Synthetic mRNA lacking poly A tails or having short adenine homopolymers and methods of use and production thereof

Abstract

The present disclosure relates to an mRNA molecule comprising a 3 '-untranslated region (3'-UTR) of a sense single-stranded RNA (+ ssRNA) of a virus, a coding sequence of a protein that is heterologous for the virus, and a 5 '-untranslated region (5'-UTR). In particular, the present disclosure relates to mRNA encoding a protein of interest but lacking a poly (A) tail. In addition, the present disclosure relates to such mRNA that allows the addition of an adenine homopolymer at its 3'end.

Description

Cross Reference to Related Applications

[0001] This application claims priority to U.S. Provisional Patent Application Nos. 63 / 586,985, filed September 29, 2023, 63 / 518,310, filed August 8, 2023, 63 / 502,030, filed May 12, 2023, and 63 / 484,969, filed February 14, 2023, all of which are hereby incorporated by reference in their entirety. Reference to Electronic Sequence Listing

[0002] The contents of the electronic sequence listing (699442001840SEQLIST.xml; size: 99,514 bytes; and date created: February 13, 2024) are hereby incorporated by reference in their entirety. TECHNICAL FIELD

[0003] The present disclosure relates to mRNA molecules comprising a 3’-untranslated region (3’-UTR) of a positive-sense single-stranded RNA (+ssRNA) of a virus, a coding sequence for a protein that is heterologous to the virus, and a 5’-untranslated region (5’-UTR). In particular, the present disclosure relates to mRNAs that encode a protein of interest but lack a poly(A) tail. Furthermore, the present disclosure relates to such mRNAs that allow for the addition of an adenine homopolymer at their 3’ end. BACKGROUND

[0004] Synthetic messenger RNAs (synRNAs) are now frequently used for therapeutic products as well as general tools in biomedical research. The basic structural components of an mRNA include a 5’-cap, a 5’-UTR (5’-untranslated region), a CDS (coding sequence), a 3’-UTR (3’-untranslated region), and a poly(A) tail (see, e.g., Fang et al., 2022; Kowalski et al., 2019; Jackson et al., 2020; and Wadhwa et al., 2019). The poly(A) tail is a homopolymer of adenine (A) of about 100-300 nucleotides in length. mRNAs with longer poly(A) tails are known to be more stable and produce more protein (see, e.g., Nicholson and Pasquinelli, 2019; and Fang et al., 2022). Furthermore, it has been shown that synRNAs lacking a poly(A) tail are not suitable for protein production (Holtkamp et al., 2006).

[0005] As a properly manufactured therapeutic product, it is crucial to ensure the identity and consistency of synRNA between manufacturing batches. One of the technical hurdles to this end is ensuring that each synRNA molecule has the same sequence. The poly(A) tail is particularly problematic, as synRNAs often exist in a mixture of mRNA molecules with varying poly(A) lengths. This is particularly problematic for synRNAs encoding large proteins with coding regions exceeding 11 kb, such as dystrophin.

[0006] Therefore, there is a need in the art for tools for generating translatable mRNAs that lack a poly(A) tail.

[0007] In addition, some methods for purifying synRNA use oligo(dT) columns to bind to the poly(A) tail of synRNA (Mencin et al., 2023). For this purpose, a short poly(A) tail of 10 to 20 adenines is sufficient (Mencin et al., 2023). However, it is unclear whether +ssRNA viral sequences allow for the addition of a short poly(A) tail, as some of these sequences lack a poly(A) tail in their native form.

[0008] Therefore, there is a further need in the art for tools for generating translatable mRNAs having a short adenine homopolymer at their 3' end. Summary of the Invention

[0009] The present disclosure relates to mRNA molecules comprising the 3'-untranslated region (3'-UTR) of a positive-sense single-stranded RNA (+ssRNA) of a virus, a coding sequence for a protein heterologous to the virus, and a 5'-untranslated region (5'-UTR). In particular, the present disclosure relates to mRNAs that encode a protein of interest but lack a poly(A) tail. Furthermore, the present disclosure relates to such mRNAs that allow the addition of an adenine homopolymer to their 3' end. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] FIGS. 1A-1E depict the structure of RNA molecules and DNA templates used to generate the RNA molecules. Synthetic mRNA (synRNA) is based on the 5’ and 3’ untranslated regions (UTRs) of the RNA genome 1 (NOV1, NCBI Accession: NC_002690) and RNA genome 2 (NOV2, NCBI Accession: NC_002691) of the Nodamura virus, respectively. FIG. 1A shows a schematic of NOV1-EGFP synRNA (SEQ ID NO: 1), in which the CDS (coding sequence) of NOV1 RNA is replaced with the coding sequence of enhanced green fluorescent protein (EGFP). FIG. IB shows a schematic of NOV2-EGFP synRNA (SEQ ID NO: 2), in which the CDS of NOV2 RNA is replaced with the coding sequence of EGFP. FIG. 1C shows a schematic of NOV2m synRNA (SEQ ID NO: 3), in which the CDS of NOV2 RNA is replaced with a multiple cloning site (MCS). FIG. ID shows a schematic of NOV2m-EGFP synRNA (SEQ ID NO: 4), in which the coding sequence of EGFP is inserted into the MCS site of NOV2m RNA. FIG. IE shows a schematic of plasmid DNA that can be used as a template for the production of synRNA by in vitro transcription (IVT). The coding sequence of EGFP is shown in SEQ ID NO: 5, and the coding sequence of an exemplary MCS is shown in SEQ ID NO: 8.

[0011] FIGS. 2A-2B depict a comparison of EGFP expression between NOV1-EGFP synRNA and NOV2-EGFP synRNA in human neonatal dermal fibroblasts (HDFn). NOV1-EGFP synRNA and NOV2-EGFP synRNA were prepared from plasmid DNA linearized with Sap I restriction enzyme by in vitro transcription driven by T7 RNA polymerase. A 5’-cap was incorporated using CleanCap AG (TriLink). Two forms of synRNA were prepared: one RNA was standard RNA without any nucleoside modification (unmodified), and the other RNA was modified with 5-methylcytosine (5mC) and pseudouridine (Ψ). Approximately 0.5 pg of RNA was transfected into HDFn using MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured at standard culture conditions at 37ºC (FIG. 2A) and at reduced temperature conditions at 33ºC (FIG. 2B) with or without B18R. Phase contrast images (left) and fluorescence images (right) were taken 12 hours after RNA transfection. The fluorescence images show EGFP expression levels.

[0012] Figure 3 depicts a comparison of cytopathic effects (CPE) between NOV1-EGFP synRNA and NOV2-EGFP synRNA in human neonatal dermal fibroblasts (HDFn). NOV1-EGFP synRNA and NOV2-EGFP synRNA were prepared from plasmid DNA linearized with Sapl restriction enzyme by in vitro transcription driven by T7 RNA polymerase. CleanCap AG (TriLink) was used to incorporate 5’-cap. Two forms of RNA were prepared: one RNA was standard RNA without any nucleoside modification (unmodified), and the other RNA was modified with 5-methylcytosine (5mC) and pseudouridine (Y). About 0.5 pg of RNA was transfected into HDFn with MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured at standard culture conditions at 37ºC and 33ºC with or without B18R. Phase contrast images were taken at 96 hours post RNA transfection.

[0013] Figure 4A-4B compares the percentage of HDFn cells transfected with NOV2-EGFP synRNA (mlY), NOV2m-EGFP synRNA (mlY), or control-EGFP synRNA (5mC + Y). About 1 pg of RNA was transfected into HDFn with MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured at standard culture conditions at 37ºC in the presence of B18R (B18R+; upper panel) and in the absence of B18R (B18R-; lower panel), and EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) at 24 hours, 96 hours, and 185 hours post transfection. In Figure 4A, GFP positive (+) cells are presented as the percentage (%) of total cells with fluorescence intensity of GFP > 30 or GFP > 300 (10 times higher than threshold). Figure 4B provides representative phase contrast and fluorescence images of NOV2-EGFP transfected cells, and shows flow cytometry scatter plots with EGFP gating boxes. These data were used to generate Figure 4A.

[0014] Figures 5A-5C depict the structure of the RNA molecule of DENVm and capless- DENVm, and the predicted secondary structure of DENVm RNA, with the location of the mutated nucleotides indicated by arrows. Synthetic mRNA (synRNA) is based on the 5’ and 3’ untranslated regions (UTRs) of Dengue virus 2 (DENV) (NC_001474.2; Kinney et al., 1997). Figure 5A shows a schematic of DENVm synRNA (SEQ ID NO: 11), in which the CDS (coding sequence) of DENV RNA is replaced by a multiple cloning site (MCS or m). Figure 5B shows a schematic of capless-DENVm synRNA (SEQ ID NO: 12), in which the 5’ cap of DENVm synRNA is removed. Figure 5C shows a schematic of the predicted secondary structure of DENVm synRNA. The prediction was made using the RNAfold web server tool available from the Institute for Theoretical Chemistry, University of Vienna website (Reute and Mathews, 2010). Four mutations were introduced to remove the two ATG start codons of DENV located upstream of the MCS, and to preserve the secondary structure.

[0015] Figure 6 shows the percentage of GFP-positive HDFn cells transfected with DENVm-EGFP synRNA (U: unmodified) and DENVm-EGFP synRNA (mlp). Each 1 pg of RNA was transfected into HDFn with MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured at 30ºC or 37ºC standard culture conditions in the presence or absence of B18R. EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) at day 1 and day 4 post-transfection. GFP-positive (+) cells were presented as the percentage (%) of total live cells with fluorescence intensity of GFP > 30, GFP > 300 (10 times above threshold) or GFP > 2000 (66.7 times above threshold).

[0016] Figure 7 shows the percentage of GFP positive HDFn cells transfected with cap- less -DENV m-EGFP synRNA (U: unmodified) and cap-less -DENV m-EGFP synRNA (ml ). Each 1 pg of RNA was transfected into HDFn with MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured at 30 °C or 37 °C standard culture conditions in the presence or absence of B18R. EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) at day 1 and day 4 post-transfection. GFP positive (+) cells were presented as the percentage (%) of total live cells with fluorescence intensity of GFP > 30, GFP > 300 (10 times above threshold) or GFP > 2000 (66.7 times above threshold).

[0017] Figure 8 shows the percentage of GFP positive HDFn cells transfected with DENV m-EGFP synRNA (U: unmodified) and DENV m-EGFP synRNA (ml ). Each 1 pg of RNA was transfected into HDFn with MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured at 33 °C or 37 °C standard culture conditions in the presence or absence of B18R. EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) at day 1, day 4, day 8 and day 11 post-transfection. GFP positive (+) cells were presented as the percentage (%) of total live cells with fluorescence intensity of GFP > 30, GFP > 300 (10 times above threshold) or GFP > 2000 (66.7 times above threshold).

[0018] Figure 9 depicts a schematic of the synRNA molecules for uncapped-BYDVm, uncapped-BYDV2m, uncapped-MNESVm, uncapped-TCVm, uncapped-PMVm, and uncapped-PEMV2m. These synRNAs do not have a 5'-cap or a 3'-poly(A) tail. Uncapped-DENVm is again shown here (also in Figure 5) for comparison. The size (kb) of each synRNA molecule is also shown. The uncapped-BYDVm RNA (SEQ ID NO: 14) consists of the 5'-UTR and 3'-UTR of Barley yellow dwarf virus (BYDV: NC_004750.1) and additional MCS. The uncapped-BYDV2m RNA (SEQ ID NO: 16) consists of the 5'-UTR, BYDV-like translation element (BTE), and 3'-UTR of Barley yellow dwarf virus (BYDV: NC_004750.1) and additional MCS. The uncapped-MNESVm RNA (SEQ ID NO: 18) consists of the 5'-UTR and 3'-UTR of Maize necrotic streak virus (MNESV: NC_007729.1) and additional MCS. The uncapped-TCVm RNA (SEQ ID NO: 24) consists of the 5'-UTR and 3'-UTR of RNA for coat protein of Turnip crinkle virus (TCV: NC_003821.3) and additional MCS. The uncapped-PMVm RNA (SEQ ID NO: 20) consists of the 5'-UTR and 3'-UTR of Polerovirus mosaic virus (PMV: U55002.1) and additional MCS. The uncapped-PEMV2m RNA (SEQ ID NO: 22) consists of the 5'-UTR and 3'-UTR of Pea enation mosaic virus-2 (PEMV2: NC_003853.1) and additional MCS.

[0019] Figure 10 depicts a schematic of synRNA molecules for BYDVm, BYDV2m, MNESVm, TCVm, PMVm, and PEMV2m. These synRNAs have a 5'-cap but do not have a 3'-poly(A) tail. Also shown is the size (kb) of each synRNA molecule. The BYDVm RNA (SEQ ID NO: 13) consists of the 5'-UTR and 3'-UTR of Barley yellow dwarf virus (BYDV: NC_004750.1) and additionally a 5'-cap and MCS. The BYDV2m RNA (SEQ ID NO: 15) consists of the 5'-UTR, BYDV-like translation element (BTE), and 3'-UTR of Barley yellow dwarf virus (BYDV: NC_004750.1) and additionally a 5'-cap and MCS. The MNESVm RNA (SEQ ID NO: 17) consists of the 5'-UTR and 3'-UTR of Maize necrotic streak virus (MNESV: NC_007729.1) and additionally a 5'-cap and MCS. The TCVm RNA (SEQ ID NO: 23) consists of the 5'-UTR and 3'-UTR of RNA of a Turnip crinkle virus coat protein (TCV: NC_003821.3) and additionally a 5'-cap and MCS. The PMVm RNA (SEQ ID NO: 19) consists of the 5'-UTR and 3'-UTR of a Mungbean yellow mosaic virus (PMV: U55002.1) and additionally a 5'-cap and MCS. The PEMV2m RNA (SEQ ID NO: 21) consists of the 5'-UTR and 3'-UTR of Pea enation mosaic virus-2 (PEMV2: NC_003853.1) and additionally a 5'-cap and MCS.

[0020] Figure 11 shows the percentage of GFP positive HDFn cells transfected with synRNAs containing 5'-cap but no poly(A) and incubated at 33°C in the presence of B18R. synRNAs used: no poly(A) control-EGFP synRNA (mlΨ), DENVm-EGFP (mlΨ), DENVm-EGFP (Unm, unmodified), NOV2m-EGFP (mlΨ), NOV2-EGFP (mlΨ), PEMV2m-EGFP (mlΨ), PEMV2m-EGFP (Unm), PMVm-EGFP (mlΨ), PMVm-EGFP (Unm), MNESVm-EGFP (mlΨ), MNESVm-EGFP (Unm), BYDV2m-EGFP (mlΨ), BYDV2m-EGFP (Unm), TCVm-EGFP (mlΨ), TCVm-EGFP (Unm), BYDm-EGFP (mlΨ), BYDm-EGFP (Unm). EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) at day 1 and day 4 post-transfection. GFP positive (+) cells were presented as the percentage (%) of total live cells with fluorescence intensity of GFP > 30, GFP > 300 (10 times above threshold) or GFP > 2000 (66.7 times above threshold).

[0021] Figure 12 shows the percentage of GFP positive HDFn cells transfected with synRNAs containing 5'-cap but no poly(A) and cultured at 33°C in the absence of B18R. synRNAs used: no poly(A) control-EGFP synRNA (mlΨ), DENV m-EGFP (mlΨ), DENV m-EGFP (Unm, unmodified), NOV2 m-EGFP (mlΨ), NOV2-EGFP (mlΨ), PEMV2 m-EGFP (mlΨ), PEMV2 m-EGFP (Unm), PMV m-EGFP (mlΨ), PMV m-EGFP (Unm), MNESV m-EGFP (mlΨ), MNESV m-EGFP (Unm), BYDV2 m-EGFP (mlΨ), BYDV2 m-EGFP (Unm), TCV m-EGFP (mlΨ), TCV m-EGFP (Unm), BYD m-EGFP (mlΨ), BYD m-EGFP (Unm). EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) at day 1 and day 4 post-transfection. GFP positive (+) cells were presented as the percentage (%) of total live cells with fluorescence intensity of GFP > 30, GFP > 300 (10 times above threshold) or GFP > 2000 (66.7 times above threshold).

[0022] Figure 13 shows the percentage of GFP positive HDFn cells transfected with synRNAs containing 5'-cap but no poly(A) and incubated at 37°C in the presence of B18R. synRNAs used: no poly(A) control-EGFP synRNA (mlΨ), DENVm-EGFP (mlΨ), DENVm-EGFP (Unm, unmodified), NOV2m-EGFP (mlΨ), NOV2-EGFP (mlΨ), PEMV2m-EGFP (mlΨ), PEMV2m-EGFP (Unm), PMVm-EGFP (mlΨ), PMVm-EGFP (Unm), MNESVm-EGFP (mlΨ), MNESVm-EGFP (Unm), BYDV2m-EGFP (mlΨ), BYDV2m-EGFP (Unm), TCVm-EGFP (mlΨ), TCVm-EGFP (Unm), BYDm-EGFP (mlΨ), BYDm-EGFP (Unm). EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) at day 1 and day 4 post-transfection. GFP positive (+) cells were presented as the percentage (%) of total live cells with fluorescence intensity of GFP > 30, GFP > 300 (10 times above threshold) or GFP > 2000 (66.7 times above threshold).

[0023] Figure 14 shows the percentage of GFP positive HDFn cells transfected with synRNAs containing 5'-caps but no poly(A) and incubated at 37°C in the absence of B18R. synRNAs used: no poly(A) control-EGFP synRNA (ml ), DENV m-EGFP (ml ), DENV m-EGFP (Unm, unmodified), NOV2 m-EGFP (ml ), NOV2-EGFP (ml ), PEMV2 m-EGFP (ml ), PEMV2 m-EGFP (Unm), PMV m-EGFP (ml ), PMV m-EGFP (Unm), MNESV m-EGFP (ml ), MNESV m-EGFP (Unm), BYDV2 m-EGFP (ml ), BYDV2 m-EGFP (Unm), TCV m-EGFP (ml ), TCV m-EGFP (Unm), BYD m-EGFP (ml ), BYD m-EGFP (Unm). EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) at day 1 and day 4 post-transfection. GFP positive (+) cells are presented as the percentage (%) of total live cells with fluorescence intensity of GFP > 30, GFP > 300 (10 times above threshold) or GFP > 2000 (66.7 times above threshold).

[0024] Figure 15 presents a summary view of the TCV m-EGFP (Unm), TCV m-EGFP (ml ), MNESV m-EGFP (Unm), MNESV m-EGFP (ml ), and no poly(A) control-EGFP synRNA (ml ) data presented in Figures 11, 12, 13, and 14. GFP positive (+) cells are presented as the percentage (%) of total live cells with fluorescence intensity of GFP > 30, GFP > 300 (10 times above threshold) or GFP > 2000 (66.7 times above threshold).

[0025] Figure 16 presents representative microscopy images of the experiments depicted in Figures 11-15. Approximately 1.0 pg of RNA was transfected into HDFn cells with MessengerMax transfection reagent (ThermoFisher). HDFn cells were incubated at reduced temperature conditions at 33°C (top panel) and at standard incubation conditions at 37°C (bottom panel) and in the presence or absence of B18R. Phase contrast images (left) and fluorescence images (right) were taken 24 hours post RNA transfection. Fluorescence images show EGFP expression levels.

[0026] Figure 17 presents representative results from fluorescence-activated cell sorting (FACS) analysis, comparing EGFP fluorescence intensity in TCVm-EGFP mRNA without poly(A) tail (top), control-EGFP synRNA with a standard 120-mer poly(A) tail as described in Warren et al., 2010 (middle), and an untransfected control (bottom). Approximately 1.0 µg of RNA was transfected into HDFn cells using MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured at 37°C under standard conditions in the presence of B18R. Cells were harvested 16 hours after mRNA transfection and subjected to FACS analysis. The geometric mean fluorescence intensity (MFI) shows that the translation efficiency of TCVm mRNA without the poly(A) tail is comparable to that of the standard mRNA.

