- thiadiazol-2-yl)methyl acetate (Compound No. NUT-83)]

[0600] [Chemical Formula 65]

[0601]

[0602] [Production of 5-(4-(4-(2-(trifluoromethyl)phenoxy)piperidin-l-yl)phenyl)-l,3,4- thiadiazol-2-yl)methyl acetate (Compound No. NUT-83)]

[0603] Using 4-(4-(2-(trifluoromethyl)phenoxy)piperidin-l-yl)benzoic acid methyl ester (334 g) manufactured in Reference Production Example 13 and hydrazine monohydrate (1.5 mL), reaction treatment was performed according to the method described in the process (a) of Example 1 to obtain a crude product of the labeled target (273 mg, crude yield 82%).

[0604] [Production of 5-(4-(4-(2-(trifluoromethyl)phenoxy)piperidin-l-yl)phenyl)-l,3,4- thiadiazol-2-yl)methyl acetate (Compound No. NUT-83)]

[0605] A portion of the crude product of 4-(4-(2-(trifluoromethyl)phenoxy)piperidin-l-yl)benzohydrazide produced in the above procedure (a) (270 mg), iPr2NEt (148 μL), and acetoxyacetyl chloride (93 μL) were reacted and treated in the same manner as described in procedure (b) of Example 1 to obtain the labeled target (300 mg).

[0606] 1 HNMR (500 MHz, CDC13) δ 9.41 (br. s, NH), 9.12 (br. s, NH), 7.76 (d, J = 8.3 Hz, 2H), 7.59 (d, J = 7.4 Hz, IH), 7.48 (t, J = 7.6 Hz, IH), 7.04-7.00 (m, 2H), 6.87 (d, J = 8.6 Hz, 2H), 4.75-4.69 (m, IH), 4.68 (s, 2H), 3.58-3.50 (m, 2H), 3.47-3.39 (m, 2H), 2.17 (s, 3H).

[0607] [Procedure (c) of Example 44] Production of 5-(4-(4-(2-(trifluoromethyl)phenoxy)piperidin-l-yl)phenyl)-l,3,4-thiadiazol-2-yl)methyl ethanoate

[0608] A portion of the crude product of 4-(4-(2-(trifluoromethyl)phenoxy)piperidin-l-yl)benzohydrazide produced in the above procedure (a) (270 mg), iPr2NEt (148 μL), and acetoxyacetyl chloride (93 μL) were reacted and treated in the same manner as described in procedure (b) of Example 1 to obtain the labeled target (300 mg).

[0609] 1 HNMR (500 MHz, CDC13) δ 9.41 (br. s, NH), 9.12 (br. s, NH), 7.76 (d, J = 8.3 Hz, 2H), 7.59 (d, J = 7.4 Hz, IH), 7.48 (t, J = 7.6 Hz, IH), 7.04-7.00 (m, 2H), 6.87 (d, J = 8.6 Hz, 2H), 4.75-4.69 (m, IH), 4.68 (s, 2H), 3.58-3.50 (m, 2H), 3.47-3.39 (m, 2H), 2.17 (s, 3H).

[0610] [Example 45] Production of (5-(4-(4-(2-(trifluoromethyl)phenoxy)piperidin-l-yl)phenyl)-l,3,4-thiadiazol-2-yl)methanol (Compound No. NUT-82)

[0611] [Chemical Formula 66]

[0612]

[0613] Using 5-(4-(4-(2-(trifluoromethyl)phenoxy)piperidin-l-yl)phenyl)-l,3,4- thiazol-2-yl)methyl acetate (148 mg) manufactured in Example 44 and lithium hydroxide monohydrate (65 mg), reaction treatment was performed according to the method described in Example 15, to obtain the marked target (100 mg, yield 74%).

[0614] 1 HNMR (500 MHz, CDC13) δ 7.84 (d, J = 8.8 Hz, 2H), 7.60 (d, J = 7.1 Hz, IH), 7.50 (t, J = 7.6 Hz, IH), 7.04-7.00 (m, 2H), 6.97 (d, J = 8.8 Hz, 2H), 5.09 (s, 2H), 4.76-4.71 (m, IH), 3.59-3.53 (m, 2H), 3.46-3.41 (m, 2H), 2.75 (br. s, OH), 2.14-2.01 (m, 2H).