[0027] Figure 18A presents representative bioluminescence images of a mouse luciferase assay one or two days after intramuscular injection of 20 µg of luciferase (LUC2)-encoding synRNA and InvivoFectamine 3.0 (ThermoFisher). In Figure 18B, luciferase activity was assessed by quantification of the bioluminescent signal. TCVm and NOV2 mRNAs were used as synRNAs encoding LUC2. Because a SapI restriction enzyme site exists in LUC2, the plasmid DNA was linearized with MluI (present immediately 3' to the SapI site). As a negative control, NOV2m-LUC synRNA generated after SapI linearization of the plasmid DNA was used as a background signal (shown as a dashed line in Figure 18B). Two mouse strains, C57BL / 6 and BALB / c, were used. TCVm-LUC2 (MluI) is highly translated in vivo, even without a poly(A) tail. NOV2m-LUC2 (MluI) also functions, but the translation efficiency is lower than that of TCVm-LUC2. Therefore, poly(A)-free synRNA is translatable in both C57BL / 6 and BALB / c mouse strains.

[0028] Figure 19 presents representative micrographs of experiments to test the effect of adding poly(A) tails to the 3’ end of poly(A)-tail-free mRNAs. Poly(A)-free control-EGFP synRNA (mlY) and its added versions (20A, 30A, 60A, and 120A). The A120 version is identical to the synRNA described in Warren et al., 2010, except for the mlY modification. NOV2m-EGFP (mlY) and its versions with added adenine homopolymers (20A, 30A, 60A, and 120A). MNESVm-EGFP (nucleosides unmodified) and its versions with added adenine homopolymers (20A, 30A, 60A, and 120A). TCVm-EGFP (mlY) and its versions with added adenine homopolymers (20A, 30A, 60A, and 120A). About 1.0 pg of RNA was transfected into HDFn cells with MessengerMax transfection reagent (ThermoFisher). HDFn cells were incubated at reduced temperature conditions at 33ºC with (top panel) or without (bottom panel) B18R. Fluorescence images were taken 24 hours after RNA transfection. Fluorescence images show EGFP expression levels.

[0029] Figure 20 presents representative micrographs of experiments as described in Figure 19, but with HDFn cells incubated at standard temperature conditions at 37ºC with (top panel) or without (bottom panel) B18R. Fluorescence images were taken 24 hours after RNA transfection. Fluorescence images show EGFP expression levels.

[0030] Figure 21 shows the percentage of GFP-positive HDFn cells in the experiments described in Figure 19. HDFn cells were incubated at reduced temperature conditions at 33ºC with (left panel) or without (right panel) B18R. EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) at day 1 post-transfection. GFP-positive (+) cells are presented as the percentage (%) of total live cells with fluorescence intensity of GFP > 30, GFP > 300 (10-fold above threshold), or GFP > 2000 (66.7-fold above threshold).

[0031] Figure 22 shows the percentage of GFP positive HDFn cells in the experiment described in Figure 20. HDFn cells were cultured at standard temperature conditions at 37ºC with B18R (left panel) or without B18R (right panel). EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) at day 1 post transfection. GFP positive (+) cells were presented as the percentage (%) of total live cells with fluorescence intensity of GFP > 30, GFP > 300 (10 times above threshold) or GFP > 2000 (66.7 times above threshold).

[0032] Figure 23A shows a schematic of NOV2m-DMD-A28 synRNA encoding full-length human dystrophin protein (DMD) (coding region of transcript variant Dp427m shown as nucleotides 238-11295 of NCBI Accession Number NM_004006). The mRNA sequence of NOV2m-DMD-A28 synRNA is shown as SEQ ID NO: 42. Figure 23B shows the results of immunohistochemistry using an antibody against human DMD (MANDYS 106, Millipore). Cell nuclei were visualized with 4’,6-diamidino-2-phenylindole (DAPI). HDFn cells were transfected with NOV2m-DMD-A28 synRNA using MessengerMax transfection reagent (ThermoFisher). Following synRNA transfection, HDFn cells were incubated with 250 ng / mL of B18R (Sigma) at 37ºC for 24 hours and subjected to immunohistochemistry.

[0033] Figure 24A shows a schematic of NOV2m-LUC-DMD-A28 synRNA encoding a fusion protein of luciferase (LUC) and full-length human dystrophin protein (DMD) (transcript variant Dp427m, NCBI Accession Number NM_004006). Figure 24B shows representative bioluminescence images of mouse luciferase assay. Rep. 1 and Rep. 2 indicate replicates. Figure 24C shows luciferase activity assessed by a bioluminescence imaging system. Briefly, 20.0 pg of NOV2m-LUC-DMD-A28 synRNA was complexed with Lipid Nanoparticles (LNP: InvivoFectamine 3.0, ThermoFisher) according to the manufacturer’s protocol. The synRNA / LNP complex was injected directly into the muscle of the right thigh region of BALB / c mice (day 0). The next day (day 1), luciferase activity was monitored by an AMI HTX bioluminescence imaging system (Spectral Instruments Imaging, Tucson, AZ, USA).

[0034] Figure 25A shows a schematic of NOV2m-COL7A1-LUC-A28 synRNA, which encodes a fusion protein of full-length human collagen type VII alpha-1 (VII) chain (COL7A1) protein (coding region of COL7A1 shown as nucleotides 64-8898 of NCBI Accession Number NM_000094) and luciferase (LUC) gene. Figure 25B shows results of immunohistochemistry using an antibody against human COL7A1 (MCA597GA, BioRad). Nuclei were visualized with DAPI. HDFn cells were transfected with NOV2m-COL7A1-LUC-A28 synRNA once (1x transfection) or three times (3x transfection) using MessengerMax transfection reagent (ThermoFisher). HDFn cells were incubated with 250 ng / mL of B18R (Sigma) at 37ºC for 24 hours after synRNA transfection (1x transfection) or for 72 hours after the first synRNA transfection (3x transfection). Samples were then subjected to immunohistochemistry.

[0035] Figure 26 shows the percentage of GFP-positive HDFn cells transfected with synRNAs in which a poly(A) tail was added to the 3’ end of a poly(A)-tail-free mRNA. SynRNAs used: DENVm-EGFP (Unm: unmodified nucleosides) and versions thereof with added adenine homopolymers (20A, 30A, 60A, and 120A). Approximately 1.0 pg of RNA was transfected into HDFn cells using MessengerMax transfection reagent (ThermoFisher). HDFn cells were incubated at reduced temperature conditions at 33ºC or at standard culture conditions at 37ºC with or without B18R. EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) at day 2 post-transfection. GFP-positive (+) cells were presented as the percentage (%) of total live cells with fluorescence intensity of GFP > 30, GFP > 300 (10-fold above threshold), or GFP > 2000 (66.7-fold above threshold).

[0036] Figure 27A shows a schematic of a synRNA molecule for SARSVm. The synRNA has a 5'-cap, 5'-UTR and 3'-UTR of severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2: NC_045512.2), a multiple cloning site (MCS), and a homopolymer of 50 adenines. The nucleotide sequence of the SARSVm 5'-UTR is set forth in SEQ ID NO: 37, and the nucleotide sequence of the SARSVm 3'-UTR+50(A) is set forth in SEQ ID NO: 38. Figure 27B shows the percentage of GFP positive HDFn cells transfected with SARSVm synRNA. Both unmodified natural synRNA (Unm) and modified synRNA (mlY) were tested. Approximately 1.0 pg of RNA was transfected into HDFn cells with MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured at reduced temperature at 33 °C or at standard culture conditions at 37 °C with or without B18R. EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) at day 1 post-transfection. GFP positive (+) cells were presented as the percentage (%) of total live cells with fluorescence intensity of GFP > 30, GFP > 300 (10-fold above threshold), or GFP > 2000 (66.7-fold above threshold).

[0037] Figure 28 shows the change in luciferase activity in BALB / c mice from day 1 to day 8 post intramuscular injection of 20 pg each of NOV2m (A50)-LUC synRNA, NOV2m (A30)-LUC synRNA, DENVm (A50)-LUC synRNA, or DENVm (A30)-LUC synRNA. Both unmodified natural synRNA (Unm) and modified synRNA (mlY) were tested. The synRNA was complexed with Invivofectamine 3.0 (ThermoFisher) prior to intramuscular injection. Luciferase activity was assessed by an AMI HTX bioluminescence imaging system (Spectral Instruments Imaging, Tucson, AZ, USA). The mean ± SEM (n = 2) is plotted.

[0038] Figure 29 shows changes in luciferase activity in BALB / c mice from day 1 to day 13 after receiving intradermal injection of 20 pg of modified or unmodified NOV2m (A50)-LUC synRNA, NOV2m (A30)-LUC synRNA, DENVm (A50)-LUC synRNA, or DENVm (A30)-LUC synRNA. The synRNAs were dissolved in lactated Ringer’s solution and delivered to the skin without the use of a transfection reagent or lipid nanoparticles (LNPs). To test the effect of chitosan oligosaccharide on gene expression, the synRNAs were injected intradermally with chitosan oligosaccharide (1.5 pg / ml final concentration) [chitosan (+)] or without chitosan oligosaccharide [chitosan (-)]. Luciferase activity was assessed by an AMI HTX bioluminescence imaging system (Spectral Instruments Imaging, Tucson, AZ, USA). Plots of the mean ± SEM [n = 2 for chitosan (-) condition; n = 3 for chitosan (+) condition] are presented.

[0039] Figure 30A shows a schematic of a synRNA encoding a fusion protein of collagen type I, comprising two COL1A1 proteins (each 1,464 amino acids in length) and one COL1A2 protein (1,366 amino acids in length) fused via nucleic acids encoding 2A self-cleaving peptides (e.g., T2A and E2A). The nucleotide sequence encoding an exemplary COL1A fusion protein is set forth in SEQ ID NO: 39. Figure 30B shows a schematic of a synRNA encoding a fusion protein of erythropoietin (EPO), comprising multiple copies of an EPO protein (193 amino acids in length) fused via nucleic acids encoding 2A self-cleaving peptides (e.g., F2A, T2A, E2A, and P2A). The nucleotide sequence encoding an exemplary EPO fusion protein is set forth in SEQ ID NO: 40. Figure 30C shows a schematic of a synRNA encoding a ribonucleoprotein-telomerase, consisting of a 5’-cap, a 5’-UTR, a telomerase reverse transcriptase (TERT: 1,132 amino acids) encoding region of a protein component, a 3’-UTR, a ribozyme, a telomerase RNA (TERC: 451 nt.) as an RNA component, a ribozyme, and a poly(A) tail. The nucleotide sequence of an exemplary TERT-TERC mRNA is set forth in SEQ ID NO: 41.

[0040] Figure 31 shows the correct localization of full-length human dystrophin in mouse skeletal muscle one day after injection of 20 µg NOV2m-DMD-A28 synRNA + Invivofectamine (BALB / c mice). Ab (MANDYS106) does not recognize mouse dystrophin but does recognize human dystrophin, while Ab (AB15277) recognizes both mouse and human DMD.

[0041] Figures 32A-32B show recovery of muscle force in D2.mdX mutant mice following intramuscular injection of mRNA-DMD. Briefly, 20 pg of NOV2m-DMD-A28 synRNA or mRNA-LUC (luciferase: control) was mixed with Invivofactamine (ThermoFisher) in a total volume of 60 pL. Using a 31G needle, D2.mdX mutant mice (lacking mouse dystrophin protein) received 3 intramuscular injections of approximately 4 pg (12 pL) of NOV2m-DMD-A28 synRNA or mRNA-LUC in the ventral forelimbs and 2 intramuscular injections in the dorsal forelimbs, with a total of 20 pg (60 pL) in each of the right and left forelimbs. The injections were initiated at 11 weeks of age and were given once per week for a total of 6 injections. The final injection was at 16 weeks of age. Peak muscle force of the forelimbs was measured by a grip strength meter (Harvard apparatus). Measurements were taken twice, 30 minutes apart. Peak muscle force was normalized to mouse body weight and the average of the two measurements was used for analysis. Figure 32A shows peak muscle force one week after the final injection (measured at 17 weeks). The NOV2m-DMD-A28 injected group showed statistically significant (p < 0.05) muscle force recovery compared to the non-injected group (D2.mdX: control) and the mRNA-LUC (luciferase: control) injected group (D2.mdX-LUC). There was no statistically significant difference between the D2.mdX-DMD group and the wild-type DBA / 2 group (control). Figure 32B shows recovery of muscle force in D2.mdX mutant mice (lacking dystrophin protein) by a single intramuscular injection of NOV2m-DMD-A28. Briefly, 20 pg of NOV2m-DMD-A28 synRNA was mixed with Invivofactamine (ThermoFisher) in a total volume of 60 pL. Using a 34G needle, D2.mdX mutant mice received a single intramuscular injection of approximately 4 pg (12 pL) of NOV2m-DMD-A28 in 3 sites in the ventral forelimbs and 2 sites in the dorsal forelimbs, with a total of 20 pg (60 pL) in each of the right and left forelimbs. The injection was performed at 18 weeks of age. Three weeks later, when the mice were 21 weeks of age, peak muscle force of the forelimbs was measured by a grip strength meter (Harvard apparatus). Measurements were taken twice, 30 minutes apart. Peak muscle force was normalized to mouse body weight and the average of the two measurements was used for analysis. At 21 weeks, the NOV2m-DMD-A28 synRNA injected group (n = 5) showed significant muscle force recovery, while the non-injected control group (n = 4) did not show significant muscle force recovery. DETAILED DESCRIPTION

[0042] Typically, synthetic mRNA (synRNA) shares sequence characteristics with cellular mRNA. That is, synRNA typically comprises a 5'-cap, a 5'-UTR, a CDS, a 3'-UTR, and a poly(A) tail. The present disclosure relates to methods for generating translatable synRNAs lacking a poly(A) tail. As described herein, synRNAs based on positive-sense single-stranded RNA (+ssRNA) viruses that naturally lack a poly(A) tail are designed to remove sequences encoding the viral RNA-dependent RNA polymerase, thereby separating the translational function of +ssRNA viruses from their replication function. Expression cassettes based on these designs are inserted into plasmids, which can be used as templates to produce synRNAs suitable for in vitro and in vivo use. Such synRNAs can be produced by any method known in the art, including in vitro transcription of template DNA, chemical synthesis of RNA, and plasmid or viral expression vectors. Furthermore, synRNAs can be produced with or without modified nucleosides. Additional genetic elements can be incorporated into the synRNA. In one embodiment, the synRNA comprises a single CDS. In another embodiment, the synRNA comprises multiple CDSs constructed by fusing two or more CDSs. In another embodiment, the synRNA comprises multiple CDSs connected by an internal ribosome entry site (IRES). In another embodiment, the synRNA comprises multiple CDSs separated by nucleotides encoding a flexible linker (e.g., a glycine-serine-linker). In another embodiment, the synRNA comprises multiple CDSs separated by nucleotides encoding a 2A self-cleaving peptide (e.g., P2A, E2A, F2A, or T2A). General Techniques and Definitions

[0043] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the skill of the art.

[0044] As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless otherwise indicated. For example, "a" excipient includes one or more excipients.

[0045] As used herein, the phrase "comprising" is open-ended, indicating that such embodiments may include additional elements. In contrast, the phrase "consisting of is closed, indicating that such embodiments do not include additional elements (except for trace impurities). The phrase "consisting essentially of is partially closed, indicating that such embodiments may further include elements that do not materially change the basic characteristics of such embodiments.

[0046] As used herein, the term "about" with respect to a value encompasses 90% to 110% of that value (eg, about 500 nucleotides in length when used with respect to an RNA molecule refers to an RNA molecule that is 450 to 550 nucleotides in length).

[0047] As used herein, the term "synthetic mRNA," abbreviated as "synRNA," refers to an mRNA molecule comprising at least a 5'-UTR (5'-untranslated region), a CDS (coding sequence), and a 3'-UTR (3'-untranslated region), wherein the CDS is heterologous to at least the 3'-UTR. Therefore, synRNA is not a naturally occurring molecule.

[0048] As used herein, the term "poly(A) tail" refers to a stretch of at least about 15 consecutive adenine nucleotides, typically present at the end of the 3'-UTR of an mRNA molecule. DNA encoding mRNA molecules native to mammalian cells does not include an adenine homopolymer at its 3' end. Instead, adenine is added to the 3'-UTR by polyadenylate polymerase to form an adenine homopolymer (i.e., a poly(A) tail). The genomes of certain single-stranded positive-sense RNA (+ssRNA) viruses also lack an adenine homopolymer at their 3' end. The length of the poly(A) tail of a native mRNA molecule depends on the cell species in which it is produced. Mammalian cells typically produce mRNA from genomic DNA with longer poly(A) tails (e.g., typically longer than 100 consecutive adenine nucleotides, such as about 75 to about 275 consecutive adenine nucleotides in length).

[0049] When used in relation to an mRNA molecule, the terms "no poly(A) tail", "no poly(A)", etc. refer to an mRNA molecule that does not comprise a poly(A) tail as defined above. In some embodiments, the mRNA lacking a poly(A) tail has no more than about 10 consecutive adenine residues downstream of its 3'-UTR.

[0050] Unless otherwise specified, the terms "polypeptide" and "protein" are used interchangeably to refer to a polymer of amino acid residues and are not limited to a certain length. Polypeptides can contain natural amino acid residues or a combination of natural and non-natural amino acid residues. The term also includes post-translational modifications of the polypeptide, such as glycosylation, sialylation, acetylation, phosphorylation, etc. In some aspects, a polypeptide can contain modifications relative to the native or natural sequence as long as the protein maintains the desired activity (e.g., antigenicity).

[0051] As used herein with respect to a protein of interest, the terms "coding sequence," "CDS," "open reading frame," and "ORF" refer to a nucleotide sequence encoding a protein of interest. Due to the degeneracy of the genetic code, multiple different nucleotide sequences can encode the same amino acid sequence.

[0052] The terms "isolated" and "purified" as used herein refer to material that is removed from at least one component with which it is naturally associated (e.g., removed from its original environment). The term "isolated" when used in reference to a recombinant protein means a protein that has been removed from the culture medium of the host cell in which the protein was produced. In some embodiments, an isolated protein is at least 75%, 90%, 95%, 96%, 97%, 98%, or 99% pure, as determined by HPLC.

[0053] An "effective amount" or "sufficient amount" of a substance is an amount that is sufficient to affect a beneficial or desired result including a clinical outcome, and as such, an "effective amount" depends on the context of its use.

[0054] In the present disclosure, the terms "individual" and "subject" refer to a mammal. "Mammal" includes, without limitation, humans, non-human primates (e.g., monkeys), farm animals, sport animals, rodents (e.g., mice and rats), and pets (e.g., dogs and cats). In some embodiments, the subject is a human subject.

[0055] The term "dose" as used herein in reference to a composition comprising mRNA encoding a protein of interest refers to a measured portion of mRNA that a subject takes (administers to or is administered by) at any one time.

[0056] The relative terms "higher" and "lower" refer to a measurable increase or decrease, respectively, in a reaction or parameter when compared to otherwise identical conditions except for the parameter of interest or, alternatively, as compared to another condition. For example, the phrases "higher levels of protein expression" and "stronger protein expression" refer to a level of protein expression that is greater than 1-fold, preferably greater than 2, 3, 4, 5, 6, 7, 8, 9, or 10-fold, as a result of contacting a cell with a composition of the disclosure comprising mRNA encoding the protein as compared to a level of protein expression that is a result of a control condition (e.g., administration of a comparative composition that does not comprise the mRNA or comprises a control mRNA that does not encode the protein). The phrases "lower levels of protein expression" and "weaker protein expression" refer to a level of protein expression that is less than 1-fold, preferably less than 2, 3, 4, 5, 6, 7, 8, 9, or 10-fold, as a result of a control condition (e.g., administration of a comparative composition that does not comprise the mRNA or comprises a control mRNA that does not encode the protein) as compared to a level of protein expression that is a result of administration of a composition of the disclosure comprising mRNA encoding the protein.

[0057] As used herein, "percent (%) amino acid sequence identity," "percent identity," and "sequence identity," when used with respect to an amino acid sequence (reference polypeptide sequence), are defined as the percentage of amino acid residues in a candidate sequence (e.g., a subject antigen) that are identical to the amino acid residues in the reference polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for the purpose of determining percent amino acid sequence identity can be achieved in a variety of ways well known in the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN, or MegAlign (DNASTAR) software. One skilled in the art can determine appropriate parameters for aligning sequences, including any algorithm needed to achieve maximum alignment over the full length of the sequences being compared.

[0058] Amino acid substitutions can include replacing one amino acid with another amino acid in a polypeptide. Amino acid substitutions can be introduced into an antigen of interest and the products screened for desired activity (e.g., increased stability and / or immunogenicity).