[0615] [Example 46] Production of 5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)phenyl)-l,3,4-thiazol-2-yl)methyl glycinate hydrochloride (Compound No. NUT-88 (ADI-88))

[0616] [Chemical Formula 67]

[0617]

[0618] [Example 46, Step (a)] Production of (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)phenyl)-l,3,4-thiazol-2-yl)methyl (tert-butoxycarbonyl)glycinate

[0619] (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)phenyl)-l,3,4-thiazol-2-yl)methanol (80 mg) manufactured by the same method as Example 18 was dissolved in DMF (3 mL), and (tert-butoxycarbonyl)glycine (57 mg), DMAP (41 mg), and EDCI (61 mg) were added, and stirred at room temperature for 24 hours. The solution after the reaction was diluted with water, and extracted with ethyl acetate. The extracted solution was washed with water, saturated brine in this order, and dried over magnesium sulfate. Further, after distilling off the solvent under reduced pressure, the residue was purified by column chromatography (developing agent: ethyl acetate: hexane = 1:1) to obtain the marked target (87 mg, yield 79%).

[0620] 1 HNMR (500 MHz, CDC13) δ 7.83 (d, J = 9.1 Hz, 2H), 7.32 (dt, J = 6.1, 8.8 Hz, 1H), 6.97 (d, J = 8.8 Hz, 2H), 6.72 (dd, J = 2.7, 10.3 Hz, 1H), 4.62 - 4.54 (m, 1H), 4.02 (d, J = 5.7 Hz, 2H), 3.64 - 3.60 (m, 2H), 3.42 - 3.37 (m, 2H), 2.10 - 2.01 (m, 4H), 1.46 (s, 9H).

[0621] [Production of (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3,4-thiadiazol-2-yl)methyl L-valinate hydrochloride (Compound No. NUT-89 (ADI-89))] of Example 47

[0622] To (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3,4-thiadiazol-2-yl)methyl (tert-butoxycarbonyl)glycinate (87 mg) produced in the above procedure (a), hydrogen chloride / 1,4-dioxane solution (4 M, 1.0 mL) was added, and stirred at room temperature for 2 hours. After the reaction, the solvent was distilled off under reduced pressure, and dried under reduced pressure to obtain the labeled target product (76 mg, yield 99%).

[0623] 1 HNMR (500 MHz, DMSO-d6) δ 8.42 (br. s, 3H), 7.80 (d, J = 8.8 Hz, 2H), 7.47 (dd, J = 6.4, 8.3 Hz, 1H), 7.28 (d, J = 10.5 Hz, 1H), 7.12 (d, J = 8.8 Hz, 2H), 6.83 (t, J = 8.1 Hz, 1H), 5.65 (s, 2H), 4.86 - 4.78 (m, 1H), 3.93 (d, J = 5.4 Hz, 2H), 3.37 - 3.33 (m, 4H), 2.08 - 1.99 (m, 2H), 1.80 - 1.70 (m, 2H).

[0624] [Production of (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-1-yl)phenyl)-1,3,4-thiadiazol-2-yl)methyl L-valinate hydrochloride (Compound No. NUT-89 (ADI-89))] of Example 47

[0625] [Chemical Formula 68]

[0626]

[0627] [Preparation of (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)phenyl)-l,3,4- thiadiazol-2-yl)methyl (tert-butoxycarbonyl)-L-valinate]

[0628] (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)phenyl)-l,3,4-thiadiazol-2- yl)methanol (160 mg) produced by the same method as in Example 18 was dissolved in DMF (6 mL), and (tert-butoxycarbonyl) L-valine (140 mg), DMAP (82 mg), and EDCI (122 mg) were added, followed by stirring at room temperature for 24 hours. The reaction solution was diluted with water and extracted with ethyl acetate. The extracted solution was washed with water and saturated brine in this order, and dried over magnesium sulfate. Further, the solvent was distilled off under reduced pressure, and the residue was purified by column chromatography (developing solvent: ethyl acetate: hexane = 1 : 1) to obtain the title compound (185 mg, yield 79%).

[0629] 1 HNMR (500 MHz, CDC13) δ 7.85 (d, J = 8.6 Hz, 2H), 7.33 (dt, J = 6.4, 8.8 Hz, IH), 6.98 (d, J = 8.6 Hz, 2H), 6.73 (dd, J = 2.5, 10.3 Hz, IH), 6.67 (dt, J = 2.5, 7.8 Hz, IH), 5.61 (d, J = 13.0 Hz, IH), 5.52 (d, J = 13.5 Hz, IH), 5.00 (d, J = 8.8 Hz, NH), 4.62-4.56 (m, IH), 4.35-4.30 (m, IH), 3.67-3.60 (m, 2H), 3.44-3.37 (m, 2H), 2.25-2.15 (m, IH), 2.12-1.98 (m, 4H), 1.46 (s, 9H), 0.99 (d, J = 6.9 Hz, 3H), 0.91 (d, J = 6.9 Hz, 3H).

[0630] [Preparation of (5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)phenyl)-l,3,4- thiadiazol-2-yl)methyl L-valinate hydrochloride]

[0631] To 5-(4-(4-(2-chloro-5-fluorophenoxy)piperidin-l-yl)phenyl)-l,3,4-thiadiazol-2-yl)methyl (tert-butoxycarbonyl)-L-valinate (185 mg) produced in the above procedure (a), hydrogen chloride / 1,4-dioxane solution (4 M, 2.5 mL) was added, and stirred at room temperature for 2 hours. After the reaction, after distilling off the solvent under reduced pressure, drying under reduced pressure was performed, to obtain the labeled target product (150 mg, yield 98%).

[0632] 1 HNMR (500 MHz, DMSO-d6) δ 8.62 (br. s, 3H), 7.82 (d, J = 8.6 Hz, 2H), 7.47 (t, J = 6.9 Hz, 1H), 7.28 (d, J = 11.0 Hz, 1H), 7.14 (d, J = 8.1 Hz, 2H), 6.83 (t, J = 8.4 Hz, 1H), 5.72 (d, J = 13.2 Hz, 1H), 5.65 (d, J = 13.4 Hz, 1H), 4.85-4.78 (m, 1H), 4.04-3.97 (m, 1H), 3.41-3.33 (m, 2H), 2.27-2.16 (m, 1H), 2.09-2.00 (m, 2H), 1.82-1.72 (m, 2H), 0.99 (d, J = 6.9 Hz, 3H), 0.95 (d, J = 6.9 Hz, 3H).

[0633] [Reference Example]

[0634] The structures of the compounds of the reference example (NUT-41, 42) used in the test examples described later are shown below.

[0635] [Chemical Formula 69]

[0636]

[0637] In the test examples below, the compounds produced above (ADI derivatives, NUT compounds) were also used for evaluation.

[0638] [Test Example 1: Evaluation of the amount of intracellular accumulation of S403 phosphorylated p62 based on ADI derivative treatment]

[0639] (1) Experimental method

[0640] Cells used were N2a (derived from mouse neuroblastoma) and HEK293 (derived from human embryonic kidney cells). Cells were seeded in 6-well plates, and the next day various ADI derivatives (1 µM) were added to the culture medium, and incubated for 24 hours. A control group was set up in which no ADI derivative was added. The culture medium used was DMEM (high sugar; WAKO) + 10% FBS (gibco). After 24 hours, after removing the culture medium, cells were washed with PBS, 1 mL of PBS was added, and the cells were detached by pipetting, added to a 1.5 mL tube, and centrifuged at 1200 rpm for 10 seconds, and the cells were recovered. After removing the supernatant, the cells were suspended with 100 µL of PBS, and subjected to ultrasonic disruption (BRANSON, 5W for 10 seconds), mixed with 2x SDS-sample buffer at 1:1, and 20 µL was supplied to SDS-PAGE, and subjected to Western blotting. The primary antibody used was a self-made anti-S403-P-p62 monoclonal antibody (clone #4F6, Matsumoto et al., Mol Cell. 44(2) 279-289, 2011) and an anti-p62 antibody (MBL, PM045).

[0641] (2) Results

[0642] The results are shown in Figure 1 (A) is the results of N2a cells, and (B) is the results of HEK293 cells. In terms of (A) and (B), in the cells treated with the ADI derivative, both the total amount of p62 protein and the accumulation amount of S403-phosphorylated p62 protein increased compared to the control group. From this result, it was found that the ADI derivative has a S403-phosphorylation promoting effect on p62 protein.

[0643] [Experiment Example 2: Study of the mechanism of the phosphorylation promoting effect of the ADI derivative]

[0644] (1) Experimental method

[0645] Cells used were mouse neuroblastoma cells (N2a+RG-p62 cells) that continuously express a mouse p62 protein (RFP-GFP-p62) in which red fluorescent protein (RFP) and green fluorescent protein (GFP) are linked in a straight line. N2a+RG-p62 cells were produced by the following method: a pRFP-GFP-mp62 vector was obtained by introducing GFP-mp62 (Matsumoto et al., Scientific Reports 8(1) 2018) into pRFP-C1-DEST (Matsumoto et al., Human molecular genetics 24(15) 4429-4442, 2015) using a gateway system, and the pRFP-GFP-mp62 vector was introduced into N2a cells using LipofectAmine3000, and a stable expression strain was selected. ADI derivatives used were ADI-14 and ADI-29. N2a+RG-p62 cells were seeded in a 6-well plate, and on the next day were cultured for 24 hours in separate treatment with an ADI derivative (1 µM), co-treatment with an ADI derivative (1 µM) and bafilomycin A (0.5 µM, hereinafter referred to as “BafA”), and co-treatment with an ADI derivative (1 µM) and BX795 (0.5 µM). As controls, an untreated group, a BafA-treated group, and a BX795-treated group were set. After 24 hours, cells were recovered, cell extracts were prepared, and the amount of intracellular accumulation of S403-phosphorylated p62 contained in the extracts was evaluated by Western blotting, in the same manner as in Test Example 1. The same antibodies as in Test Example 1 were used. BafA is a compound that has the effect of inhibiting the breakdown of autophagosomes by lysosomes by inhibiting the fusion of autophagosomes with lysosomes, and BX795 is a compound that has a TBK1 inhibitory effect.