[0059] Amino acids can generally be grouped according to the following common side chain properties: (1) Hydrophobicity: norleucine, Met, Ala, Val, Leu, Ile; (2) Neutral hydrophilicity: Cys, Ser, Thr, Asn, Gln; (3) Acidic: Asp, Glu; (4) Basic: His, Lys, Arg; (5) Residues that affect chain orientation: Gly, Pro; and (6) Aromatic: Trp, Tyr, Phe.

[0060] Conservative amino acid substitutions will involve exchanging a member of one of these classes with another member of the same class. Non-conservative amino acid substitutions will involve exchanging a member of one of these classes with a member of another class.

[0061] As used herein, the term “excipient” refers to a compound present in a composition comprising an active ingredient (e.g., mRNA encoding a protein of interest). Pharmaceutically acceptable excipients are inert pharmaceutical compounds, and can include, for example, solvents, fillers, buffers, tonicity adjusting agents, and preservatives (Pramanick et al., Pharma Times, 45:65-77, 2013). In some embodiments, the compositions of the present disclosure comprise an excipient that functions as one or more of a solvent, a filler, a buffer, and a tonicity adjusting agent (e.g., sodium chloride in saline can act as both an aqueous vehicle and a tonicity adjusting agent). I. Synthetic mRNA (synRNA)

[0062] To establish synRNA as a biologic manufactured correctly in CMC (Chemistry, Manufacturing, and Control), it is important to ensure the identity and consistency of synRNA between produced batches. One of the technical hurdles involves ensuring that the synRNA molecules in a batch have the same sequence. A particularly problematic part of synRNA is the poly(A) tail, a homopolymer that typically comprises over 100 adenine (A) nucleotides. Essentially all eukaryotic mRNAs contain a poly(A) region at their 3’ end. A mixture of synRNAs with different poly(A) tail lengths is not ideal as a therapeutic product.

[0063] Three methods are commonly used to add a poly(A) tail to the 3’ end of synRNA. One method for adding a poly(A) tail involves the use of a poly(A) polymerase. However, the length of the poly(A) tail cannot be controlled using this method (Holtkamp et al., 2006).

[0064] Another method is to add a poly(A) region by tail-PCR using a primer containing a long stretch of thymine (T) nucleotides at the 5’ end. The PCR product is then used as a template for in vitro transcription (IVT) of synRNA by T7-RNA polymerase, T3-RNA polymerase, or SP6-RNA polymerase (Warren et al., 2010). This method allows for the addition of a 120 poly(A) stretch at the 3’ end of synRNA (Warren et al., 2010). Disadvantages of this method include: (1) difficulty in guaranteeing that the PCR product has the same sequence; (2) difficulty in scaling up the production of the PCR product; and (3) difficulty in performing PCR amplification for long coding sequences.

[0065] Another approach is to include a poly(A) stretch in the plasmid DNA, which can then be used as template DNA for in vitro transcription (IVT) of synRNA by T7-RNA polymerase, T3-RNA polymerase or SP6-RNA polymerase after linearization of the plasmid DNA by restriction enzyme digestion. This approach is suitable for scale-up and maintaining sequence identity during amplification in E. coli. Thereby, this approach overcomes the shortcoming of the tail-PCR approach. However, one of the main limitations of this approach is that the homopolymer in the plasmid DNA is usually unstable and often truncated during amplification of the plasmid DNA in E. coli. This limits the size of the poly(A) tail to a length shorter than the desired length of the poly(A) tail. In an attempt to overcome this problem, a segmented poly(A) tail can be utilized. The segmented poly(A) tail is composed of relatively short poly(A) stretches (e.g., about 50 A nucleotides) connected by non-poly(A) linkers (Trepotec et al., 2019). However, this technology does not guarantee the integrity of the synRNA. In particular, the coding sequence for a large protein of interest increases the size of the plasmid DNA, and including an overly long adenine homopolymer results in a large plasmid that is even less stable than a smaller plasmid.

[0066] The present disclosure solves these problems by designing synRNA molecules that lack a poly(A) tail at the 3’ end. Eliminating the poly(A) tail from synRNA is counterintuitive given the critical importance of the poly(A) tail for mRNA stability and protein production. In fact, there are numerous scientific publications demonstrating that mRNA lacking a poly(A) tail lacks protein production (see, e.g., Holtkamp et al., 2006).

[0067] During the development of the present disclosure, natural examples of functional mRNA lacking a poly(A) tail were considered. An example of an mRNA without a poly(A) tail is the chromosome of some positive-sense single-stranded RNA (+ssRNA) viruses. Replication of +ssRNA viruses requires a virus-specific RNA-dependent RNA polymerase (RdRp). However, the RNA genome is typically delivered to a cell that lacks the RdRp protein. Therefore, the RNA genome must first be translated using the host cell translation machinery to produce the RdRp. Thus, many +ssRNA viral chromosomes are similar to host cell mRNAs in that they contain a 5'-cap, a 5'-untranslated region (5'-UTR), a coding sequence (CDS), a 3'-UTR, and a poly(A) tail. The CDS of a +ssRNA viral genome must include the open reading frame of the RdRp. Once translated, the RdRp replicates the +ssRNA genome, and thus the 5'-UTR, 3'-UTR, and other RNA genome sequences play a critical role not only in translation but also in replication. By removing the CDS of the RdRp from a +ssRNA viral genome, thereby separating the translation function of the +ssRNA from the replication function, it is in principle possible to convert any +ssRNA virus into a non-replicative synRNA platform.

[0068] Interestingly, some +ssRNA viruses do not have a poly(A) tail. Examples of +ssRNA virus families that lack a poly(A) tail include, but are not limited to, Nodaviridae (Sahul Hameed et al., 2019), Flaviridae (Simmonds et al., 2017), and Tetraviridae (Dorrington et al., 2009). Flaviridae includes, but is not limited to, flaviviruses (e.g., yellow fever virus, dengue virus, Zika virus, Japanese encephalitis virus, West Nile virus, and tick-borne encephalitis virus), pestiviruses (e.g., bovine viral diarrhea virus and classical swine fever virus), and hepaciviruses (e.g., hepatitis C virus) and Pegivirus.

[0069] Furthermore, some +ssRNA viruses (mainly against plants) do not even have a 5'-cap structure. Thus, these +ssRNA viruses are 5'-capless and poly(A)-tailless (Nicholson and White 2011). These +ssRNA viruses employ a mechanism called 3'-cap-independent translation enhancer (3'-CITE), which is divided into 6 major classes. Examples of +ssRNA viruses that lack both a 5'-cap and a 3'-poly(A) tail include, but are not limited to, Barley yellow dwarf virus (BYDV), Maize necrotic streak virus (MNESV), Pea mosaic virus (PMV), Pea enation mosaic virus-2 (PEMV2), and Turnip crinkle virus (TCV).

[0070] Thus, the present disclosure provides an RNA molecule comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein the 3'-UTR is a viral 3'-UTR or a fragment thereof, optionally wherein the fragment is at least 40 nucleotides in length, and the CDS is heterologous to the virus and replaces the open reading frame of the virus, and the virus is a positive-sense single-stranded RNA (+ssRNA) virus whose genome (or its chromosome) lacks a poly(A) tail. In some embodiments, the +ssRNA virus is a member of a virus family selected from the families Nodamuraviridae, Flaviviridae, and Tetraviridae. In some embodiments, the +ssRNA virus is selected from plant viruses lacking both a 5'-cap and a 3'-poly(A) tail, such as barley yellow dwarf virus (BYDV), maize necrotic streak virus (MNESV), millet mosaic virus (PMV), pea ear mosaic virus-2 (PEMV2), and turnip crinkle virus (TCV). However, it was found that the translation efficiency of +ssRNA without a 5'-cap in human cells was quite low. Therefore, in some embodiments, a cap structure is artificially added to the 5' end of these synRNAs. In some embodiments, an adenine homopolymer of defined length is added to the 3' end of these synRNAs (synthetic poly (A) tail). Ideally, the synthetic poly (A) tail has a defined length and is shared by multiple synRNAs prepared by in vitro transcription. The uniformity of the length and sequence of the 3' adenine homopolymer is beneficial for synRNA purification and for the characterization of pharmaceutical compositions containing synRNAs. II. Nodaviridae Chromosome

[0071] The Nodamura virus family includes, but is not limited to, Nodamura virus (RNA1 [AF174533 = NC_002690], RNA2 [AF174534 = NC_002691]) and Flockhouse virus (RNA1 [X77156 = NC_004146], RNA2 [X15959 = NC_004144]). Genetic components of Nodamura virus (NOV) (Newman 1975) were used as a platform for generating poly(A)-free synRNAs, as described in Examples 1-5. However, RNA fragments from other +ssRNA viruses lacking a poly(A) tail can also be used to generate poly(A)-free synRNAs.

[0072] Nodamura virus (NOV) is a bipartite RNA virus with two RNA chromosomes: RNA1 encodes RNA-dependent RNA polymerase (RdRp); RNA2 encodes capsid protein (Hameed 2019). Both NOV1 and NOV2 have 5'-cap, 5'-UTR, CDS, 3'-UTR, but not poly(A) tail (Hameed 2019). Previously, it has been shown that stem-loop structure at 3'-UTR is essential for replication of NOV (Rosskopf, 2010). However, it has not been investigated whether just 5'-cap, 5'-UTR, and 3'-UTR are sufficient to drive efficient translation of CDS, especially foreign CDS.

[0073] First, it was tested whether NOV1 and NOV2 can be used as a platform for synRNAs without poly(A). The CDS of NOV1 and NOV2 were replaced with EGFP coding sequence to generate NOV1-EGFP RNA (SEQ ID NO: 1) and NOV2-EGFP RNA (SEQ ID NO: 2). The RNAs were prepared by IVT using T7 RNA polymerase and plasmid DNA templates linearized with Sap I restriction enzyme (Example 1). The exemplary plasmid DNA templates contain T7 promoter; however, other promoters can be used to drive transcription (e.g., T3, SP6, etc.). The exemplary synRNAs contain 5'-cap added using CleanCap-AG (TriLink). Even so, other methods can be used to add 5'-cap in IVT RNA. Although the naturally occurring NOV RNAs do not have any nucleoside modifications, both the native form (unmodified) and the 5mC and Ψ-modified forms were generated.

[0074] NOV1-EGFP RNA and NOV2-EGFP RNA were transfected into human fibroblasts, and the viability and expression of EGFP were monitored by microscopy. It was found that both NOV1 and NOV2 untranslated regions are suitable for producing translatable synRNAs lacking poly(A) tail (Example 2). Interestingly, NOV2 synRNA resulted in stronger EGFP protein expression than NOV1. This is surprising because NOV1 chromosome encodes RdRp, which is used to replicate both NOV1 and NOV2 RNA chromosomes, and thus one might expect NOV1 to be more effective than NOV2 in terms of initial protein expression. However, the actual outcome was the opposite. Although the 3' end stem-loop structure of the 3'-UTR of NOV2 is known to be essential for NOV2 RNA replication (Rosskopf et al., 2010), the role of NOV2 3'-UTR on translation has not been reported.

[0075] Unmodified NOV1-RNA and NOV2-RNA were found to be cytotoxic (Example 2). After transfecting unmodified NOV1-RNA and unmodified NOV2-RNA into human fibroblasts, many dead cells were observed. Recombinant B18R protein was tested as a means to reduce cytotoxicity, as it is known to suppress innate immunity by neutralizing type I interferon (IFN). While B18R was found to reduce cytotoxicity caused by transfecting cells with NOV1-RNA and NOV2-RNA to some extent and under certain conditions, B18R did not completely reduce cytotoxicity. Modifying the nucleosides of NOV1 and NOV2 synRNA by replacing cytosines with 5mC and uridines with Ψ (5mC + Ψ) reduced cytotoxicity (Example 2). Naturally occurring NOV1 RNA and NOV2 RNA do not contain nucleoside modifications. Thus, the fact that artificial modification of nucleosides significantly reduced the cytotoxicity of NOV1 and NOV2 RNA was unexpected.

[0076] To test whether other nucleoside modifications are compatible with NOV2-RNA translation, NOV2-EGFP synRNA modified with 5mC + Ψ, 5moU, mlΨ, or Ψ was transfected into human fibroblasts. Viability and EGFP protein expression were monitored by microscopy (Example 3). As observed in Example 2, unmodified NOV2 synRNA was cytotoxic, and certain nucleoside modifications at least partially reduced cytotoxicity. Of the modifications tested, 5mC + Ψ and mlΨ produced the strongest levels of EGFP expression, but other modifications were also somewhat effective at reducing cytotoxicity (Example 3).

[0077] NOV1 synRNA and NOV2 synRNA were found to be translatable at both 37ºC and 33ºC, but expression was slightly stronger at 37ºC than at 33ºC (Example 2, Example 3). Previous NOV studies were conducted at 28ºC, 31ºC, and 34ºC (Ball et al., 1992; Johnson 2003). Because the optimal temperature for NOV replication is about 28ºC, and viral replication is greatly reduced at 37ºC (Johnson 2003). Thus, when transfected cells were cultured at 33ºC instead of 37ºC, higher levels of NOV1 synRNA and NOV2 synRNA were expected. Therefore, it was unexpected to find that NOV1 and NOV2 synRNA were comparable or higher in translatability when transfected cells were cultured at 37ºC compared to 33ºC.

[0078] To further develop NOV2-RNA as a poly(A)-free synRNA platform, the effect of additional nucleotides around the ATG start codon and stop codon on CDS translation was tested. For this purpose and to facilitate cloning of plasmid DNA templates for IVT of additional synRNAs, a multiple cloning site was inserted immediately upstream of the ATG start codon and extended to the stop codon (Example 4). In this way, the ATG-stop portion of the native NOV2 synRNA sequence was removed. This construct is referred to as NOV2m. Exemplary nucleic acid fragments inserted within the multiple cloning site of NOV2m include a Kozak consensus sequence, an ATG start codon, an EGFP coding sequence, and a stop codon. EGFP from NOV2m-EGFP RNA is translated as well as EGFP from NOV2-EGFP (Example 4, Example 5). Thus, NOV2m is an important tool to simplify cloning of any CDS into the multiple cloning site of a plasmid DNA that is used as a template for the production of synRNAs without a poly(A) tail.

[0079] Subsequently, EGFP protein expression from the poly(A)-free NOV2m-EGFP synRNA was compared to a control-EGFP synRNA comprising a poly(A) tail of 120A (Example 5). It was found that EGFP expression levels from the NOV2m synRNA lacking a poly(A) tail were comparable to EGFP expression levels from the control-EGFP synRNA comprising a poly(A) tail of 120 nucleotides.

[0080] Accordingly, the present disclosure provides a RNA molecule comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) of at least one protein, and a 3'- untranslated region (3'-UTR), wherein the 3'-UTR is a Nodamura virus RNA2 (NOV2) 3'-UTR or a fragment thereof or a Nodamura virus RNA1 3'-UTR or a fragment thereof, optionally wherein the fragment is at least 40 nucleotides in length, and the CDS is heterologous to NOV2 or NOV1 and replaces the open reading frame for the Nodamura virus coat protein or the open reading frame for the Nodamura virus RNA-dependent RNA polymerase (RdRp) of NOV2. III. Flaviviridae Chromosomes

[0081] The Flaviviridae family includes, but is not limited to, Flaviviruses (e.g., Yellow fever virus, Dengue virus, Zika virus, Japanese encephalitis virus, West Nile virus, and Tick-borne encephalitis virus), Pestiviruses (e.g., Bovine viral diarrhea virus and Classical swine fever virus), and Hepaciviruses (e.g., Hepatitis C virus) and Pegiviruses.

[0082] As a typical example, the genetic components of Dengue Virus 2 (DENV) (NC_001474.2; Kinney et al., 1997) were utilized as a platform for the production of synRNAs lacking a poly(A) tail, as described in Example 6. However, RNA segments of other +ssRNA viruses lacking a poly(A) tail can also be utilized for the production of synRNAs lacking a poly(A) tail.

[0083] Dengue virus (DENV) is a non-segmented +ssRNA virus with an 11 kb single RNA genome, which is modified at the 5’ end with a cap-1 structure for canonical cellular translation. The 3’ end of the RNA genome does not carry a poly(A) tail. Rather, a loop structure is formed. Interestingly, a cap-independent translation mechanism for DENV has also been described (Mazeaud et al., 2018). Therefore, we tested both the cap 1 (Figure 5A) and the capless (Figure 5B) versions of DENV RNA (Example 6).

[0084] DENV RNA is known to circularize through complementary sequences located at both the 5’-UTR (including the sequence downstream of the ATG start codon) and the 3’-UTR (Mazeaud et al., 2018). To make a DENV-based synRNA construct that allows for the insertion of a foreign CDS starting from the ATG to the stop codon, we introduced two mutations changing AUG to AUC at both locations (Figure 5C). These mutations eliminated the two ATG start codons upstream of the multiple cloning site. To maintain the circular structure of the DENV-based synRNA, two corresponding mutations in the 3’-UTR were also introduced (CAU to GAU; GAC to CAC) (Figure 5C).

[0085] The final DENV-based synRNA construct, designated DENVm RNA, contains a 5'-cap, a 5'-UTR (mutated), a multiple cloning site (MCS), a 3'-UTR (mutated), and does not contain a poly(A) (SEQ ID NO: 11). The RNA was prepared by IVT using a T7 RNA polymerase and plasmid DNA template linearized with a Sap I restriction enzyme (Example 6). The exemplary plasmid DNA template contains a T7 promoter; however, other promoters can be used to drive transcription (e.g., T3, SP6, etc.). The exemplary synRNA includes a 5'-cap added using CleanCap-AG (TriLink). Other methods can be used to add a 5'-cap in the IVT RNA, even so. Other caps can be used as well, such as CapO, Cap2, etc. As noted above, a capless version was also produced, designated capless-DENVm RNA, which starts with a GGG sequence (SEQ ID NO: 12). Both the native version (unmodified, Unm) and the m1y-modified version were produced. Other modified nucleosides can be used as well. To test protein production, EGFP was cloned into the MCS.

[0086] DENVm-EGFP RNA and capless-DENVm-EGFP RNA were transfected into human fibroblasts and EGFP expression was monitored by microscopy and Moxi Go II cell analyzer (Examples 7, 8).

[0087] DENVm synRNA was able to produce protein, EGFP in this example, under all four culture conditions (30ºC or 37ºC; B18R+ or B18R-) (Examples 7, 8; Figure 6). In contrast, the capless version (capless-DENVm) produced very low levels of protein (Figure 7), indicating that the 5'-cap is required for efficient translation from DENVm RNA.

[0088] Interestingly, the DENVm synRNA has many unique features that are not common in usual synRNAs. First, unlike other synRNAs, the DENVm synRNA shows stronger protein production in its native form (i.e., nucleosides unmodified form) than in the nucleoside-modified form (Figure 6). It is also noteworthy that, unlike other synRNAs (especially the unmodified form), the presence or absence of B18R does not affect protein production (Figure 6). Also unusual is that the DENVm-EGFP (unmodified) synRNA shows stronger expression at day 4 compared to day 1 (Figure 6), as synRNAs usually show strong expression at day 1, which gradually weakens over time. However, even in this case, day 4 seems to be the time of peak expression, as expression subsequently decreases over time and becomes very low by day 11.

[0089] Accordingly, the present disclosure provides an RNA molecule comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) of at least one protein, and a 3'- untranslated region (3'-UTR), wherein the 5'-UTR and 3'-UTR are Dengue virus 5'-UTR and 3'-UTR. The DENVm synRNA provides unique features that are different from the usual synRNA platform: notably, protein production from the DENV2m synRNA is stronger in the native unmodified form than in the modified nucleoside form. This can be particularly useful for applications that require unmodified synRNA of nucleosides. Such examples include, but are not limited to, applications for vaccines and ribonucleoproteins. IV. Plant virus chromosomes

[0090] Unlike +ssRNA viruses that infect insects and vertebrates, +ssRNA viruses that infect plants do not have either a 5'-cap structure or a poly(A) tail (Nicholson and White 2011). Thus, the genetic components of these plant +ssRNAs are an interesting alternative to the usual synRNAs. However, whether plant viral genetic components (such as 5'-UTR and 3'-UTR) are functional in mammalian cells, especially in human cells, is essentially unknown.