[0646] (2) Results

[0647] The results are shown in Figure 2"endo.p62" indicates an endogenous p62 protein. As in Test Example 1, in the ADI-14-treated group and the ADI-29-treated group, the amount of accumulation of S403-phosphorylated p62 increased. Phosphorylated p62 is continuously decomposed, and thus, in the control group, the ADI-14-treated group, and the ADI-29-treated group, S403-phosphorylated p62 accumulated in the cells by inhibiting decomposition by the addition of BafA. When the TBK1 inhibitor (BX795) was added, S403-phosphorylated p62 did not accumulate in the control group, the ADI-14-treated group, and the ADI-29-treated group. That is, it was shown that the S403-phosphorylation promoting effect of the ADI derivative on p62 was inhibited by the TBK1 inhibitor. Thus, it was indicated that the ADI promotes S403-phosphorylation of p62 by inducing activation of TBK1.

[0648] [Experiment Example 3: Study of genes induced by ADI derivatives]

[0649] (1) Experimental method

[0650] (1-1) Cell test

[0651] N2a cells were seeded in a 6-well plate, and the next day, ADI-14 and ADI-29 were added at a final concentration of 1 µM, respectively, and incubated for 24 hours. After 24 hours, the cells were recovered, and total RNA was extracted using TRI reagent (trade name, Molecular Research Center Inc.), and 2 µg of the RNA was subjected to reverse transcription using PRIME script MAX (TAKARA) to synthesize cDNA, and quantitative PCR was performed using THUNDERBIRD SYBR qPCR Mix (TOYOBO). The genes to be measured were set to Atf3 (Activating transcription factor 3), Ddit3 (DNA damage-inducible transcript 3), Gadd45a (Growth Arrest and DNA Damage-inducible 45), Nfil3 (Nuclear factor, interleukin 3 regulated), Ppp1r15a (Protein phosphatase 1 regulatory subunit 15A), p62 / Sqstm1 (p62 / sequestosome 1), and Trib3 (Tribbles Pseudokinase 3). For the genes to be measured, RNA sequencing (RNA-seq) was performed on ADI-treated N2a cells and untreated N2a cells, and by comprehensive analysis of genes with large differences in expression amounts, genes that were presumed to be increased in expression due to ADI treatment were selected. The expression amount of each gene (mRNA) was calculated as the relative mRNA amount with respect to the control (no ADI derivative treatment) using the ΔΔCt method, with the mRNA expression amount of the Gapdh gene as a reference.

[0652] (1-2) Animal Test

[0653] ADI-14 and ADI-29 dissolved in DMSO were dissolved in olive oil (containing 1% DMSO as a final concentration), and C57BL / 6J mice were forcibly administered orally at 50 µg per day for two weeks. After the end of the administration period, the mice were euthanized, the hippocampus was collected, and total RNA was extracted, cDNA was synthesized, and quantitative PCR was performed in the same manner as in (1) above. The genes to be measured were set to Atf3, Ddit3, Gadd45a, Nfil3, Ppp1r15a, p62 / Sqstm1, and Trib3 of mice. For the expression amount of each gene (mRNA), it was also calculated in the same manner as in (1) above.

[0654] The primers used in the quantitative PCR are shown below.

[0655] Aft3_RT_F: GCTGGAGTCAGTTACCGTCAA (SEQ ID NO: 2).

[0656] Aft3_RT_R: CGCCTCCTTTTCCTCTCAT (SEQ ID NO: 3).

[0657] Ddit3_RT_F: TCACACGCACATCCCAAA (SEQ ID NO: 4).

[0658] Ddit3_RT_R: CCTAGTTCTTCCTTGCTCTTCC (SEQ ID NO: 5).

[0659] Gadd45a_RT_F: CCACGCTGATGCAAGGATTA (SEQ ID NO: 6).

[0660] Gadd45a_RT_R: TTCTTCAGGCTCACCTCTCT (SEQ ID NO: 7).

[0661] Nfil3_RT_F: CTTTCTTTTCCCCCTCACG (SEQ ID NO: 8).

[0662] Nfil3_RT_R: CAGGAGCCTTTCATGGGTTA (SEQ ID NO: 9).

[0663] Ppp1r15a_RT_F: GACACAGAGGAAGAGGAAGATG (SEQ ID NO: 10).

[0664] Ppp1r15a_RT_R: TAGCAGGAGTGGAAGAGGAA (SEQ ID NO: 11).

[0665] p62 / Sqstm1_RT_F: GAAGCTGCCCTATACCCACA (SEQ ID NO: 12).

[0666] p62 / Sqstm1_RT_R: TGGGAGAGGGACTCAATCAG (SEQ ID NO: 13).

[0667] Trib3_RT_F: CGCTTTGTCTTCAGCAACTGT (SEQ ID NO: 14).

[0668] Trib3_RT_R: TCATCTGATCCAGTCATCACG (SEQ ID NO: 15).

[0669] Gapdh_RT_F: ATGGTGAAGGTCGGTGTGA (SEQ ID NO: 16).

[0670] Gapdh_RT_F: AATCTCCACTTTGCCACTGC (SEQ ID NO: 17).

[0671] (2) Results

[0672] The results of the cell test are shown in Figure 3 Among all the genes measured, the expression amount was significantly increased by the ADI derivative treatment. The results of the animal test are shown in Figure 4 The expression amounts of Atf3 and Nfil3 of the mRNA adjusted from the hippocampus of the mouse brain were significantly increased by the oral administration of the ADI derivative. According to these results, it was suggested that the ADI derivative promoted aggregate autophagy through selective autophagy induction accompanied by the gene expression of Atf3 and Nfil3.

[0673] [Experiment Example 4: Study of the Aggregate Autophagy Promotion Effect of the ADI Derivative Using a Tau Aggregation Cell Line]

[0674] (1) Experimental Method

[0675] A self-made Tau aggregation cell line (G1F1B, G1E3B) was used. The Tau aggregation cell line (G1F1B, G1E3B) is a cell line in which the GFP-hTau-2N4R-P301L protein forms fibers by introducing a Tau aggregation nucleus into HEK293 cells stably expressing GFP-hTau-2N4R-P301L, and continuously maintains the Tau aggregate by passing the Tau aggregation nucleus to the daughter cell at the time of cell division, and is a cell made from HEK293 cells according to the method for producing a Tau aggregation cell line of N2a cells described in Matsumoto et al. (International Journal of Molecular Sciences 19(5) 2018), and the GFP-hTau-2N4R-P301L is a fusion of GFP at the N terminus of the full-length human Tau protein (2N4R) containing the mutation of FTDP-17 (linked to chromosome 17, familial frontotemporal dementia with parkinsonism), i.e., P301L mutation. The Tau aggregation cell line was inoculated at 1 x 10 5 6 cells / 2 mL per well in a 12-well plate and cultured with DMEM + 10% FBS medium. The next day, ADI-14 was added at a final concentration of 1 µM to 3 wells, and in addition, as a control, DMSO was added to 3 wells, and using IncuCyto ZOOM (ESSEN Bioscience) built into a 5% CO2 incubator, 9 parts of each well were fixedly photographed once an hour, and the aggregate number (A) and cell density (% confluence; B) were measured over time.

[0676] (2) Results

[0677] Figure 5 Images were captured over time, capturing cells at an arbitrary time, designated "time 0," and the same cells (including daughter cells) two days later. In the control group, the number of aggregates increased after two days, while in the ADI-14 group, the number of aggregates did not increase even after two days. This result is believed to indicate that ADI-14 induces autophagy of aggregates, degrading tau aggregates and preventing the transfer of seeds to daughter cells, resulting in cells unable to form new aggregates.

[0678] Figure 6 (A) shows the time-dependent change in the average number of aggregates per hour, approximately one hour after the start of fixed-point observation, with t = 0. Error bars represent the standard error (SEM) of the aggregate counts across three wells. This indicates that the addition of ADI-14 significantly reduced the number of tau aggregates (****; p < 0.0001). Figure 6 (B) shows the average of the three wells, where the cell density was determined by the proportion of cells occupying the visual field, with the total visual field occupied being 100. Error bars represent the standard error (SEM) of the number of aggregates across the three wells. This indicates that the addition of ADI-14 did not inhibit cell proliferation. These results indicate that the reduction in the number of tau aggregates by ADI-14 is not due to inhibition of cell proliferation.

[0679] [Test Example 5: Verification of the Effect of Administration of ADI Derivatives on Neurodegenerative Disease Model Animals Forming Amyloid Protein Aggregates]

[0680] (1) Experimental methods

[0681] (1-1) Preparation of dosing solution

[0682] Dissolve 100 mg of the ADI derivative ADI-29 (mw 489.99) in 2 mL of DMSO (Fujifilm) to prepare a 100 mM stock solution. Store the stock solution at -20°C. Dissolve 10 µL of the stock solution in 1 mL of sterilized olive oil (Fujifilm), stir thoroughly, and incubate at 65°C overnight to prepare a dosing solution (1 mM ADI-29, 0.5 mg / mL) dissolved in olive oil. For each dose solution preparation, prepare 10 tubes of 1 mL of the dosing solution and store at 4°C. Store at room temperature for one week before dosing.