[0091] To test these plant+ssRNA viruses as a platform for therapeutic use of synRNAs, we used a mechanism called 3'-cap-independent translation enhancer (3'-CITE) as a guide. 3'-CITE is divided into 6 major classes (Nicholson and White 2011). These 3'-CITEs are located in the 3'-UTR of +ssRNA viruses and have the function of helping to position the 3' end of the RNA near the 5' end of the RNA. This circularization of the mRNA is required for efficient translation of the mRNA and production of protein. In mammalian cells, this circularization of the mRNA is mediated by the interprotein interaction between eIF4e binding to the 5'-cap structure and poly(A)-binding protein binding to the 3'-poly(A) sequence. Plant +ssRNA viruses achieve this circularization without a 5'-cap, without a 3'-poly(A) sequence. We selected 5 different plant +ssRNA viruses, prepared synRNA constructs (Examples 9, 11), and tested EGFP expression in human fibroblasts (Examples 10, 12, 13, 14, 15).

[0092] Barley yellow dwarf virus (BYDV: NC_004750.1) contains a 3' CITE that folds into a compact cruciform RNA secondary structure and is called the BYDV-like translation element (BTE). We tested four different forms of BYDV-based synRNAs. BYDVm RNA (SEQ ID NO: 13) contains 5'-cap 1, 5'-UTR, MCS, 3'-UTR (without BTE), and no poly(A). Cap-less-BYDVm RNA (SEQ ID NO: 14) contains no 5'-cap, 5'-UTR, MCS, 3'-UTR (without BTE), and no poly(A). Neither of these RNAs contains the BTE motif. BYDV2m RNA (SEQ ID NO: 15) contains 5'-cap 1, 5'-UTR, MCS, BTE (added), 3'-UTR, and no poly(A). Cap-less-BYDV2m RNA (SEQ ID NO: 16) contains no 5'-cap, 5'-UTR, MCS, BTE (added), 3'-UTR, and no poly(A).

[0093] Maize necrotic streak virus (MNESV: NC_007729.1) contains a 3’ CITE that folds into an I-shaped RNA secondary structure (ISS). We tested two different versions of MNESV-based synRNAs. MNESVm RNA (SEQ ID NO: 17) contains 5’-Capl, 5’-UTR, MCS, 3’-UTR, and does not contain poly(A). Capless-MNESVm RNA (SEQ ID NO: 18) does not contain 5’-Cap, contains 5’-UTR, MCS, 3’-UTR, and does not contain poly(A).

[0094] Pea mosaic virus (PMV: U55002.1) contains a 3’ CITE that folds into a T-shaped RNA secondary structure and is known as the PMV-like translation element (PTE). We tested two different versions of PMV-based synRNAs. PMVm RNA (SEQ ID NO: 19) contains 5’-Capl, 5’-UTR, MCS, 3’-UTR, and does not contain poly(A). Capless-PMVm RNA (SEQ ID NO: 20) does not contain 5’-Cap, contains 5’-UTR, MCS, 3’-UTR, and does not contain poly(A).

[0095] Pea earliness mosaic virus-2 (PEMV2: NC_003853.1) contains the same 3’ CITE as PMV, known as the PTE. We tested two different versions of PEMV2-based synRNAs. PEMV2m RNA (SEQ ID NO: 21) contains 5’-Capl, 5’-UTR, MCS, 3’-UTR, and does not contain poly(A). Capless-PEMV2m RNA (SEQ ID NO: 22) does not contain 5’-Cap, contains 5’-UTR, MCS, 3’-UTR, and does not contain poly(A).

[0096] Turnip crinkle virus (TCV: X05193.1) contains a 3’ CITE that folds into a complex T-shaped structure (TSS) similar to tRNA. Because its subgenomic sequence encoding coat protein is expressed more highly than the genomic sequence, we used the subgenomic sequence, i.e., the turnip crinkle virus RNA encoding coat protein (TCV: NC_003821.3). We tested two different versions of TCV-based synRNAs. TCVm RNA (SEQ ID NO: 23) contains 5’-Capl, 5’-UTR, MCS, 3’-UTR, and does not contain poly(A). Capless-TCVm RNA (SEQ ID NO: 24) does not contain 5’-Cap, contains 5’-UTR, MCS, 3’-UTR, and does not contain poly(A).

[0097] First, capless versions of plant virus-based synRNAs were tested on human fibroblasts. These synRNAs were capless-BYDVm RNA, capless-BYDV2m RNA, capless-MNESVm RNA, capless-PMVm RNA, capless-PEMV2m RNA, and capless-TCVm RNA. To test protein production, EGFP was cloned into the MCS. The RNAs were made by IVT using a T7 RNA polymerase and plasmid DNA template linearized with a Sail restriction enzyme (Example 9). The exemplary plasmid DNA template contains a T7 promoter; however, other promoters can be used to drive transcription (e.g., T3, SP6, etc.). Although the naturally occurring plant virus RNAs appear to not have any nucleoside modifications, both the native form (unmodified) and the m1Ψ modified form were produced and tested. Other modified nucleosides can also be used.

[0098] The results show that the +ssRNAs without 5'-caps have rather low translation efficiency in human cells (Example 10).

[0099] Next, 5'-capl -added versions of plant virus-based synRNAs were tested on human fibroblasts. These +ssRNA viruses do not have a 5'-cap structure by nature. These synRNAs were BYDVm RNA, BYDV2m RNA, MNESVm RNA, PMVm RNA, PEMV2m RNA, and TCVm RNA. To test protein production, EGFP was cloned into the MCS. The RNAs were made by IVT using a T7 RNA polymerase and plasmid DNA template linearized with a Sail restriction enzyme (Example 11). The exemplary plasmid DNA template contains a T7 promoter; however, other promoters can be used to drive transcription (e.g., T3, SP6, etc.). Although the naturally occurring plant virus RNAs appear to not have any nucleoside modifications, both the native form (unmodified) and the m1Ψ modified form were produced and tested. Other modified nucleosides can also be used.

[0100] Surprisingly, artificial addition of 5'-capl significantly improved translation efficiency under all four culture conditions (33°C or 37°C; B18R+ or B18R-) (Examples 12-15; Figures 11, 12, 13, 14). Protein expression levels were significantly higher than the control - EGFP synRNA without poly(A) (5'-capl, m1Ψ modified), which showed almost no EGFP expression (Figures 11, 12, 13, 14). For some of these plant virus-based synRNAs, protein expression levels were significantly higher than those produced by DENVm, NOV2, and NOV2m. In particular, TCVm and MNESVm are two notable examples (Figure 15).

[0101] TCVm can be used as a poly(A)-free version of a common synRNA, as its characteristics are similar to standard synRNAs except for the lack of a 3'-poly(A) tail: the unmodified version of the nucleoside (m1Ψ) showed significantly higher protein expression compared to the unmodified version (Figures 15, 16); the presence or absence of B18R did not affect protein expression; the expression was high at day 1, decreased over time, but the expression was relatively maintained until day 4; and the expression was observed at both 33°C and 37°C (Figure 15).

[0102] In contrast, MNESVm can represent a novel type of synRNA: in addition to the unique feature of being poly(A)-tail free, it showed significantly higher expression in the unmodified version of the nucleoside than in the modified version (Figures 15, 16). This expression pattern is the same as for DENVm synRNA, but different from what was observed with common synRNAs. The presence or absence of B18R did not affect expression from unmodified MNESVm much. Transient expression was strong at day 1, with expression relatively well maintained until day 4 (Figure 15). These unique features are useful for applications such as vaccines and ribonucleoproteins.

[0103] Accordingly, the present disclosure provides RNA molecules comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'- untranslated region (3'-UTR), wherein the 5'-UTR and 3'-UTR are plant + ssRNA virus 5'-UTR or 3'-UTR. These novel synRNAs lack a poly(A) tail, and thus, provide the advantages of ease of manufacture and CMC. They also provide high protein expression with some additional unique features, which are clearly shown in the case of TCVm and MNESVm. V. In vivo synRNA delivery and efficient protein expression

[0104] To further test whether the poly(A)-free synRNA of the present disclosure is translatable in vivo, we used commercially available lipid nanoparticles (LNPs) to generate synRNA / LNP complexes. Of course, any mRNA delivery system (including but not limited to other LNPs, dendrimers, micelles, and polyethyleneimine-based polymers) is suitable for use with the synRNA of the present disclosure. It is also possible to deliver naked synRNA (without LNPs or other polymers) to cells in vivo. In addition, it is possible to deliver synRNA to cells in vivo by electroporation or by other mechanical methods.

[0105] It has been well documented that synRNA can be delivered systemically by intravenous infusion or direct injection into specific organs, by inhalation, and any other relevant method. As a representative example, synRNA encoding the luciferase gene was injected into skeletal muscle.

[0106] To develop representative poly(A)-free synRNAs, the TCVm and NOV2m platforms were used. The luciferase gene was cloned into the NdeI-NotI sites of the multiple cloning sites of these vectors, and synRNAs were produced by IVT after linearization of the vector with the MluI restriction enzyme. As described in Example 14, TCVm-LUC2(MluI) was translated at high levels in vivo, even without a poly(A) tail (Figure 18A). NOV2m-LUC2(MluI) also functioned, but with lower translation efficiency than TCVm-LUC2 (Figure 18B). These poly(A)-free synRNAs were translatable in both the C57BL / 6 and BALB / c mouse strains, demonstrating that poly(A)-free synRNAs are suitable for protein production in any mouse strain. Furthermore, given the fact that poly(A)-free synRNA is translatable in human fibroblasts in vitro, it is contemplated that poly(A)-free synRNA is translatable in other cell and tissue types in vitro and in vivo, as well as in other mammalian species.

[0107] Thus, the present disclosure provides RNA molecules that are functional in vitro and in vivo in the absence of a poly(A) tail. VI. Addition of Short Adenine Homopolymers

[0108] During the manufacture of synRNAs, some purification methods use oligo(dT) columns to bind to the poly(A) tail of synRNAs (Mencin et al., 2023). If the poly(A) tail is short enough, it can be compatible with synRNAs that have long coding sequences (CDS). Therefore, it is conceivable to add a short homopolymer of adenine (synthetic poly(A) tail) to the 3’ end of the +ssRNA viral sequences described herein. However, it is not clear whether the unique 3’ end of +ssRNA viruses allows the addition of a homopolymer of adenine, as these sequences lack a poly(A) tail in their native form. Therefore, we systematically tested whether the poly(A)-free synRNA platform described herein is compatible with short stretches of adenine nucleotides.

[0109] We generated five sets (A0, A20, A30, A60, and A120) of synRNAs from four different constructs (control-EGFP, NOV2m-EGFP, TCVm-EGFP, and MNESVm-EGFP). A0 is the original poly(A)-free synRNA. A20 represents the addition of 20 adenines at the 3’ end of the poly(A)-free synRNA. Likewise, A30, A60, and A120 represent the addition of 30, 60, and 120 adenines at the 3’ end of the poly(A)-free synRNA, respectively. A poly(A) tail of approximately 120 adenines is the standard poly(A) tail length (Warren et al., 2010). First, following the protocol of Mandal and Rossi (2013), DNA templates were generated by tail-PCR with primers containing 0, 20, 30, 60, and 120 thymine (T) nucleotides. IVT was performed using these DNA templates to generate synRNAs. The control synRNA (A120) is the same synRNA described in previous reports (Warren et al., 2010; Mandal and Rossi, 2013), but there is a nucleoside modification with m1Ψ instead of 5mC / Ψ. The 3’-UTR of the control synRNA is hemoglobin alpha adult chain 1 (Hba-a1). NOV2m-EGFP, TCVm-EGFP, and MNESVm-EGFP are as described in the previous section. Based on the results presented above, NOV2m-EGFP and TCVm-EGFP are m1Ψ-modified, as they performed better compared to the nucleoside-unmodified versions. On the other hand, MNESVm-EGFP was used in the nucleoside-unmodified version (Unm), as it performed better than the nucleoside-modified version (m1Ψ) in the experiments described in the previous section. All synRNAs were transfected into HDFn cells and cultured at 33ºC or 37ºC for 24 hours with or without B18R.

[0110] The control synRNA shows the expected expression pattern. A0 and A20 show no or very low translation (Figures 19, 20, 21, 22). Starting with A30, to A60, and to A120, the translation efficiency increases gradually. The control synRNA works well at both 33°C and 37°C and with and without B18R (Figures 19, 20, 21, 22).

[0111] The NOV2m synRNA shows expression starting with A0 (Figures 19, 20, 21, 22). The translation efficiency is increased by adding the A20 homopolymer and further increased by adding the A30, A60, and A120 homopolymers. The NOV2m synRNA works well at both 33°C and 37°C and with and without B18R (Figures 19, 20, 21, 22).

[0112] The TCVm synRNA shows strong expression starting with A0 (Figures 19, 20, 21, 22). Interestingly, adding the A20 homopolymer decreases the translation efficiency compared to A0, and only by adding the longer adenine homopolymer than A30, the translation efficiency is increased to the level of A0. The temperature (33°C or 37°C) and the presence or absence of B18R have little effect on the translation efficiency of the TCVm synRNA (Figures 19, 20, 21, 22).

[0113] The MNESVm (Unm) synRNA shows strong expression starting with A0 (Figures 19, 20, 21, 22). Like the TCVm synRNA, adding the A20 and A30 homopolymers decreases the translation efficiency compared to A0, and only by adding the longer adenine homopolymer than A60, the translation efficiency is increased to the level of A0. The temperature (33°C or 37°C) and the presence or absence of B18R have little effect on the translation efficiency of the MNESVm synRNA (Figures 19, 20, 21, 22).

[0114] Among the four constructs tested (control-EGFP, NOV2m-EGFP, TCVm-EGFP, and MNESVm-EGFP), the NOV2m synRNA showed the best expression level with any length of the poly(A) homopolymer (i.e., A20, A30, A60, or A120) (Fig. 19, Fig. 20, Fig. 21, Fig. 22). It is noteworthy that the NOV2m synRNA performed much better than the control synRNA, TCVm synRNA, and MNESVm synRNA even with the standard A120 homopolymer. The synRNA is most commonly used under natural in vivo conditions (i.e., at 37ºC body temperature and in the absence of B18R). Under this condition, it is noteworthy that the NOV2m synRNA with A20 and A30 showed equal or even better expression levels than the control synRNA with the standard A120 homopolymer (Fig. 22) considering the short poly(A) homopolymer length required.

[0115] Accordingly, the present disclosure provides an RNA molecule comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) of at least one protein, and a 3'- untranslated region (3'-UTR) and a subsequent short poly(A) homopolymer, wherein the 5'-UTR and the 3'-UTR are derived from a +ssRNA virus. These novel synRNAs with short 3' poly(A) homopolymer are suitable for expressing high levels of protein while facilitating manufacturing and purification by using an oligo(dT) column. VII. Addition of short poly(A) homopolymer to DENVm

[0116] We also generated five sets (A0, A20, A30, A60, and A120) of synRNAs from the DENVm plasmid (Example 19). A0 is the original poly(A)-free synRNA. A20 represents the addition of 20 adenines at the 3' end of the poly(A)-free synRNA. Likewise, A30, A60, and A120 represent the addition of 30, 60, and 120 adenines at the 3' end of the poly(A)-free synRNA, respectively. First, following the protocol of Mandal and Rossi (2013), DNA templates were generated by tail-PCR with primers containing 0, 20, 30, 60, and 120 thymidine (T) nucleotides. IVT was performed using these DNA templates to produce the synRNAs. DENVm-EGFP was used in the unmodified nucleoside form (Unm) as it performed better than the modified nucleoside form (m1y) in the experiments described in the previous section. All synRNAs were transfected into HDFn cells and cultured at 33ºC or 37ºC for 24 hours with or without B18R.

[0117] DENVm synRNAs (Umn) showed expression in vitro starting from A0. The efficiency of translation was increased by the addition of A20 poly(A) and further increased by the addition of A30, A60 and A120. The presence of temperature (33°C or 37°C) or B18R did not have a very big impact on the efficiency of translation of DENVm synRNAs (Unm) (Figure 26).

[0118] Accordingly, the present disclosure provides RNA molecules comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) of at least one protein, and a 3'- untranslated region (3'-UTR) and subsequently a short adenine homopolymer, wherein the 5'-UTR and the 3'-UTR are derived from a Dengue virus. Although Dengue viruses do not have a poly-A at the 3' end in their native state, the current findings show that these novel synRNAs containing a short adenine homopolymer can be used to express high levels of a protein of interest, while providing the advantage of manufacturing and purification by using an oligo(dT) column, if necessary. VIII. Chromosome of the Coronaviridae family

[0119] The genome size of the +ssRNA viruses in the Coronaviridae family is 27-32 kb and is the largest among all RNA viral genomes. It has a cap structure at its 5' end and a poly-A at its 3' end. In this sense, unlike the +ssRNA viral genomes used above, the +ssRNA genome of the Coronaviridae family is analogous to a mammalian mRNA. However, the poly-A length of the Coronaviridae RNA is relatively short, starting from about 45 nucleotides immediately after viral entry up to about 64 nucleotides (Wu et al., 2023).

[0120] To test whether 5'-UTR, 3'-UTR and short poly-A from Coronaviridae can be used for expression of heterologous proteins, we constructed a plasmid vector carrying a T7 promoter followed by DNA encoding SARS Vm RNA (5'-UTR, MCS, 3'-UTR and 50 adenosines) as depicted in FIG. 27A. The 5'-UTR and 3'-UTR were taken from SARS-CoV-2 (GenBank: NC_045512.2) (Example 20). The nucleotide sequence of the 5'-UTR of SARS Vm is set forth in SEQ ID NO: 37, and the nucleotide sequence of the 3'-UTR and the homopolymer of 50 adenosines is set forth in SEQ ID NO: 38. After cloning of EGFP into the MCS, the synRNA was in vitro transcribed with Cap 1 (TriLink) with or without ml Ψ modification. GFP expression from SARS Vm was tested by transfecting SARSm(A50)-EGFP into HDFn cells and culturing the cells at 33ºC or 37ºC for 24 hours with or without 250 ng / mL of B18R (Sigma). As shown in FIG. 27B, SARS Vm can efficiently express EGFP when the mRNA is modified with ml Ψ. Interestingly, the expression is very weak when the mRNA is in unmodified form, which is its native form. This indicates that 5'-UTR and 3'-UTR of Coronaviridae can be used as a synRNA platform, and the nucleoside-modified (i.e., artificial) form is superior.

[0121] We have also tested the addition of a longer homopolymer of adenosines to the native poly-A tail of SARS-CoV-2 mRNA. To this end, we have constructed a plasmid vector carrying a T7 promoter, DNA encoding SARS VmlOO (5'-UTR, MCS, 3'-UTR and 100 adenosines), wherein the 5'-UTR and 3'-UTR were taken from SARS-CoV-2 (GenBank: NC_045512.2). This mRNA is referred to as SARS VmlOO. After cloning of EGFP into the MCS, the synRNA was in vitro transcribed with Cap 1 (TriLink) with or without ml Ψ modification. Compared to SARS Vm, a further enhancement of EGFP expression was only observed for the ml Ψ modified form of SARS VmlOO.

[0122] Accordingly, the present disclosure provides an RNA molecule comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) of at least one protein, and a 3'- untranslated region (3'-UTR) followed by a homopolymer of adenosines, wherein the 5'-UTR and the 3'-UTR are derived from a +ssRNA virus that naturally has a homopolymer of adenosines at the 3' end. IX. Chromosomes of the Togaviridae

[0123] The +ssRNA genome of the Togaviridae is 9.7-11.8 kb and contains a 5’ cap and a 3’ polyA. The Togaviridae include alphaviruses that are widely used as self-replicating RNAs (self-amplifying RNAs, replicons) and include Venezuelan equine encephalitis virus, Semliki Forest virus, Sindbis virus, and Chikungunya virus. The natural polyA of these viruses is short, typically in the range of about 25 to about 35 nucleotides.

[0124] To test whether the 5’-UTR, 3’-UTR, and short polyA from the Togaviridae can be used to express heterologous proteins, we have constructed a plasmid vector carrying a T7 promoter followed by DNA encoding VEEVm RNA (5’-UTR, MCS, 3’-UTR, and 30 adenines). The 5’-UTR and 3’-UTR are taken from Venezuelan equine encephalitis virus (Genbank: L014442.2). This mRNA is now called VEEVm. After cloning EGFP into the MCS, the synRNA is in vitro transcribed with Cap 1 (CleanCap AU, TriLink) with or without m1Ψ modification. When the mRNA is modified with m1Ψ, VEEVm can efficiently express EGFP.