[0683] (1-2) Neurodegenerative Disease Model Animals

[0684] As a model animal of a neurodegenerative disease in which amyloid protein aggregates are formed, PS19 mice (B6; C3-Tg(Prnp-MAPT*P301S)PS19Vle / J, Jackson Laboratory) were used. PS19 mice are Tau protein disease model mice in which a mutant human Tau (MAPT) P301S-1N4R isoform derived from frontotemporal lobar degeneration with Parkinsonism linked to chromosome 17 (FTDP-17) is integrated under the prion promoter, and formation of hyperphosphorylated Tau aggregates in nerve cells and brain atrophy are confirmed at 8 to 10 months of age.

[0685] (1-3) Administration schedule

[0686] ADI-29 was started to be administered to 36-week-old PS19 mice. The above administration solution was administered 100 µL three times a week by force-feeding into the stomach using an oral feeding tube (ADI-29 administration group, n = 8). The administration period was 10 weeks. The control group (n = 7) was orally administered 100 µL of olive oil.

[0687] (1-4) Detection of intracerebral phosphorylated Tau aggregates

[0688] Two days after the final administration, the mice were euthanized, the brains were removed, and fixed by immersion in formalin. Sagittal sections were prepared from the hemispheres of the brains fixed by formalin, and immunostaining was performed with an anti-phosphorylated Tau (S202 / T205) antibody (AT8, Thermo Fisher Scientific) used in the detection of human Tau protein disease pathology in order to confirm Tau aggregates.

[0689] (1-5) Measurement of the thickness of the CA1 nerve cell layer of the hippocampus

[0690] It is known that in PS19 mice, hippocampal atrophy due to nerve cell death of the nerve cell layer of the hippocampus occurs due to accumulation of AT8-positive Tau aggregates. Therefore, in order to measure the thickness of the CA1 nerve cell layer of the hippocampus, a rabbit anti-NeuN monoclonal antibody (abcam ab177487) was used to perform fluorescent immunostaining (Alexa 568) of the NeuN protein specifically expressed in nerve cells, and a KEYENCE integrated microscope (BX-810) was used to take images of the hippocampal region with a 40x objective lens. The width of the CA1 nerve cell layer located above the dentate gyrus of the hippocampus was measured at 5 places per section, and the values for 2 sections per mouse (a total of 10 places per mouse) were analyzed using the statistical analysis software PRISM9.

[0691] (2) Results

[0692] The results of immunostaining brain tissue sections with anti-phospho-Tau antibodies are shown in Figure 7 In the control group, AT8-positive tau was observed in the form of aggregates throughout the brain, including the cerebral cortex, hippocampus, and brainstem. In the hippocampus, in particular, AT8-positive tau was confirmed to accumulate in the neuronal cell bodies of the CA1 region. On the other hand, in the ADI-29-administered group, although AT8-positive tau was detected in parts of the brainstem and hippocampus, almost no AT8-positive tau aggregates were observed that accumulated in neuronal cell bodies, such as those observed in the CA1 region.

[0693] The results of measuring the thickness of the CA1 neuronal layer of the hippocampus are shown in Figure 8 . Figure 8 (A) is an image of brain tissue sections fluorescently immunostained with anti-NeuN monoclonal antibody. Figure 8 (B) is a graph showing the measured values ​​of the width of the CA1 neuron layer (the width between the arrows in (A)). Figure 8 As shown in (A) and (B), atrophy of the CA1 neuronal layer in 46-week-old PS19 mice was significantly suppressed in the ADI-29-administered group. This result demonstrates that ADI-29 inhibits neuronal toxicity caused by mutant tau and has a therapeutic effect in preventing the formation of phosphorylated tau aggregates and neuronal cell death.

[0694] [Test Example 6: Study on the Inhibitory Effect of ADI Derivatives on the Number of Tau Aggregates Using Tau Aggregating Cell Lines]

[0695] (1) Experimental methods

[0696] The Tau-aggregating cell line (G1F1B) used in Experimental Example 4 was used. The Tau-aggregating cell line was cultured at 5×10 4 Cells were seeded at 100 μg / well in a 24-well plate. The next day, 1 mL of culture medium (DMEM + 10% FBS) and an ADI derivative at a final concentration of 1 μM were added. DMSO was added as a control. Using an IncuCyte ZOOM, the number of fluorescently labeled Tau aggregates and cell density (confluence) were measured at nine locations per well per hour using a 20x objective lens. The average of the nine measured values ​​was converted to a relative value, with the number of aggregates at hour 0 set to 1. Nonlinear curve fitting (logistic growth) analysis was performed using PRISM software using the formula Y = YM × Y0 / ((YM - Y0) × exp(-k × x) + Y0), and YM (Ymax: the theoretical multiple of the increase in aggregates) was determined as the parameter. Measurements were performed for 120 hours, but data analysis was performed up to 100 hours, when cell proliferation was maintained and the data were stable.