[0125] We have also tested the addition of longer homopolymers of adenines to the natural polyA tail of VEEV. For this, we have constructed a plasmid vector carrying a T7 promoter followed by DNA encoding VEEVm100 RNA (5’-UTR, MCS, 3’-UTR, and 100 adenines), where the 5’-UTR and 3’-UTR are taken from Venezuelan equine encephalitis virus (Genbank: L014442.2). This mRNA is called VEEVm100. After cloning EGFP into the MCS, the synRNA is in vitro transcribed with Cap 1 (TriLink) with or without m1Ψ modification. Compared to VEEVm, a further enhancement of EGFP expression is only observed in the m1Ψ modified version of VEEVm100. X. In vivo expression of luciferase from NOV2m (A50) and DENVm (A50) in muscle

[0126] We have tested the in vivo expression of synRNAs based on +ssRNA viruses, with a focus on mRNAs with additional homopolymers of adenines. We have selected NOV2m (A50), NOV2m (A30), DENVm (A50), and DENVm (A30) for testing in skeletal muscle (Example 21).

[0127] For intramuscular injection, synRNAs-LUC (luciferase) were complexed with Lipid Nanoparticle (LNP) Invivofectamine 3.0 (ThermoFisher) according to the manufacturer’s protocol. The synRNA-LUC / LNP complexes were injected directly into the muscle of BALB / c mice. Luciferase expression was monitored using a bioluminescence imaging system.

[0128] We have demonstrated that luciferase is efficiently expressed in muscle from all four of NOV2m(A50), NOV2m(A30), DENVm(A50), and DENVm(A30) mRNAs (Figure 28). The RNA of the homopolymer of 50 adenines resulted in slightly higher levels of luciferase expression than the RNA of the homopolymer of 30 adenines. Nucleoside modifications helped to increase the translation efficiency of NOV2m but not DENVm in muscle. XI. In vivo expression of luciferase from NOV2m(A50) and DENVm(A50) in skin

[0129] We have also tested the in vivo expression of NOV2m(A50), NOV2m(A30), DENVm(A50), and DENVm(A30) in skin (Example 21).

[0130] For intradermal injection, we have previously demonstrated that naked (i.e., neither transfection reagent nor LNP) c-srRNAs (controllable self-replicating RNAs) dissolved in lactated Ringer’s solution can efficiently produce proteins (see, U.S. Patent No. 11,421,248 to Ko). We have also demonstrated that the addition of chitosan oligosaccharides increases protein expression (see, WO 2022 / 266511 and WO 2023 / 034881 to Elixirgen Therapeutics, Inc.). We have now evaluated the expression of luciferase from NOV2m and DENVm in skin after intradermal administration of naked mRNAs in the presence and absence of chitosan.

[0131] About 20.0 µg of each synRNA was dissolved in 60 µL lactated Ringer’s solution with or without chitosan oligosaccharides (molecular weight ≤ 5 kDa, ≥ 75% deacetylation: Heppe Medical Chitosan GmbH: Product Number 44009). The final concentration of chitosan oligosaccharides was 1.5 µg / ml. Luciferase expression was monitored using a bioluminescence imaging system.

[0132] We have demonstrated that luciferase is effectively expressed in skin from all four of NOV2m(A50), NOV2m(A30), DENVm(A50), and DENVm(A30) (Figure 29). For both NOV2m and DENVm, the synRNAs with the longer 50-adenine homopolymer were more effective than the synRNAs with these shorter 30-adenine homopolymers. Nucleoside modifications helped to increase the translation efficiency of NOV2m but not DENVm in skin. For DENVm, the unmodified synRNA (Unm) was more effective than the synRNA with modifications (ml ). We have demonstrated that, overall, DENVm(A50), whether modified or unmodified, performed well and was slightly better than NOV2m(A50). Interestingly, synRNAs administered in compositions comprising chitosan oligosaccharide significantly enhanced luciferase expression under all test conditions: NOV2m(ml ), NOV2m(Unm), DENVm(ml ), and DENVm(Unm). We have demonstrated that, overall, DENVm(A50), whether modified or unmodified, performed well and was slightly better than NOV2m(A50), even with nucleoside modifications. XII. Expression of large proteins using synRNA technology

[0133] The technology disclosed herein has made it possible to generate synRNAs encoding large proteins. Typically, synRNAs cannot accommodate the coding sequence of large proteins. For example, a synRNA encoding cystic fibrosis transmembrane conductance regulator (CFTR), which is 1,480 amino acids in length, is the largest protein currently being tested in clinical trials (Vavilis et al. 2023). Since CFTR and many other large proteins are candidates for protein replacement therapy, it is desirable to use the synRNA platform for their production.

[0134] Duchenne muscular dystrophy results from a shortage of dystrophin (DMD) protein due to mutations. The DMD protein, which is 3,685 amino acids in length, is another target for protein replacement therapy. However, due to its large protein size, current clinical trials employing adeno-associated virus (AAV) vectors use a shortened form of DMD (microdystrophin). Now, due to the development of the present disclosure, it is possible to generate a synRNA encoding the full-length human DMD protein to successfully express DMD protein in vitro (Example 16; Figure 23A; Figure 23B) and in vivo (Example 17: Figure 24A, Figure 24B, Figure 24C). Although the examples herein use the DMD sequence from public databases (e.g., NCBI), codon-optimized or truncated DMD sequences can also be used.

[0135] In Example 17, we also used a NOV2m synRNA with a 28-residue 3'-adenine homopolymer (NOV2m-A28). However, only in Example 17, the synRNA encoded a fusion protein of luciferase (LUC) and full-length human dystrophin protein (transcript variant Dp427m, NCBI Accession NM_004006). When the 13.0 kb length NOV2m-LUC-DMD-A28 synRNA was injected into skeletal muscle, it produced the fusion protein, which was detected by an in vivo luciferase assay (Fig. 24B, Fig. 24C). This demonstrated that a very large protein was successfully expressed from a +ssRNA virus-based synRNA in vivo.

[0136] We have also demonstrated the production of human dystrophin protein in mouse skeletal muscle by immunohistochemistry. In Example 22, we used a NOV2m synRNA with a 28-residue 3'-adenine homopolymer (NOV2m-A28), but in this case it encoded only full-length human dystrophin protein (not a LUC-DMD fusion protein). When the 11.3 kb length NOV2m-DMD-A28 synRNA was injected into skeletal muscle, it produced dystrophin protein, which was detected by immunohistochemistry. Sections of muscle at the injection site were stained with an anti-human DMD antibody (MANDYS 106), which does not recognize mouse dystrophin but does recognize human dystrophin. Untreated muscle showed no staining, but muscle injected with the NOV2m-DMD-A28 synRNA showed production and correct localization of human dystrophin protein (Fig. 31, upper panel). Furthermore, muscle sections stained with an anti-mouse DMD antibody (AB15277), which recognizes both mouse and human dystrophin, showed correct localization of both mouse and human dystrophin (Fig. 31, lower panel). Higher magnification images of immunostaining results from the same experiment also showed correct localization of full-length human dystrophin protein in mouse skeletal muscle.

[0137] Importantly, we have now successfully demonstrated functional restoration of skeletal muscle of a mutant mouse lacking mouse dystrophin as a result of intramuscular injection of NOV2m-DMD-A28 synRNA (Example 23). The nucleotide sequence of the NOV2m-DMD-A28 synRNA is shown as SEQ ID NO: 42. D2.mdx mice, also known as D2.B10-Dmd mdxThe D2.mdx mouse, a well-known animal model of Duchenne Muscular Dystrophy, recapitulates human features of DMD muscle pathology (Coley et al. 2016, Hammers et al. 2020). DBA / 2 mice (wild-type) are commonly used as controls. In Example 23, D2.mdx mutants and wild-type DBA / 2 mice received 3 intramuscular injections in the ventral forelimb and 2 intramuscular injections in the dorsal forelimb of synRNAs. One week after 6 weekly injections, peak muscle force of the forelimb was measured by a grip meter. The NOV2m-DMD-A28 synRNA injected group showed statistically significant (* p < 0.05) muscle force recovery compared to the non-injected group (D2.mdx) and the control mRNA-LUC injected group (D2.mdx-LUC) (Figure 32A). There was no statistically significant difference between the D2.mdx-DMD group and the wild-type DBA / 2 group. There were no safety findings related to the administration of NOV2m-DMD-A28 synRNA for the NOV2m-DMD-A28 synRNA injected group. This result indicates that another large protein was successfully expressed from a +ssRNA virus-based synRNA in vivo.

[0138] In addition, we have demonstrated that a single intramuscular injection of NOV2m-DMD-A28 synRNA resulted in muscle force recovery in D2.mdx mutant mice (Figure 32B). This result indicates that a single NOV2m-DMD-A28 synRNA injection not only restored muscle force in D2.mdx mutant mice, but also that the heterologous DMD protein was stable in cells at the injection site and remained for at least 3 weeks.

[0139] A shortage of collagen type VII alpha-1 (VII) chain (COL7A1) protein due to mutation can cause epidermolysis bullosa. Collagen type VII is a homotrimer of COL7A1 proteins, each of which is 2,944 amino acids in length. The technology of the present disclosure has made it possible to produce a synRNA encoding a full-length human COL7A1 protein to successfully express COL7A1 protein in vitro (Figure 25B) and in vivo. Although the examples herein use a COL7A1 sequence from a public database (e.g., NCBI), a codon-optimized or truncated COL7A1 sequence can also be used.

[0140] A shortage of von Willebrand Factor (VWF) due to mutation can cause a coagulopathy called von Willebrand disease. VWF is 2,813 amino acids in length. The technology of the present disclosure has made it possible to produce a synRNA encoding a full-length human VWF protein. Although the examples herein use a VWF sequence from a public database (e.g., NCBI), a codon-optimized or truncated VWF sequence can also be used.

[0141] There are many diseases caused by the shortage or loss of function of proteins that are potential targets for protein replacement therapy with synRNAs. On the other hand, the overproduction or abnormal production of proteins leads to other types of diseases. synRNAs encoding dominant negative forms of these proteins are potential therapeutics for these diseases. One of the obstacles to applying synRNAs to such therapies is the size of the protein, as pathogenic genes are often large proteins.

[0142] For example, according to the UniProt database, more than 200 human proteins involved in human diseases are longer than 2,000 amino acids (>6,000 nucleotide coding region) in length. These genes include, but are not limited to, ABCA1, ABCA12, ABCA2, ABCA4, ABCA7, ACACA, ACAN, ADGRV1, AGRN, AKAP9, ALMS1, ANK2, ANK3, ANKRD11, ANKRD17, APC, APC2, APOB, ARID1A, ARID1B, ASH1L, ASPM, ASXL3, ATM, ATR, ATRX, BDP1, BLTP1, BPTF, BRCA2, C2CD3, CACNA1A, CACNA1B, CACNA1C, CACNA1D, CACNA1E, CACNA1G, CACNA1H, CACNA1I, CAD, CCDC88C, CDH23, CELSR1, CENPE, CENPF, CEP250, CEP290, CFAP47, CHD3, CHD6, CHD7, CHD8, CIT, CNOT1, CNTRL, COL12A1, COL6A3, COL6A5, COL7A1, CPLANE1, CREBBP, CUBN, DCHS1, DMBT1, DMD, DMXL2, DNAH1, DNAH10, DNAH11, DNAH17, DNAH2, DNAH5, DNAH8, DNAH9, DNAJC13, DNHD1, DOCK3, DOCK6, DOCK7, DOCK8, DSP, DST, DYNC1H1, DYNC2H1, DYSF, EP300, EPG5, EYS, F5, F8, FANCM, FAT2, FAT4, FBN1, FBN2, FLG, FLG2, FLNA, FLNB, FLNC, FN1, FRAS1, FREM1, FREM2, FRYL, FSIP2, GPR179, HCFC1, HERC1, HERC2, HIVEP2, HMCN1, HSPG2, HTT, HYDIN, IGSF10, INTS1, ITPR1, ITPR2, ITPR3, KAT6A, KAT6B, KMT2A, KMT2B, KMT2C, KMT2D, KNL1, LAMA1, LAMA2, LAMA3, LAMA5, LOXHD1, LRBA, LRP1, LRP2, LRRK1, LRRK2, LYST, MACF1, MAP1B, MED12, MED12L, MED13, MED13L, MEGF8, MPDZ, MTOR, MUC5B, MXRA5, MYO15A, MYO18B, MYO7A, MYO9A, MYO9B, MYOF,NAV3, NBAS, NBEA, NBEAL2, NEB, NF1, NIN, NIPBL, NOTCH1, NOTCH2, NOTCH3, NSD1, NUP205, NUP214, OBSCN, OTOG, OTOGL, PCLO, PCM1, PCNT, PDE4DIP, PI4KA, PIEZO1, PIEZO2, PIKFYVE, PKD1, PKD1L1, PKHD1, PLCE1, PLEC, POLE, POLQ, PRKDC, PRPF8, PRR12, PTPRQ, RALGAPA1, RANBP2, RELN, RNF213, ROS1, RP1, RP1L1, RTTN, RYR1, RYR2, SACS, SCN1A, SCN2A, SCN3A, SCN5A, SETD2, SETX, SMCHD1, SNRNP200, SON, SORL1, SPAG17, SPEG, SPEN, SPG11, SPTA1, SPTAN1, SPTB, SPTBN1, SPTBN2, SPTBN4, SRCAP, SVIL, SYNE1, SYNE2, SZT2, TECTA, TENM3, TENM4, TET1, TET2, TEX15, TG, TNC, TNXB, TPR, TRIO, TRIOBP, TRPM6, TRRAP, TTN, UNC80, USH2A, USP9X, USP9Y, VCAN, VPS13A, VPS13B, VPS13C, VPS13D, VWF, WDFY3, WNK1, ZFHX2, ZFHX4, ZFYVE26, ZNF292, ZNF407, ZNF462, ZNF469.

[0143] Further, according to the UniProt database, more than 300 human proteins are involved in human diseases with a length between 1,333 amino acids and 1,999 amino acids (3,999 to 5,997 nucleotide coding region). These genes include, but are not limited to, A2ML1, ABCA3, ABCC1, ABCC2, ABCC6, ABCC8, ABCC9, ADAMTS13, ADCY10, ADGRL1, AFDN, AGL, AHDC1, ALK, ALPK3, ALS2, ANAPC1, ANK1, ANKRD26, ARFGEF1, ARFGEF2, ARHGAP31, ARHGEF10, ARHGEF12, ARHGEF18, ARID2, ASXL1, ASXL2, ATP7A, ATP7B, BAZ1B, BCL9, BCOR, BCORL1, BICRA, BLM, BRCA1, BRD4, BRWD3, C2CD6, C3, C4A, C4B, C4ORF54, C5, CACNA1F, CACNA1S, CAMSAP2, CAMTA1, CARMIL2, CC2D2A, CCDC88A, CDC42BPB, CDK12, CDK13, CDK5RAP2, CENPJ, CEP152, CEP164, CFAP43, CFAP44, CFAP65, CFAP74, CFTR, CHD1, CHD2, CHD4, CHD5, CIC, CLTC, CNTNAP1, CNTNAP2, COL11A1, COL11A2, COL17A1, COL18A1, COL1A1, COL1A2, COL27A1, COL2A1, COL3A1, COL4A1, COL4A2, COL4A3, COL4A4, COL4A5, COL4A6, COL5A1, COL5A2, CPAMD8, CPS1, CPSF1, CRB1, CUL7, CUX1, CUX2, DCC, DEPDC5, DICER1, DLEC1, DNMBP, DNMT1, DOCK2, DUOX2, EIF2AK4, EIF4G1, ELP1, EPRS1, ERBB3, ERCC6, ERCC6L2, EXPH5, FANCA, FANCD2, FHOD3, FLT1, FLT4, FMN2, FOCAD, FYCO1, GEMIN5, GLI2, GLI3, GREB1L, GRIN2A, GRIN2B, GRIN2D, HECW2, HFM1, IFT140, IFT172, IGF1R, IGSF1, INSR, IQSEC2, ITGB4, KANK1, KATNIP, KDM3B, KDM5A, KDM5B, KDM5C, KDM6A,KDM6B, KDR, KIAA0586, KIAA1549, KIDINS220, KIF14, KIF15, KIF1A, KIF1B, KIF21A, KIF26A, KIF7, KMT2E, LAMA4, LAMB1, LAMB2, LAMC3, LCT, LRP4, LRP5, LRP6, LRPPRC, LTBP1, LTBP2, LTBP4, MADD, MAGI2, MAP3K1, MAPK8IP3, MAPKBP1, MAST1, MBD5, MCM3AP, MED23, MET, MIA2, MIA3, MLH3, MSH6, MST1R, MYH10, MYH11, MYH14, MYH2, MYH3, MYH6, MYH7, MYH8, MYLK, MYO3A, MYO5A, MYO5B, NALCN, NCAPD2, NCAPD3, NCOA1, NCOA2, NEXMIF, NFASC, NHS, NLRP1, NPHP3, NPHP4, NRXN1, NSD2, NSD3, NUP155, NUP160, NUP188, NUP98, OBSL1, OTOF, PALLD, PAPPA2, PARD3, PBRM1, PCDH11Y, PCDH15, PHIP, PIK3C2A, PLCH1, PLEKHG2, PLXNA1, PNPLA6, POGZ, POLA1, POLR1A, POLR2A, POLR3A, PRG4, PRX, PTCH1, PTPN23, PTPRF, PXDN, QRICH2, RAB3GAP2, RAI1, RAPGEF2, RERE, RIC1, RIMS1, RIMS2, ROBO2, ROBO3, RUSC2, SAMD9, SAMD9L, SBF1, SBF2, SCAPER, SCN10A, SCN11A, SCN4A, SCN8A, SCN9A, SCRIB, SETBP1, SETD1A, SETD1B, SETD5, SHANK2, SHANK3, SHOC1, SHROOM4, SI, SIPA1L3, SKIC3, SLX4, SMARCA2, SMARCA4, SOS1, SOS2, SPEF2, STRC, SYCP2, SYNGAP1, SYNJ1, TAF1, TANC2, TCF20, TCHH, TCOF1, TDRD9, TECPR2, TET3, TEX14, THADA, THOC2, THSD7A, TIAM1, TMEM94, TNIK, TNR, TNRC6A, TNRC6B, TOGARAM1, TONSL, TOP2B, TP53BP1, TRIP11,TRIP12, TRPM1, TRPM3, TRPM7, TSC2, TUBGCP6, UBR1, USP6, WDR19, WDR62, WDR81, WRN, XDH, YEATS2, ZMYM2, ZMYM3, ZNF142, ZNF335, ZNFX1. XIII. Expression of large fusion proteins or multiple protein subunits using synRNA technology

[0144] The technology disclosed herein has made it possible to generate synRNAs encoding large fusion proteins (FIG. 24, FIG. 25). Proteins often function as complexes formed of multiple protein subunits within a cell. Therefore, each protein subunit of a protein complex must be expressed within the same cell. If the subunit proteins are encoded by separate synRNAs, they can not be delivered to the same cell. Thus, it can be desirable to encode each protein subunit in the same synRNA. This can be accomplished by making a single fusion protein, in which each protein coding region is fused via a 2A self-cleaving peptide. Alternatively, the coding sequences of the protein subunits can be linked via an internal ribosome entry site (IRES). Regardless of the linking element utilized, the synRNA encoding the fusion protein or multiple protein subunits will be large. The technology of the present disclosure is suitable for use with overly long coding regions (e.g., large payload space) to allow production of fusion proteins and multi-protein complexes within a host cell.

[0145] One example of a large multi-protein complex is type I collagen, which accounts for 70% of total collagen found in the human body. A deficiency of type I collagen due to mutation can lead to a disease called osteogenesis imperfecta. Type I collagen is a heterotrimer of two COL1A1 proteins (length 1,464 amino acids) and one COL1A2 protein (length 1,366 amino acids). To achieve a stoichiometry of 2: 1, two COL1A1 coding sequences and one COL1A2 coding sequence are fused via a nucleic acid encoding a 2A self-cleaving peptide to give a synRNA greater than 13 kb in length, which encodes a fusion protein of length 4,338 amino acids (FIG. 30A). While this construct is a significant challenge to conventional RNA technology, the synRNA of the present disclosure (without a poly(A) tail or with a short 3’ adenine homopolymer) facilitates expression of this large fusion protein from a single synRNA molecule.

[0146] Some fusion proteins can be composed of multiple copies of the same protein. This increases the number of proteins to be produced from a single synRNA. Alternatively, multiple copies of the coding region of the same protein in a single synRNA can be linked via an IRES. One such example is erythropoietin (EPO), which is 193 amino acids in length. The technology of the present disclosure (e.g., synRNAs without a poly(A) tail or synRNAs with a short 3’ adenine homopolymer) facilitates the expression of multiple EPO proteins in a single synRNA, resulting in more EPO proteins produced from a single synRNA in vivo (FIG. 30B). XIV. Expressing ribonucleoproteins using synRNA technology

[0147] Ribonucleoproteins function by forming complexes with proteins as well as their partner RNAs. One example of a ribonucleoprotein is telomerase, which is composed of telomerase reverse transcriptase (TERT) as the protein component and telomerase RNA (TERC) as the RNA component. Other examples are the CRISPR / Cas9 genome editing tool, which is composed of Cas9 as the protein component and a single guide RNA (sgRNA) as the RNA component. Other genome editing tools, such as Casl2a, Casl3, and “prime editing” are also based on ribonucleoproteins. Ribonucleoproteins also include, but are not limited to, ribosomes, vault ribonucleoproteins, RNase P, hnRNPs, and small nuclear RNP (snRNP).

[0148] Therapeutic applications of ribonucleoproteins require the delivery of both the protein and the RNA in the same cell. Since proteins can be expressed in a cell by introducing a synRNA, it can be desirable to encode both the protein and the RNA in the same synRNA. The RNA component can be cleaved away by flanking it with a self-cleaving ribozyme RNA sequence or a ribozyme target sequence (such as RNase III, RNase P, RNase Z, or a Cas protein such as Casl2a). However, cleavage of the synRNA would separate the 5’-cap and / or 3’-poly(A) from the coding sequence of the synRNA, resulting in loss of protein production.

[0149] This problem is solved by the technology of the present disclosure (synRNAs without a poly(A) tail or synRNAs with a short 3' adenine homopolymer). A typical design of such synRNAs consists of: 5'-cap, 5'-UTR, CDS (coding for the protein part), 3'-UTR, one or more ribozymes, RNA part, one or more ribozymes, no or short adenine homopolymer. For example, a single synRNA encoding both TERT (protein part) and TERC (RNA part) (Figure 30C). Upon delivery of the synRNA to the cell, the ribozymes cleave the synRNA, resulting in two RNA molecules: the protein production part (5'-cap, 5'-UTR, CDS, 3'-UTR) and the RNA part. While the protein production part does not have a poly(A) tail, it is still suitable for protein production, it binds to the RNA part to form a protein / RNA complex (ribonucleoprotein). The RNA part includes, but is not limited to, TERC, sgRNA, crRNA, microRNA, and shRNA. The technology of the present disclosure provides synRNAs with large payload space, which can accommodate the coding sequence of large proteins and large RNAs (or repeats of RNAs). XV. Enumerated embodiments 1. An RNA molecule comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein the 3'-UTR is a Nodamura virus RNA2 (NOV2) 3'-UTR or a fragment thereof, or a Nodamura virus RNA1 (NOV1) 3'-UTR or a fragment thereof, wherein the fragment is at least 40 nucleotides in length, and the CDS is heterologous to NOV2 or NOV1 and replaces the open reading frame for the Nodamura virus coat protein or the open reading frame for the Nodamura virus RNA-dependent RNA polymerase (RdRp) of NOV2. 2. The RNA molecule of embodiment 1, wherein the 3'-UTR is a NOV2 3'-UTR. 3. The RNA molecule of embodiment 2, wherein the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 10, or a nucleotide sequence with at least 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 10. 4. The RNA molecule of embodiment 1, wherein the 3'-UTR is a NOV1 3'-UTR. 5. The RNA molecule according to embodiment 4, wherein the 3’-UTR comprises the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence which is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 7. 6. The RNA molecule according to embodiment 1, which comprises: (i) the nucleotide sequence of SEQ ID NO: 6 as the 5’-UTR and the nucleotide sequence of SEQ ID NO: 7 as the 3’-UTR; or (i) the nucleotide sequence of SEQ ID NO: 9 as the 5’-UTR and the nucleotide sequence of SEQ ID NO: 10 as the 3’-UTR. 7. An RNA molecule comprising a 5’-untranslated region (5’-UTR), at least one coding sequence (CDS) of at least one protein, and a 3’-untranslated region (3’-UTR), wherein the 3’-UTR comprises a viral 3’-UTR or a fragment thereof, wherein the fragment is at least 40 nucleotides in length, the CDS is heterologous to the virus and replaces at least part of an open reading frame of the virus, and the virus is a positive-sense single-stranded RNA (+ssRNA) virus, the genome of which lacks a poly(A) tail. 8. The RNA molecule according to embodiment 7, wherein the virus is a member of a viral family selected from the family Nodaviridae, the family Flaviviridae and the family Tetraviridae. 9. The RNA molecule according to embodiment 8, wherein the virus is a member of the family Nodaviridae. 10. The RNA molecule according to embodiment 9, wherein the virus is a Nodamura virus or a Flavovirus. 11. The RNA molecule according to embodiment 8, wherein the virus is a member of the family Flaviviridae. 12. The RNA molecule according to embodiment 11, wherein the virus is a Dengue virus. 13. The RNA molecule according to embodiment 7, wherein the virus is a plant virus. 14. The RNA molecule according to embodiment 13, wherein the plant virus is Barley yellow dwarf virus (BYDV), Maize necrotic streak virus (MNESV), Pea mosaic virus (PMV), Pea enation mosaic virus-2 (PEMV2) or Turnip crinkle virus (TCV). 15. The RNA molecule of any one of embodiments 1-14, comprising at least one modified nucleoside. 16. The RNA molecule of embodiment 15, wherein the at least one modified nucleoside comprises “5mC + Ψ”, “ml Ψ”, “5moU”, or “Ψ”, optionally wherein the at least one modified nucleoside comprises “ml Ψ”, optionally wherein the at least one modified nucleoside comprises “5mC + Ψ”. 17. The RNA molecule of any one of embodiments 1-16, wherein the at least one CDS comprises two or more CDSs of two or more different proteins. 18. The RNA molecule of embodiment 17, wherein the two or more CDSs are operably linked to form a fusion protein comprising the two or more different proteins. 19. The RNA molecule of embodiment 17, wherein the two or more CDSs are separated from each other by an internal ribosome entry site (IRES). 20. The RNA molecule of embodiment 17, wherein the two or more CDSs are separated from each other by nucleotides encoding a flexible linker or a 2A self-cleaving peptide. 21. The RNA molecule of any one of embodiments 1-20, wherein the RNA molecule comprises a heterologous adenine homopolymer of no more than about 60 nucleotides in length at its 3’ end, optionally wherein the heterologous adenine homopolymer is 20 to 60 nucleotides in length. 22. The RNA molecule of any one of embodiments 1-20, wherein the at least one protein is a full-length human dystrophin protein or a full-length human collagen type VII alpha-1 (COL7A1) protein. 23. A DNA template for the RNA molecule of any one of embodiments 1-22, optionally wherein one or more first restriction enzyme sites are present between the 5’-UTR and the at least one coding region, and one or more second restriction enzyme sites are present between the at least one coding region and the 3’-UTR. 24. A plasmid comprising the DNA template of embodiment 23, wherein the plasmid comprises a promoter upstream of the 5’ UTR. 25. A host cell comprising the plasmid of embodiment 24. 26. A recombinant virus comprising the RNA molecule of any one of embodiments 1-22. 27. A method for expressing a protein, the method comprising contacting a mammalian cell with an RNA molecule according to any one of embodiments 1-22. 28. The method according to embodiment 27, wherein the contacting is performed in vitro. 29. The method according to embodiment 27, wherein the contacting is performed in vivo. 30. The method according to any one of embodiments 27-29, wherein the contacting is performed in the presence of a B18R protein. 31. An RNA molecule comprising, from 5’ to 3’, a 5’-untranslated region (5’-UTR), at least one coding sequence (CDS) of a protein, a 3’-untranslated region (3’-UTR), and a homopolymer of adenines, wherein the 3’-UTR comprises a viral 3’-UTR or a fragment thereof, wherein the fragment is at least 40 nucleotides in length, the CDS and the homopolymer of adenines are heterologous to the virus, and the virus is a positive-sense single-stranded RNA (+ssRNA) virus, the genome of which lacks a poly(A) tail. 32. The RNA molecule according to embodiment 31, wherein the homopolymer of adenines is no more than about 60 nucleotides in length. 33. The RNA molecule according to embodiment 32, wherein the homopolymer of adenines is 20 to 60 nucleotides in length. 34. The RNA molecule according to embodiment 31, wherein the virus is a member of a viral family selected from the family Nodaviridae, the family Flaviviridae, and the family Tetraviridae. 35. The RNA molecule according to embodiment 31, wherein the virus is a member of the family Nodaviridae. 36. The RNA molecule according to embodiment 35, wherein the virus is a Nodamura virus or a Flavovirus. 37. The RNA molecule according to embodiment 31, wherein the virus is a member of the family Flaviviridae. 38. The RNA molecule according to embodiment 37, wherein the virus is a Dengue virus. 39. The RNA molecule according to embodiment 31, wherein the virus is a plant virus. 40. The RNA molecule according to embodiment 39, wherein the plant virus is a Barley yellow dwarf virus (BYDV), a Maize necrotic streak virus (MNESV), a Panicum mosaic virus (PMV), a Pea enation mosaic virus-2 (PEMV2), or a Turnip crinkle virus (TCV). 41. The RNA molecule of any one of embodiments 31-40, comprising at least one modified nucleoside. 42. The RNA molecule of embodiment 41, wherein the at least one modified nucleoside comprises “5mC + Ψ”, “ml Ψ”, “5moU”, or “Ψ”, optionally wherein the at least one modified nucleoside comprises “ml Ψ”, optionally wherein the at least one modified nucleoside comprises “5mC + Ψ”. 43. The RNA molecule of any one of embodiments 31-42, wherein the at least one protein is a full-length human dystrophin protein or a full-length human collagen type VII alpha-1 (COL7A1) protein. 44. The RNA molecule of embodiment 31, wherein the adenine homopolymer is between about 60 nucleotides and about 120 nucleotides in length. 45. An RNA molecule comprising, from 5’ to 3’: a 5’-untranslated region (5’-UTR), at least one coding sequence (CDS) for at least one protein, and a 3’-untranslated region (3’-UTR), wherein the 3’-UTR comprises a viral 3’-UTR or a fragment thereof, wherein the fragment is at least 40 nucleotides in length, the CDS is heterologous to the virus and at least replaces an open reading frame of an RNA-dependent RNA polymerase of the virus, and the virus is a positive-sense single-stranded RNA (+ssRNA) virus. 46. The RNA molecule of embodiment 45, wherein the RNA molecule further comprises an adenine homopolymer downstream of the 3’-UTR between 15 and 200 nucleotides in length. 47. The RNA molecule of embodiment 46, wherein the virus is a member of the Coronaviridae family. 48. The RNA molecule of embodiment 47, wherein the virus is severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2). 49. An RNA molecule comprising, from 5’ to 3’: a 5’-untranslated region (5’-UTR), at least one coding sequence (CDS) for at least one protein, and a 3’-untranslated region (3’-UTR), wherein the 3’-UTR comprises a viral 3’-UTR or a fragment thereof, wherein the fragment is at least 40 nucleotides in length, the CDS encodes a full-length human dystrophin protein or a full-length human collagen type VII alpha-1 (COL7A1) protein, and replaces at least a portion of an open reading frame of the virus, and the virus is a positive-sense single-stranded RNA (+ssRNA) virus. 50. The RNA molecule of embodiment 49, wherein the genome of the virus lacks a poly(A) tail. 51. The RNA molecule of embodiment 50, further comprising a heterologous adenine homopolymer at its 3’ end, optionally wherein the adenine homopolymer is 20 to 60 nucleotides in length. 52. The RNA molecule of embodiment 49, wherein the genome of the virus comprises a poly(A) tail, and the RNA molecule further comprises the poly(A) tail. 53. The RNA molecule of embodiment 52, further comprising a heterologous adenine homopolymer at the 3’ end of the poly(A) tail, optionally wherein the sum of the lengths of the poly(A) tail and the heterologous adenine homopolymer is between 20 and 120 nucleotides. 54. An RNA molecule comprising, from 5’ to 3’: a 5’-untranslated region (5’-UTR), at least one coding sequence (CDS) for at least one protein, and a 3’-untranslated region (3’-UTR), wherein the 5’-UTR is a 5’-UTR of a Dengue virus or a fragment thereof, and the 3’-UTR is a 3’-UTR of the Dengue virus or the fragment thereof, wherein the fragment is at least 40 nucleotides in length, and the CDS is heterologous to the Dengue virus and replaces an open reading frame of the Dengue virus, such that the portion of the open reading frame that interacts with a complement of the 3’-UTR to form a circular conformation is retained in the RNA molecule. 55. The RNA molecule of embodiment 54, wherein a first start codon in the portion of the open reading frame that is retained in the RNA molecule is mutated to not initiate translation of a first corresponding genomic sequence, and a first corresponding portion of the 3’-UTR that interacts with the first start codon to form the circular conformation is mutated, such that the mutated first start codon remains complementary to the mutated first corresponding portion of the 3’-UTR to form the circular conformation. 56. The RNA molecule of embodiment 55, wherein a second initiation codon in the portion of the open reading frame that remains in the RNA molecule is mutated to not initiate translation of a second corresponding genomic sequence, and a second corresponding portion of the 3’-UTR that interacts with the second initiation codon to form the circular conformation is mutated such that the mutated second initiation codon remains complementary to the mutated second corresponding portion of the 3’-UTR to form the circular conformation. 57. The RNA molecule of any one of embodiments 54-56, further comprising a 5’-cap. 58. The RNA molecule of any one of embodiments 54-57, wherein: (i) the 5’-UTR comprises the nucleotide sequence of SEQ ID NO: 25, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 25; and (ii) the 3’-UTR comprises the nucleotide sequence of SEQ ID NO: 26, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 26. 59. The RNA molecule of any one of embodiments 54-58, further comprising a homopolymer of adenines downstream of the 3’-UTR. 60. The RNA molecule of embodiment 59, wherein the homopolymer of adenines is between about 30 nucleotides and about 60 nucleotides in length. 61. An RNA molecule comprising, from 5’ to 3’: a 5’-untranslated region (5’-UTR), at least one coding sequence (CDS) of at least one protein, and a 3’-untranslated region (3’-UTR), wherein the 5’-UTR is a 5’-UTR of a plant virus or a fragment thereof, and the 3’-UTR is a 3’-UTR of the plant virus or a fragment thereof, wherein the fragment is at least 40 nucleotides in length, the CDS is heterologous to the plant virus and replaces at least a portion of an open reading frame of the plant virus, the virus is a positive-sense single-stranded RNA (+ssRNA) virus, the genome of the virus lacks a poly(A) tail, and the 3-UTR comprises a 3’-cap independent translation enhancer (3’-CITE). 62. The RNA molecule of embodiment 61, further comprising a 5’-cap that is heterologous to the plant virus. 63. The RNA molecule of embodiment 61 or embodiment 62, further comprising a homopolymer of adenine that is heterologous to the plant virus. 64. The RNA molecule of embodiment 63, wherein the adenine homopolymer is between about 30 nucleotides and about 60 nucleotides in length. 65. The RNA molecule of any one of embodiments 61-64, wherein the plant virus is barley yellow dwarf virus (BYDV), maize necrotic streak virus (MNESV), millet mosaic virus (PMV), pea ear mosaic virus-2 (PEMV2), or turnip crinkle virus (TCV). 66. The RNA molecule of any one of embodiments 61-64, wherein the 3'-CITE is a BYDV-like translation element (BTE), a PMV-like translation element (PTE), an I-shaped secondary structure (ISS), or a T-shaped structure (TSS). 67. The RNA molecule of embodiment 66, wherein the 3'-CITE is a BTE. 68. The RNA molecule of embodiment 67, wherein: (i) the 5'-UTR comprises the nucleotide sequence of SEQ ID NO: 27, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 27; and (ii) the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 28, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 28. 69. The RNA molecule of embodiment 66, wherein the 3'-CITE is a PTE. 70. The RNA molecule of embodiment 69, wherein: (i) the 5'-UTR comprises the nucleotide sequence of SEQ ID NO: 29, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 29; and (ii) the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 30, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 30. 71. The RNA molecule of embodiment 69, wherein: (i) the 5'-UTR comprises the nucleotide sequence of SEQ ID NO:31, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:31; and (ii) the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 32, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 32. 72. The RNA molecule of embodiment 66, wherein the 3'-CITE is an ISS. 73. The RNA molecule of embodiment 72, wherein: (i) the 5'-UTR comprises the nucleotide sequence of SEQ ID NO:33, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:33; and (ii) the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 34, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 34. 74. The RNA molecule of embodiment 66, wherein the 3'-CITE is a TSS. 75. The RNA molecule of embodiment 74, wherein: (i) the 5'-UTR comprises the nucleotide sequence of SEQ ID NO:35, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:35; and (ii) the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 36, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 36. 76. An RNA molecule comprising, from 5' to 3', a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein The 5'-UTR is a 5'-UTR of a virus or a fragment thereof, and the 3'-UTR is a 3'-UTR of the virus or a fragment thereof, the fragment being at least 40 nucleotides in length, The CDS is heterologous to the virus and replaces the open reading frame of the virus, and The virus is a positive-sense single-stranded RNA (+ssRNA) virus. 77. The RNA molecule of embodiment 76, wherein the viral 3'-UTR comprises a heterologous adenine homopolymer downstream of a homologous adenine homopolymer of the virus. 78. The RNA molecule of embodiment 77, wherein: (i) the 5'-UTR comprises the nucleotide sequence of SEQ ID NO:37, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:37; and (ii) the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 38, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 38. 79. The RNA molecule of embodiment 76, wherein the at least one protein comprises full-length human dystrophin or full-length human type VII collagen alpha-1 (VII) chain (COL7A1). 80. The RNA molecule of embodiment 76, wherein the CDS comprises the nucleotide sequence of SEQ ID NO: 39, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 39. 81. The RNA molecule of embodiment 76, wherein the CDS comprises the nucleotide sequence of SEQ ID NO: 40, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 40. 82. The RNA molecule of embodiment 76, comprising the nucleotide sequence of SEQ ID NO: 41, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 41. 83. The RNA molecule of any one of embodiments 76-82, wherein the 5'-UTR and the 3'-UTR form a circular conformation. 84. An RNA molecule comprising, from 5' to 3', a viral 5'-untranslated region (5'-UTR), a multiple cloning site (MCS) and a viral 3'-untranslated region (3'-UTR), wherein The virus is a positive-sense single-stranded RNA (+ssRNA) virus, and the MCS is 18 to 60 nucleotides in length. 85. The RNA molecule of embodiment 84, wherein the MCS comprises the nucleotide sequence of SEQ ID NO: 8. 86. The RNA molecule of embodiment 84, comprising the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 3. 87. The RNA molecule of embodiment 84, comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 11-24, or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 11-24. 88. The RNA molecule of any one of embodiments 84-87, further comprising at least one coding sequence (CDS) for at least one protein located within or replacing a portion of the MCS. 89. A DNA template for the RNA molecule of any one of embodiments 31-88. 90. The DNA template of embodiment 89, wherein one or more first restriction enzyme sites are present between the 5’-UTR and the at least one coding region, and one or more second restriction enzyme sites are present between the at least one coding region and the 3’-UTR. 91. A plasmid comprising the DNA template of embodiment 90, wherein the plasmid comprises a promoter upstream of the 5’ UTR. 92. A host cell comprising the plasmid of embodiment 91. 93. A recombinant virus comprising the RNA molecule of any one of embodiments 31-88. 94. A method for expressing a protein, the method comprising contacting a mammalian cell with the RNA molecule of any one of embodiments 31-88. 95. The method of embodiment 94, wherein the contacting is performed in vitro. 96. The method of embodiment 94, wherein the contacting is performed in vivo. 97. The method of any one of embodiments 94-96, wherein the contacting is performed in the presence of a B18R protein. EXAMPLE

[0150] Abbreviations: +ssRNA (single-stranded positive-sense RNA); 3'-UTR (3'-untranslated region); 5'-UTR (5'-untranslated region); 5mC + Ψ (5-methylcytosine and pseudouridine); 5moU (5-methoxyuridine); B18R (vaccinia virus-encoded receptor protein); BTE (BYDV-like translation element); BYDV (barley yellow dwarf virus); CDS (coding sequence); COL1A (type I collagen α chain); COL7A1 (type VII collagen α-1 chain); DAPI (4',6-diamidino-2-phenylindole); DENV (dengue virus); DMD (dystrophin); EGF P (enhanced green fluorescent protein); EPO (erythropoietin); GOI (gene of interest); GS-linker (glycine-serine linker); HDFn (human dermal fibroblasts, neonatal); IRES (internal ribosome entry site); IVT (in vitro transcription); kb (kilobase); LUC (luciferase); m1Ψ (N1-methylpseudouridine); MCS (multiple cloning site); MNESV (maize necrotic streak virus); NOV (Nodamura virus); NOV RNA1 (NOV1); NOV RNA2 (NOV2); ORF (open reading frame); PCR (polymerase chain reaction); PEMV2 (pea ear mosaic virus-2); PMV (millet mosaic virus); PTE (PMV-like translation element); Ψ (pseudouridine); synRNA (synthetic mRNA); RdRp (RNA-dependent RNA polymerase); TCV (turnip crinkle virus); and Unm (unmodified). Example 1. Generation of NOV1-EGFP, NOV2-EGFP, NOV2m, and NOV2m-EGFP synRNAs

[0151] This example describes the construction of plasmid DNA and its use for synRNA production. Nodamura virus (NOV) contains a bipartite ssRNA genome: RNA1 (NOV1) and RNA2 (NOV2). Both RNA1 and RNA2 possess a 5'-cap but lack a poly(A) tail at their 3' ends. RNA1 encodes the RNA-dependent RNA polymerase (RdRp), and RNA2 encodes the capsid protein. As a proof-of-concept, the open reading frames (ORFs) of NOV1 and NOV2 were replaced with the open reading frames (ORFs) of a gene of interest (GOI). Materials and methods

[0152] Design of NOV RNA and construction of template plasmid DNA. The NOV1 RNA genome sequence (NCBI Accession: NC_002690) and NOV2 RNA genome sequence genome 2 (NOV2, NCBI Accession: NC_002691) were used as starting sequences. The open reading frame (from start codon to stop codon) of NOV1 and NOV2 was replaced with the coding sequence of enhanced green fluorescent protein (EGFP) (Fig. 1A, Fig. IB). To facilitate cloning of multiple genes in the NOV2 expression cassette of plasmid DNA, the ORF of NOV2 was replaced with a multiple cloning site sequence. This expression cassette is named NOV2m (Fig. 1C). NOV2m-EGFP was generated by cloning EGFP with the Kozak consensus sequence into the Ascl-Notl site (Fig. ID). Exemplary plasmid DNA for the production of NOV1-GOI mRNA, NOV2-GOI mRNA, and NOV2m-GOI mRNA is shown in Fig. IE. A T7 RNA polymerase promoter sequence was added to the 5’ end of NOV1 and NOV2 to facilitate in vitro transcription (IVT). A 5’-cap can be added to the mRNA using standard methods. However, for convenience, a 5’-cap (Cap 1) was added using CleanCap AG (Henderson 2021; TriLink). This was made possible by the insertion of a nucleotide (A) immediately downstream of the T7 promoter. At the 3’ end, a Sapl restriction enzyme site was added to generate the same 3’ end sequence as present in the NOV1 and NOV2 RNA fragments.