[0697] The results are shown in Table 1. Relative aggregation inhibitory activity is indicated as +++, +, or ++. The results of two wells for each compound were averaged.

[0698] [Table 1]

[0699]

[0700] Note that the present application is not limited to the above-described embodiments, test examples, and examples, and various modifications can be made within the scope of the claims, and embodiments obtained by appropriately combining the technical methods respectively disclosed in different embodiments are also included in the technical scope of the present application. Furthermore, the academic and patent literatures described in this specification are all incorporated by reference into this specification.

Claims

1. A composition for promoting the decomposition of protein aggregates, characterized in that Contains a compound represented by the following general formula (I) or a salt thereof: [Chemical Formula 1] In formula (I), R 1 are independently selected from the group consisting of: halogen atoms, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-6 Alkoxy, C 3-8 Cycloalkyl, C 1-6 Halogenated alkyl, C 1-6 Halogenated alkoxy, C 1-6 Alkylaminoamide, carboxyl, amino, nitro, C 1-6 Alkylthio, C 1-6 Halogenated alkylthio, C 1-6 Alkylsulfinyl, C 1-6 Halogenated alkylsulfinyl, C 1-6 Alkylsulfonyl and C 1-6 Haloalkylsulfonyl, R 2 For hydrogen atoms, halogen atoms, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-6 Alkoxy, C 3-8 Cycloalkyl, C 1-6 Halogenated alkyl, C 1-6 a haloalkoxy group, a cyano group, a C(=S)NH2 group, an amide group or a SF5 group, R 3 are independently selected from the group consisting of: halogen atoms, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-6 Alkoxy, C 3-8 Cycloalkyl, C 1-6 Halogenated alkyl, C 1-6 Halogenated alkoxy, C 1-6 Alkylamino, C 1-6 Alkoxyamino, carboxyl and amino groups, R 4 Selected from the group consisting of: halogen atoms, C 1-6 Alkyl, C 1-6 Haloalkyl, hydroxy, hydroxy C 1-6 Alkyl, carboxyl, C 1-6 Alkylamino, amino and [Chemical Formula 2] Where R is a halogen atom, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 3-8 Cycloalkyl, C 1-6 Alkylamino, C 1-6 Haloalkylamino, C 1-6 Alkylamide, C 1-6 a haloalkylamide group or a phenyl group, the phenyl group being optionally substituted by a halogen atom, a C 1-6 Alkyl or C 1-6 Haloalkyl substitution, L is -O-, -S-, -NH-, C optionally substituted by R 1-6 Alkylene, C optionally substituted by R 2-6 Alkenylene, C optionally substituted by R 2-6 Alkyne group or chemical bond, X and Y are optionally the same or different and are N, CH or CR 3 , Ring A is an aromatic hydrocarbon having 5 to 10 carbon atoms or a five-membered or six-membered aromatic heterocyclic ring containing 1 to 4 heteroatoms selected from the group consisting of nitrogen atoms, sulfur atoms, and oxygen atoms, Ring B is an aromatic hydrocarbon ring having 5 to 10 carbon atoms or a five-membered or six-membered aromatic heterocyclic ring containing 1 to 4 heteroatoms selected from the group consisting of nitrogen atoms, sulfur atoms, and oxygen atoms, wherein the heteroatoms include at least one nitrogen atom. p is 0, 1, 2, 3, 4, or 5, q is 0, 1, or 2, r is 0, 1, 2, or 3, When p, q and / or r are 2 or more, two or more R 1 、R 3 and / or R 4 optionally together with a portion of the respective substituted ring to form a ring, m and n are optionally the same or different and are 1, 2 or 3, R 1 、R 3 and one or more of R are optionally substituted with biotin or a derivative thereof.

2. The composition according to claim 1, characterized in that Ring B is selected from the group consisting of phenyl, naphthyl, oxazolyl, thiazolyl, imidazolyl, pyrrolyl, pyrazolyl, isoxazolyl, isothiazolyl, 1,2,4-oxadiazol-5-yl, 1,2,4-oxadiazol-3-yl, 1,3,4-oxadiazolyl, 1,2,5-oxadiazolyl, 1,2,3-oxadiazolyl, 1,2,4-thiadiazol-5-yl, 1,2,4-thiadiazol-3-yl, 1,2,5-thiadiazolyl, 1,3,4-thiadiazolyl, 1,2,3-thiadiazolyl, 1,2,4-triazolyl, 1,2,3-triazolyl and tetrazolyl.

3. The composition according to claim 1, characterized in that Ring B is any of the following structures: [Chemical Formula 3] Where R 4 Same as claim 1.