[0153] Synthetic RNA was produced by in vitro transcription. Plasmid DNA was linearized with Sapl restriction enzyme and used as template DNA for in vitro transcription (IVT) with the MEGAscript T7 kit (ThermoFisher Scientific) according to the manufacturer’s instructions. A 5’-cap was incorporated using CleanCap AG (TriLink). RNA with modified nucleosides was produced according to the manufacturer’s instructions. Five forms of RNA were prepared: standard RNA without any nucleoside modifications (unmodified), RNA modified with 5-methylcytosine and pseudouridine (5mC + Ψ), RNA modified with N1-methylpseudouridine (mlΨ), RNA modified with 5-methoxyuridine (5moU), RNA modified with pseudouridine (Ψ). Results

[0154] Schematic of successfully produced synRNAs is shown in Fig. 1A, Fig. IB, Fig. 1C, and Fig. ID. The RNA sequences of these constructs are shown as SEQ ID NOs: 1-4. Example 2. EGFP protein expression from NOV1 mRNA and NOV2 mRNA

[0155] This example describes transfection of human fibroblasts with synRNAs in which the open reading frame (from start codon to stop codon) of NOV1 and NOV2 is replaced with the coding sequence of enhanced green fluorescent protein (EGFP). It also describes the viability of the transfected cells and the expression of EGFP protein in the transfected cells. Materials and Methods

[0156] Cell culture. Newborn human dermal fibroblasts (HDFn) were purchased from ThermoFisher Scientific (cat. no. C0045C) and cultured according to the manufacturer’s instructions.

[0157] NOV1-EGFP synRNAs and NOV2-EGFP synRNAs were transfected into HDFn. On day -1, 3 x 10^4 HDFn cells / well were plated in a 24-well plate. The next day, cells were transfected with 0.5 µg of synRNA using MessengerMax transfection reagent (ThermoFisher). Four different synRNAs were used: NOV1-EGFP synRNA (unmodified), NOV1-EGFP synRNA (modified with 5mC and Ψ), NOV2-EGFP synRNA (unmodified), and NOV2-EGFP synRNA (modified with 5mC and Ψ). HDFn cells were cultured at 37ºC or 33ºC with or without 250 ng / mL of recombinant B18R (Sigma). B18R is a vaccinia virus protein that functions as a decoy receptor for type I interferons. During RNA transfection, B18R binds human interferon alpha and improves cell viability.

[0158] Cell viability and EGFP expression. Phase contrast images (left) and fluorescence images (right) were taken 12 hours after RNA transfection (Figures 2A, 2B). The fluorescence images show the level of EGFP expression. Phase contrast images were taken 96 hours after RNA transfection (Figure 3). Results and Conclusions

[0159] EGFP protein expression was detected by fluorescence microscopy in both NOV1-EGFP mRNA-transfected cells and NOV2-EGFP mRNA-transfected cells at 37ºC (standard cell culture conditions) (Figure 2A) and at 33ºC (hypothermic conditions) (Figure 2B). Both mRNAs lack a poly(A) tail. Therefore, synRNAs are translatable even though they lack a poly(A) sequence.

[0160] It is known that NOV functions best at about 30°C and has little function at 37°C. Therefore, it was unexpected that EGFP was expressed more strongly at 37°C (Figure 2A) than at 33°C (Figure 2B).

[0161] Interestingly, strong expression of EGFP was observed in more cells transfected with NOV2-EGFP mRNA than in cells transfected with NOV1-EGFP mRNA (Figure 2A, Figure 2B). Both the 5'-UTR and 3'-UTR sequences of NOV2 are different from those of NOV1. This indicates that the protein translation efficiency of mRNA lacking the poly(A) sequence depends on the 5'-UTR and / or 3'-UTR sequence.

[0162] In phase contrast images, it was observed that both NOV1-EGFP synRNA and NOV2-EGFP synRNA were toxic to the transfected cells (i.e., cytopathic effect), as evidenced by the presence of dead cells (Figure 2A, Figure 2B, Figure 3). The cytopathic effect was reduced in cells transfected with nucleoside-modified NOV1-EGFP synRNA and NOV2-EGFP synRNA (Figure 2A, Figure 2B, Figure 3). The cytopathic effect of unmodified synRNA was attenuated when the transfected cells were cultured in the presence of B18R (Figure 2A, Figure 2B, Figure 3). It is interesting to note that naturally occurring NOV RNA lacks nucleoside modifications.

[0163] In summary, the 5'-UTR and 3'-UTR of NOV1 and NOV2 can be used as components of poly(A)-free synRNA for expressing a protein of interest in transfected cells. NOV2 (5'-UTR, 3'-UTR) is more effective than NOV1 (5'-UTR, 3'-UTR). Unmodified NOV1 and NOV2 mRNA are cytotoxic. Modification of nucleosides (5mC + Ψ) attenuates the cytotoxicity of NOV1- and NOV2-based mRNA. The presence of B18R in the culture medium attenuates the cytotoxicity of mRNA to some extent. NOV1 mRNA and NOV2 mRNA are translatable at both 37°C and 33°C, with slightly higher expression levels observed at 37°C than at 33°C. Example 3: Effect of nucleoside modification on NOV2-EGFP expression

[0164] This example describes the transfection of human fibroblasts with nucleoside-modified NOV2-EGFP synRNA. It also describes the viability of the transfected cells and the expression of EGFP protein in the transfected cells. Materials and Methods

[0165] Cell culture. Neonatal human dermal fibroblasts (HDFn) were purchased from ThermoFisher Scientific (Cat. No. C0045C) and cultured according to the manufacturer's instructions.

[0166] NOV2-EGFP synRNA was transfected into HDFn cells. On day -1, 3 x 10^4 HDFn cells were plated per well in a 24-well plate. The following day, cells were transfected with 0.5 µg of synRNA using MessengerMax transfection reagent (ThermoFisher). Five different synRNAs were transfected: NOV2-EGFP synRNA (unmodified), NOV2-EGFP synRNA (5mC and Ψ-modified), NOV2-EGFP synRNA (m1Ψ-modified), NOV2-EGFP synRNA (5moU-modified), and NOV2-EGFP synRNA (Ψ-modified). HDFn cells were cultured at 37°C or 33°C in the presence or absence of 250 ng / mL B18R (Sigma).

[0167] Cell viability and EGFP expression. Phase contrast and fluorescence images were taken 24 hours after RNA transfection. Fluorescence images show EGFP expression levels. Results and Conclusions

[0168] EGFP protein expression was detected in all cells transfected with modified NOV2-EGFP synRNA when cultured at 37°C (standard cell culture conditions) and 33°C (cooled conditions). As shown in Table 3-1, synRNA containing N1-methylpseudouridine (m1Ψ) showed the strongest protein expression, followed by synRNA containing 5-methylcytosine and pseudouridine (5mC + Ψ). SynRNAs with 5moU or Ψ modifications showed weaker expression than those with 5mC + Ψ modifications. Table 3-1. Effects of culture conditions and nucleotide modifications

[0169] The results of Example 3 are consistent with those of Example 2. Expression of the modified NOV2-EGFP was slightly stronger when transfected cells were cultured at 37°C compared to when cultured at 33°C. Based on phase-contrast images captured under the same conditions as in Table 3-1, unmodified NOV2 synRNA was more cytotoxic than modified NOV2 synRNA. When transfected cells were cultured at 37°C, B18R was able to mitigate the cytotoxicity of unmodified NOV2 synRNA to some extent.

[0170] In summary, the 5'-UTR and 3'-UTR of NOV2 can be used as components of synRNAs without poly(A). NOV2 synRNAs lacking nucleotide modifications are cytotoxic. Modification of the nucleosides mitigates the cytotoxicity of NOV2 mRNA. The presence of B18R in the culture medium of transfected cells mitigates the cytotoxicity of many NOV2 synRNAs to some extent when the cells are cultured at 37ºC. Protein production is slightly higher when transfected cells are cultured at 37ºC compared to when cultured at 33ºC. Example 4. Inclusion of a multiple cloning site in NOV2-based synRNAs

[0171] This example describes testing of NOV2-based synRNAs in which the coding sequence for EGFP was inserted within a multiple cloning site located between the 5'-UTR and 3'-UTR of NOV2. This NOV2-based synRNA is named NOV2m (m is for multiple cloning site). It can be used to produce mRNAs containing any ORF (encoding any protein of interest) in the absence of a poly(A) sequence. Materials and Methods

[0172] Cell culture. Neonatal human dermal fibroblasts (HDFn) were purchased from ThermoFisher Scientific (Cat. No. C0045C) and cultured according to the manufacturer’s instructions.

[0173] NOV2-EGFP synRNAs and NOV2m-EGFP synRNAs were transfected into HDFn. On day -1, 3 x 10^4 HDFn cells / well were plated in a 24-well plate. The next day, cells were transfected with 1.0 µg of NOV2-EGFP synRNA (modified with mlΨ) or NOV2m-EGFP (modified with mlΨ) synRNA using MessengerMax transfection reagent (ThermoFisher). HDFn cells were cultured at 37ºC or 30ºC with or without 250 ng / mL of B18R (Sigma).

[0174] Cell viability and EGFP expression. Phase contrast and fluorescence images were taken 17 hours, 24 hours, and 42 hours after RNA transfection. Fluorescence images show EGFP expression levels. Results and Conclusions

[0175] EGFP protein expression was detected in cells transfected with both NOV2-EGFP (m1Ψ) synRNA and NOV2m-EGFP (m1Ψ) synRNA when cultured at 37°C in the presence or absence of B18R (Table 4-1). Strong EGFP expression was observed for at least 42 hours after synRNA transfection. Although the presence of B18R slightly increased overall expression, m1Ψ modification alone was sufficient for EGFP protein expression.

[0176] EGFP protein expression was detected in cells transfected with both NOV2-EGFP (m1Ψ) synRNA and NOV2m-EGFP (m1Ψ) synRNA when cultured at 30°C in the presence or absence of B18R (Table 4-1). While strong expression was observed for at least 42 hours after synRNA transfection, expression was stronger at 37°C than at 30°C. Although the presence of B18R slightly increased overall expression, the m1Ψ modification alone was sufficient for robust protein expression. Table 4-1. Effects of culture conditions and multiple cloning sites

[0177] In summary, insertion of a multiple cloning site between the 5'-UTR and 3'-UTR of NOV2 did not interfere with protein translation from NOV2-based synRNAs. Plasmids containing the NOV2m sequence facilitated cloning of target coding sequences into the multiple cloning site for in vitro transcription of synRNAs lacking a poly(A) tail. Based on phase-contrast images captured under the same conditions as in Table 3-1, inclusion of modified nucleosides mitigated the cytotoxicity of NOV2m synRNAs. The presence of B18R in the culture medium of transfected cells increased protein expression from synRNAs containing modified nucleosides to a lesser extent. Protein yields were slightly higher when transfected cells were cultured at 37°C compared to when cultured at 30°C. Protein production from NOV2m synRNAs persisted for over 42 hours after transfection. Example 5. Stronger and longer protein expression from NOV2-RNA and NOV2 m-RNA

[0178] This example describes a comparison of EGFP expression from cells transfected with NOV2 and NOV2m synRNAs and cells transfected with a control synRNA with a standard 120 poly(A) tail. Materials and methods

[0179] Control-EGFP synRNAs were generated by in vitro transcription. As a control, control-EGFP synRNAs encoding EGFP were used. Control-EGFP synRNAs with 5-methylcytosine and pseudouridine (5mC + Ψ) modifications were prepared according to published protocols (Warren et al. 2010; Mandall and Rossi, 2013). A poly(A) tail of 120 consecutive adenines was added to the 3’ end by tail-PCR (Warren et al. 2010; Mandall and Rossi, 2013). The 3’-UTR sequence of the control-EGFP synRNAs was identical to the Mus musculus hemoglobin alpha adult chain 1 (Hba-a1) mRNA (NM_008218.2).

[0180] Cell culture. Newborn human dermal fibroblasts (HDFn) were purchased from ThermoFisher Scientific (Cat. No. C0045C) and cultured according to the manufacturer’s instructions.

[0181] NOV2-EGFP synRNAs, NOV2m-EGFP synRNAs and synRNA-EGFP were transfected into HDFn. On day -1, 3 x 10^4 HDFn cells / well were plated in 24-well plates. The next day, cells were transfected with 1.0 µg of NOV2-EGFP synRNA (m1Ψ-modified), NOV2m-EGFP synRNA (m1Ψ-modified) or synRNA-EGFP (5mC + Ψ-modified) using MessengerMax transfection reagent (ThermoFisher). HDFn cells were incubated at 37ºC with or without 250 ng / mL of B18R (Sigma).

[0182] Cell viability and EGFP expression. EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) at 24 hours, 96 hours and 185 hours post-transfection. GFP-positive (+) cells were presented as the percentage (%) of total cells with fluorescence intensity of GFP > 30 (all GFP+ cells) or GFP > 300 (strong GFP+ cells). Results and conclusions

[0183] EGFP protein expression was detected in cells transfected with both NOV2-EGFP (ml ) synRNA and NOV2m-EGFP (ml ) synRNA in the presence or absence of B18R when the transfected cells were incubated at 37°C or 30°C (FIG. 4A, FIG. 4B, Table 5-1). At 24 hours post-transfection, almost all cells expressed GFP (GFP > 30) in the presence or absence of B18R. About 60% to 80% of GFP+ cells showed high levels of GFP expression (GFP > 300). GFP expression persisted for more than 185 hours (8 days) for both NOV2-EGFP synRNA and NOV2m-EGFP synRNA (FIG. 4A, FIG. 4B, Table 5-1).

[0184] As expected, cells transfected with control-EGFP synRNA containing a 120A poly(A) tail also expressed GFP (FIG. 4A, Table 5-1). However, expression from synRNAs with a poly(A) tail was much weaker than expression from NOV2 and NOV2m synRNAs lacking a poly(A) tail (FIG. 4A, Table 5-1; at 96 hours post-transfection).

[0185] In summary, protein production from NOV2 and NOV2m synRNAs persisted for more than 185 hours post-transfection. Poly(A)-free NOV2 and NOV2m synRNAs showed comparable or even higher protein expression than control-EGFP synRNA with a 120A poly(A). Table 5-1. Incubation conditions and effect of poly(A) tail Example 6. Production of DENVm-EGFP synRNA and cap-less-DENVm-EGFP synRNA

[0186] This example describes the construction of plasmid DNA and its use for the production of synRNAs. Dengue virus (DENV) is a non-segmented +ssRNA virus with an 11 kb single RNA genome that is modified at the 5’ end with a cap-1 structure for canonical cellular translation. The 3’ end of the RNA genome does not carry a poly(A) tail but forms a loop structure. Interestingly, a cap-independent translation mechanism for DENV has also been described (Mazeaud et al., 2018). Therefore, we tested both the cap 1 and cap-less form of DENV RNA. Materials and Methods

[0187] Design of DENVm synRNA and construction of template plasmid DNA. The genome sequence of Dengue virus 2 (DENV) (NC_001474.2; Kinney et al., 1997) was used as a starting sequence. While the DENV RNA genome appears simple, consisting of a 5’-UTR, a single CDS, and a 3’-UTR, we anticipated that a simple strategy of replacing the CDS with a multi-cloning site sequence for cloning of foreign CDS would not work. To function properly, the DENV RNA is known to have to be circularized by complementary sequences located at both the 5’-UTR (including sequences downstream of the ATG start codon) and the 3’-UTR (Mazeaud et al., 2018). Therefore, we hypothesized that the N-terminal part of the CDS has to be kept in the synRNA structure. To make a DENV-based synRNA construct that allows insertion of a foreign CDS starting at the ATG and ending at the stop codon, we introduced two mutations changing AUG to AUC at two positions (Figure 5B). These mutations eliminated the two ATG start codons upstream of the multi-cloning site. However, the introduction of these two mutations resulted in the disruption of the complementary sequences between these sequences and the corresponding sequences in the 3’-UTR. To maintain the circular structure of the DENV-based synRNA, two corresponding mutations in the 3’-UTR were also introduced (CAU -> GAU; GAC -> CAC) (Figure 5B).

[0188] The final DENV-based synRNA construct (named DENVm synRNA) contains a 5’-cap1, a 5’-UTR (mutated), a multi-cloning site (MCS), a 3’-UTR (mutated), and does not contain a poly(A) (SEQ ID NO: 11). The RNA was made by IVT using a T7 RNA polymerase and a plasmid DNA template linearized with a SapI restriction enzyme.

[0189] The exemplary plasmid DNA used to produce the DENVm synRNA contains a T7 RNA polymerase promoter sequence for in vitro transcription (IVT) reactions. A 5’-cap can be added to the mRNA using standard methods. However, for convenience, a 5’-cap (cap1) was added using CleanCap AG (Henderson 2021; TriLink). This was made possible by the insertion of a nucleotide (A) immediately downstream of the T7 promoter. Any 5’-cap (e.g., cap0, cap1, cap2) can be added to the 5’ end of the DENVm synRNA. At the 3’ end, a SapI restriction enzyme site was added to create the same 3’ end sequence as present in the DENV RNA genome. To test protein production, an EGFP was cloned into the MCS.

[0190] Design of cap-less-DENVm synRNA and construction of template plasmid DNA. Since a cap-independent translation mechanism for DENV has also been described (Mazeaud et al., 2018), we constructed a plasmid DNA with a standard T7 RNA polymerase promoter that produces the same DENVm synRNA but lacks the 5’-cap, named cap-less-DENVm synRNA (SEQ ID NO: 12).