4. The composition according to claim 1, characterized in that R 4 The structure is as follows: [Chemical Formula 4] Wherein, R is the same as that in claim 1.

5. The composition according to claim 1, characterized in that The composition is [Chemical Formula 5] Any structure in In the formula, Hal is optionally the same or different and is halogen or C 1-6 Halogenated alkyl.

6. The composition according to claim 1, characterized in that X and Y are both CH. 7 . A pharmaceutical composition for preventing or treating a neurodegenerative disease accompanied by formation of protein aggregates, comprising the composition according to claim 1 .

8. The pharmaceutical composition according to claim 7, wherein The neurodegenerative disease accompanied by protein aggregate formation is selected from the group consisting of: Alzheimer's disease, progressive supranuclear palsy, basal ganglia degeneration, frontotemporal lobar degeneration, Parkinson's disease, multiple system atrophy, dementia with Lewy bodies, rapid eye movement sleep behavior disorder, striatonigral degeneration, Creutzfeldt-Jakob disease, Gerstmann syndrome, amyotrophic lateral sclerosis, Huntington's disease, spinocerebellar degeneration and dentatorubral pallidum Lewy body atrophy. 9 . A composition for promoting the phosphorylation of p62 / SQSTM1, comprising the compound represented by the general formula (I) according to claim 1 or a salt thereof.

10. The composition according to claim 8, wherein The phosphorylation promoting site is serine at position 403 of the amino acid sequence of human p62 / SQSTM1 shown in SEQ ID NO: 1, or the serine corresponding to serine at position 403 of SEQ ID NO: 1 in the amino acid sequence of p62 / SQSTM1 of a non-human animal.

11. A compound represented by the following general formula (II) or a salt thereof, [Chemical Formula 6] In formula (II), R 1 are independently selected from the group consisting of: halogen atoms, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-6 Alkoxy, C 3-8 Cycloalkyl, C 1-6 Halogenated alkyl, C 1-6 Halogenated alkoxy, C 1-6 Alkylaminoamide, carboxyl, amino, nitro, C 1-6 Alkylthio, C 1-6 Halogenated alkylthio, C 1-6 Alkylsulfinyl, C 1-6 Halogenated alkylsulfinyl, C 1-6 Alkylsulfonyl and C 1-6 Haloalkylsulfonyl, R 2 For hydrogen atoms, halogen atoms, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-6 Alkoxy, C 3-8 Cycloalkyl, C 1-6 Halogenated alkyl, C 1-6 a haloalkoxy group, a cyano group, a C(=S)NH2 group, an amide group or a SF5 group, R 3 are independently selected from the group consisting of: halogen atoms, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-6 Alkoxy, C 3-8 Cycloalkyl, C 1-6 Halogenated alkyl, C 1-6 Halogenated alkoxy, C 1-6 Alkylamino, C 1-6 Alkoxyamino, carboxyl and amino groups, R 4 Selected from the group consisting of: halogen atoms, C 1-6 Alkyl, C 1-6 Haloalkyl, hydroxy, hydroxy C 1-6 Alkyl, carboxyl, C 1-6 Alkylamino, amino and [Chemical Formula 7] in, R is a halogen atom, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 3-8 Cycloalkyl, C 1-6 Alkylamino, C 1-6 Haloalkylamino, C 1-6 Alkylaminoamide, C 1-6 a haloalkylamido group or a phenyl group, the phenyl group being optionally substituted with a C 1-6 Alkyl, C 1-6 Haloalkyl or halogen atom substitution, L is -O-, -S-, -NH-, -NR-, C optionally substituted by R 1-6 Alkylene, C optionally substituted by R 2-6 Alkenylene, C optionally substituted by R 2-6 Alkyne group or chemical bond, A 1 、A 2 and A 3 are optionally the same or different, and are independently selected from the group consisting of: a sulfur atom, a nitrogen atom, CR 4 As well as CH, the CR 4 In, R 4 Halogen atoms, C 1-6 Alkyl, C 1-6 Haloalkyl, hydroxy, hydroxy C 1-6 Alkyl, carboxyl, amino, p is 1, 2, or 3, q is 0 or 1, m and n are optionally the same or different and are 1, 2 or 3, In formula (II), the following compounds are not included: (i) A 1 and A 2 A is a nitrogen atom 3 is an oxygen atom, R 4 A compound wherein A is CH2OH; and (ii) 1 and A 2 A is a nitrogen atom 3 is a sulfur atom, R 4 It is a compound of CH2-C(=O)-OCH3.

12. A compound represented by the following formula or a salt thereof, [Chemical Formula 8] [Chemical Formula 9] 。 13. A compound represented by the following formula or a salt thereof, [Chemical Formula 10] 。

Images