[0191] Production of DENVm-EGFP synRNA by in vitro transcription. Plasmid DNA was linearized with Sap I restriction enzyme and used as template DNA for in vitro transcription (IVT) carried out according to the manufacturer’s instructions using MEGAscript T7 kit (ThermoFisher Scientific). 5’-caps were incorporated using CleanCap AG (TriLink). Two forms of RNA were prepared: standard RNA without any nucleoside modification (unmodified or UNM) and RNA modified with N1 -methylpseudouridine (m1y). Results and conclusions

[0192] A schematic representation of the successfully produced DENVm-EGFP synRNA is shown in Figures 5A, 5B and 5C. The RNA sequence of DENVm-MCS is shown in SEQ ID NO: 11 and the RNA sequence of cap-less-DENVm is shown in SEQ ID NO: 12. Example 7. EGFP protein expression from DENVm synRNA and cap-less-DENVm synRNA

[0193] This example describes a comparison of EGFP expression in cells transfected with DENVm-EGFP synRNA and cap-less-DENVm-EGFP synRNA. Materials and methods

[0194] Cell culture. Newborn human dermal fibroblasts (HDFn) were purchased from ThermoFisher Scientific (cat. no. C0045C) and cultured according to the manufacturer’s instructions.

[0195] DENV m-EGFP synRNAs and capless-DENV m-EGFP synRNAs were transfected into HDFns. On day -1, 3 x 10^4 HDFn cells / well were plated in 24-well plates. The next day, cells were transfected with 1.0 pg of synRNA using MessengerMax transfection reagent (ThermoFisher). HDFn cells were incubated at 30ºC or 37ºC with or without 250 ng / mL of B18R (Sigma).

[0196] EGFP expression. EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) on day 1 and day 4 post-transfection. GFP positive (+) cells were presented as the percentage (%) of total cells with fluorescence intensity of GFP > 30 (all GFP+ cells), GFP > 300 (strong GFP+ cells), or GFP > 2000 (very strong GFP+ cells). Results and conclusions

[0197] When transfected cells were incubated at 37ºC or 30ºC in the presence or absence of B18R, EGFP protein expression was detected in cells transfected with both DENV m-EGFP synRNA (unmodified) and DENV m-EGFP synRNA (ml ) (Figure 6).

[0198] Interestingly, DENV m-EGFP synRNA (unmodified) showed stronger EGFP expression than DENV m-EGFP synRNA (ml ) under all four incubation conditions (30ºC or 37ºC; B18R+ or B18R-) (Figure 6). This is a very unique feature of DENV m synRNAs, as it is well known that synRNAs with modified nucleosides generally show stronger protein expression than unmodified synRNAs.

[0199] Also unusual is that DENV m-EGFP synRNA (unmodified) showed stronger expression on day 4 compared to day 1 (Figure 6), as synRNAs typically show strong expression on day 1, which gradually weakens over time.

[0200] Also interesting to note is that the presence or absence of B18R had little effect on EGFP expression (Figure 6).

[0201] In contrast to the 5'-cap+ versions, the uncapped versions of both DENV m-EGFP synRNA (unmodified) and DENV m-EGFP synRNA (mlY) produced very low levels of EGFP (Figure 7). This result indicates that 5'-caps are required for efficient translation from DENV m RNAs, as in their natural state, despite the previously described cap-independent translation mechanism for DENV (Mazeaud et al., 2018).

[0202] In summary, DENV m synRNAs offer unique features that differ from commonly used synRNA platforms: notably, protein production from DENV m synRNAs is stronger in the natural, unmodified form than in the modified nucleoside form. Example 8. EGFP protein expression from DENV m synRNAs in long-term cell culture

[0203] This example describes long-term EGFP expression from DENV m-EGFP synRNAs. Materials and Methods

[0204] Cell culture. Neonatal human dermal fibroblasts (HDFn) were purchased from ThermoFisher Scientific (Cat. No. C0045C) and cultured according to the manufacturer's instructions.

[0205] DENV m-EGFP synRNAs (unmodified) and DENV m-EGFP synRNAs (modified with mlY) were transfected into HDFn. On day -1, 3 x 10^4 HDFn cells / well were plated in 24-well plates. The following day, cells were transfected with 1.0 pg of synRNA using MessengerMax transfection reagent (ThermoFisher). Following synRNA transfection, HDFn cells were cultured at 33 °C or 37 °C for up to 11 days with or without 250 ng / mL of B18R (Sigma).

[0206] EGFP expression. EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) at multiple time points post-transfection. GFP-positive (+) cells were presented as the percentage (%) of total cells with fluorescence intensity of GFP > 30 (all GFP+ cells), GFP > 300 (strong GFP+ cells), or GFP > 2000 (very strong GFP+ cells). Results and Conclusions

[0207] Consistent with Example 7, interestingly, DENVm-EGFP synRNA (unmodified) showed stronger EGFP expression than DENVm-EGFP synRNA (m1Ψ) under all four culture conditions (33°C or 37°C; B18R+ or B18R-) (Figure 8). The presence or absence of B18R had little effect on EGFP expression (Figure 8). Under 33°C culture conditions, EGFP expression increased from day 1 to day 4, but then decreased over time, reaching very low levels by day 11. However, under 37°C culture conditions, EGFP expression was initially high on day 1 and gradually decreased over time (Figure 8).

[0208] In summary, the experiments show that DENVm functions as a unique synRNA platform, which may be particularly useful for applications requiring synRNAs with unmodified nucleosides. Example 9. Production of Cap-Free Plant+ssRNA Virus-Based SynRNA

[0209] This example describes the construction of plasmid DNA and its use to generate synRNAs based on +ssRNA viruses that infect plants. Unlike +ssRNA viruses that infect insects and vertebrates, +ssRNA viruses that infect plants have neither a 5'-cap nor a poly(A) tail. We selected five different plant +ssRNA viruses and prepared synRNA constructs. These plant +ssRNAs lack a 5'-cap, and therefore we first tested uncapped forms of the synRNAs. Materials and methods

[0210] Design of plant + ssRNA virus-based synRNA and construction of template plasmid DNA.

[0211] The uncapped BYDVm synRNA (SEQ ID NO: 14) consists of the 5'-UTR, multiple cloning site (MCS), and 3'-UTR (without the BTE) of barley yellow dwarf virus (BYDV: NC_004750.1). The BTE sequence element is a 3' CITE, which folds into a compact cruciform RNA secondary structure and is called a BYDV-like translation element (BTE).

[0212] Uncapped-BYDV2 mRNA (SEQ ID NO: 16) contains the 5'-UTR, MCS, BTE (added) sequence, and 3'-UTR of barley yellow dwarf virus (BYDV: NC_004750.1).

[0213] Capless-MNESVm RNA (SEQ ID NO: 18) contains the 5'-UTR, MCS, and 3'-UTR of Maize necrotic streak virus (MNESV: NC_007729.1).

[0214] Capless-PMVm RNA (SEQ ID NO: 20) contains the 5'-UTR, MCS, and 3'-UTR of Mungbean mosaic virus (PMV: U55002.1).

[0215] Capless-PEMV2m RNA (SEQ ID NO: 22) contains the 5'-UTR, MCS, and 3'-UTR of Pea enation mosaic virus-2 (PEMV2: NC_003853.1).

[0216] Capless-TCVm RNA (SEQ ID NO: 24) contains the 5'-UTR, MCS, and 3'-UTR of RNA of Turnip crinkle virus coat protein (TCV: NC_003821.3).

[0217] Exemplary plasmid DNA for production of plant+ssRNA virus-based synRNAs contains a T7 RNA polymerase promoter sequence for in vitro transcription (IVT) reactions.

[0218] synRNAs were produced by in vitro transcription. Plasmid DNA was linearized with the Sap I restriction enzyme and used as template DNA for in vitro transcription (IVT) carried out using the MEGAscript T7 kit (ThermoFisher Scientific) according to the manufacturer's instructions. Two forms of RNA were prepared: standard RNA without any nucleoside modifications (unmodified or UNM or U) and RNA modified with N1-methylpseudouridine (mlp or M). Results and Conclusions

[0219] Schematic of successfully produced synRNAs is shown in FIG. 9. RNA sequences for these constructs are shown as SEQ ID NOs: 14, 16, 18, 20, 22, 24. Example 10. EGFP protein expression from capless (uncapped) plant+ssRNA virus-based synRNAs.

[0220] This example describes EGFP expression from plant+ssRNA virus-based synRNAs encoding EGFP. Materials and Methods

[0221] Cell culture. Newborn human dermal fibroblasts (HDFn) were purchased from ThermoFisher Scientific (Cat. No. C0045C) and cultured according to the manufacturer’s instructions.

[0222] Unmodified and m1Ψ-modified cap-less BYDm, cap-less MNESVm, cap-less PMVm, cap-less TCVm, cap-less PEMV2m, and cap-less BYDV2m synRNAs encoding EGFP were transfected into HDFn. On day -1, 3 x 10^4 HDFn cells / well were plated in 24-well plates. The next day, cells were transfected with 1.0 µg of synRNA using MessengerMax transfection reagent (ThermoFisher). Following synRNA transfection, HDFn cells were cultured at 33ºC or 37ºC for up to 5 days with or without 250 ng / mL of B18R (Sigma).

[0223] EGFP expression. EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) at multiple time points post-transfection. GFP-positive (+) cells were presented as the percentage (%) of total cells with fluorescence intensity of GFP > 30 (all GFP+ cells), GFP > 300 (strong GFP+ cells), or GFP > 2000 (very strong GFP+ cells). Results and conclusions

[0224] While some synRNAs showed very low EGFP expression (e.g., cap-less PMVm, cap-less BYDVm, and cap-less BYDV2m), essentially no EGFP expression was detected for both unmodified and modified nucleosides under all four culture conditions (30ºC or 37ºC; B18R+ or B18R-) (Table 10-1). Table 10-1. EGFP expression from cap-less (cap-less) plant+ssRNA virus-based synRNAs

[0225] In summary, the experiments showed that cap-less forms of plant+ssRNA virus-based synRNAs did not express EGFP. Example 11. Production of 5’-cap-containing plant+ssRNA virus-based synRNAs

[0226] This example describes the construction of plasmid DNA and its use for the production of synRNAs based on +ssRNA viruses that infect plants. Unlike +ssRNA viruses that infect insects and vertebrates, +ssRNA viruses that infect plants do not have a 5'-cap structure nor a poly(A) tail. We artificially added a 5'-cap (capl) to the 5' end of the synRNAs. We selected five different plant +ssRNA viruses and prepared synRNA constructs. Materials and Methods

[0227] Design of 5'-cap containing synRNAs based on plant +ssRNA viruses and construction of template plasmid DNA.

[0228] BYDVm synRNA (SEQ ID NO: 13) consists of a 5'-cap (capl), the 5'-UTR of Barley yellow dwarf virus (BYDV: NC_004750.1), a multiple cloning site (MCS), and a 3'-UTR (without BTE). The BTE sequence element is a 3' CITE that folds into a compact cruciform RNA secondary structure and is called BYDV-like translation element (BTE).

[0229] BYDV2m RNA (SEQ ID NO: 15) contains a 5'-cap (capl), the 5'-UTR of Barley yellow dwarf virus (BYDV: NC_004750.1), a MCS, a BTE sequence (added), and a 3'-UTR.

[0230] MNESVm RNA (SEQ ID NO: 17) contains a 5'-cap (capl), the 5'-UTR of Maize necrotic streak virus (MNESV: NC_007729.1), a MCS, and a 3'-UTR.

[0231] PMVm RNA (SEQ ID NO: 19) contains a 5'-cap (capl), the 5'-UTR of Miliitia mosaic virus (PMV: U55002.1), a MCS, and a 3'-UTR.

[0232] PEMV2m RNA (SEQ ID NO: 21) contains a 5'-cap (capl), the 5'-UTR of Pea enation mosaic virus-2 (PEMV2: NC_003853.1), a MCS, and a 3'-UTR.

[0233] TCVm RNA (SEQ ID NO: 23) contains a 5'-cap (capl), the 5'-UTR of RNA of the coat protein of Tulip breaking virus (TCV: NC_003821.3), a MCS, and a 3'-UTR.

[0234] Example plasmid DNA for production of plant+ssRNA virus-based synRNAs contain a T7 RNA polymerase promoter sequence for in vitro transcription (IVT) reactions. A 5'-cap can be added to the mRNA using standard methods. However, for convenience, a 5'-cap (Capl) was added using CleanCap AG (Henderson 2021; TriLink). This was made possible by the insertion of a nucleotide (A) immediately downstream of the T7 promoter. Any 5'-cap (e.g., Capo, Capl, Cap2) can be added to the 5' end of the synRNA. At the 3' end, a Sapl restriction enzyme site was added to produce the same 3' end sequence as found in the +ssRNA virus RNA genome. To test protein production, EGFP was cloned into the MCS.

[0235] synRNAs were produced by in vitro transcription. Plasmid DNA was linearized with Sapl restriction enzyme and used as template DNA for in vitro transcription (IVT) carried out using the MEGAscript T7 kit (ThermoFisher Scientific) according to the manufacturer's instructions. Two forms of RNA were prepared: standard RNA without any nucleoside modifications (unmodified or UNM or U) and RNA modified with Nl-methylpseudouridine (mlY or M). Results and Conclusions

[0236] A schematic of the successfully produced synRNAs is shown in Figure 10. The RNA sequences of these constructs are shown as SEQ ID NOs: 13, 15, 17, 19, 21, 23. Example 12. EGFP expression from plant+ssRNA virus-based synRNAs containing a 5'-cap.

[0237] This example describes EGFP expression from plant+ssRNA virus-based synRNAs (containing a 5'-cap) encoding EGFP. Materials and Methods

[0238] Cell culture. Newborn human dermal fibroblasts (HDFn) were purchased from ThermoFisher Scientific (cat# C0045C) and cultured according to the manufacturer's instructions.

[0239] Unmodified and mlΨ-modified BYDVm, MNESVm, PMVm, TCVm, PEMV2m, and BYDV2m synRNAs encoding EGFP were transfected into HDFn. On day -1, 3 x 10^4 HDFn cells / well were plated in 24-well plates. The next day, cells were transfected with 1.0 pg of synRNA using MessengerMax transfection reagent (ThermoFisher). Following synRNA transfection, HDFn cells were incubated at 33ºC or 37ºC for up to 4 days with or without 250 ng / mL of B18R (Sigma).

[0240] DENVm-EGFP synRNA (unmodified), DENVm-EGFP synRNA (mlΨ-modified), NOV2-EGFP synRNA (mlΨ-modified), and NOV2m-EGFP synRNA (mlΨ-modified) were transfected into HDFn. These four synRNAs were used for comparison purposes.

[0241] Poly(A)-free control-EGFP synRNA (mlΨ-modified) was transfected into HDFn. For comparison purposes, this control synRNA-EGFP was prepared following published protocols (Warren et al., 2010; Mandall and Rossi, 2013). The 3’-UTR sequence of synRNA-EGFP is identical to Mus musculus hemoglobin alpha adult chain 1 (Hba-al) mRNA (NM_008218.2). The RNA was prepared with mlΨ nucleoside modifications. Instead of adding a poly(A) tail of 120 consecutive adenine nucleotides to the 3’ end, no poly(A) was added to this poly(A)-free synRNA-EGFP by tail-PCR.

[0242] EGFP expression. EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) at day 1 and day 4 post-transfection. GFP-positive (+) cells were presented as the percentage (%) of total cells with fluorescence intensity of GFP > 30 (all GFP+ cells), GFP > 300 (strong GFP+ cells), or GFP > 2000 (very strong GFP+ cells). Results and conclusions

[0243] As expected, the poly(A)-free control-EGFP synRNA (5’-capl, mlΨ-modified) showed little EGFP expression at day 1 and day 4 under all four culture conditions (33ºC or 37ºC; B18R+ or B18R-) (Figures 11, 12, 13, and 14).

[0244] As expected, DENVm-EGFP (unmodified), DENVm-EGFP (m1 modified), NOV2-EGFP (m1 modified), and NOV2m-EGFP (m1 modified) all showed strong EGFP expression at day 1 and day 4 under all four culture conditions (33ºC or 37ºC; B18R+ or B18R-) (Figures 11, 12, 13, and 14).

[0245] Surprisingly, 5'-cap containing plant+ ssRNA virus-based synRNAs (both unmodified and m1 modified nucleosides) showed strong EGFP expression at day 1 and day 4 under all four culture conditions (33ºC or 37ºC; B18R+ or B18R-). In particular, TCVm and MNESVm showed significantly stronger EGFP expression than the others (including DENVm-EGFP, NOV2-EGFP, and NOV2m-EGFP) (Figures 11, 12, 13, and 14).

[0246] TCVm showed similar characteristics as standard synRNAs: the m1 modified form showed significantly higher EGFP expression than the unmodified form (Figures 15 and 16); the presence of B18R did not affect EGFP expression; the expression was high at day 1 and decreased over time, but the expression was relatively maintained until day 4; and the expression was observed at both 33ºC and 37ºC (Figure 15).

[0247] Interestingly, MNESVm showed significantly higher expression in the unmodified nucleoside form than in the m1 modified form (Figures 15 and 16). This expression pattern was the same as for DENVm synRNAs, but different from what was observed with commonly used synRNAs. The presence of B18R did not affect the expression of unmodified MNESVm. The expression was strong at day 1 and its expression was relatively well maintained until day 4 (Figure 15).

[0248] In summary, plant+ ssRNA virus-based synRNAs can be used as poly(A)-free synRNAs when a 5'-cap is added. In particular, TCVm and MNESVm can drive very high GOI expression. Example 13. Comparison of EGFP protein expression from poly(A)-free TCVm and control synRNA with 120 poly(A) tail.

[0249] This example describes a fluorescence-activated cell sorter (FACS) analysis comparing EGFP fluorescence intensity between TCVm-EGFP mRNA without poly(A), control-EGFP synRNA with standard 120 poly(A) tail, and untransfected control. Materials and Methods

[0250] Cell culture. Newborn human dermal fibroblasts (HDFn) were purchased from ThermoFisher Scientific (Cat. No. C0045C) and cultured according to the manufacturer’s instructions.

[0251] TCVm-EGFP, control-EGFP synRNA with 120 poly(A) tail production and transfection. TCVm-EGFP (containing 5’-cap, without poly(A)) was produced as described in Example 12. Control-EGFP synRNA (containing 5’-cap, with 120 poly(A)) was prepared following published protocols (Warren et al., 2010; Mandall and Rossi, 2013). The 3’-UTR sequence of control-EGFP synRNA is identical to Mus musculus hemoglobin alpha adult chain 1 (Hba-a1) mRNA (NM_008218.2) and 120 poly(A) tail was added using tail-PCR. On day -1, 3 x 10^4 HDFn cells / well were plated in 24-well plates. The following day, cells were transfected with 1.0 µg of synRNA using MessengerMax transfection reagent (ThermoFisher). Following synRNA transfection, HDFn cells were incubated with 250 ng / mL of B18R (Sigma) for 16 hours at 37ºC before harvesting for FACS analysis.

[0252] FACS analysis: FACS analysis was performed in a standard method. Cells were gated by forward scatter (FSC) and side scatter (SSC) before calculating the geometric mean of fluorescence intensity (MFI). Results and Conclusions

[0253] TCVm-EGFP and control-EGFP showed GFP intensities of 4,794 (MFI) and 6,076 (MFI), respectively (Figure 17). The results show that even without a poly(A) tail, the translation efficiency of TCVm synRNA is comparable to that of control l-EGFP synRNA with a standard 120 poly(A) tail.

[0254] In summary, TCVm (plant + ssRNA virus-based synRNA) can be used as a poly(A)- free synRNA when a 5'-cap is added, and can drive very high GOI expression. Example 14. In vivo protein expression from 5'-cap containing poly(A)- free + ssRNA virus-based synRNA.

[0255] This example describes the discovery that + ssRNA virus-based synRNA lacking a poly(A) tail can be efficiently translated in vivo when a 5'-cap is added. Materials and Methods

[0256] Mice. C57BL / 6 and BALB / c mice were purchased from Jackson Laboratory and housed and handled according to protocols approved by the Institutional Animal Care and Use Committee (IACUC).

[0257] Production of plasmid DNA for IVT. Because the Sap I restriction enzyme site for linearizing plasmid DNA for IVT is present in the luciferase gene, Mlu I restriction enzyme was chosen to linearize the plasmid DNA template. The plasmid DNA for NOV2m described in Example 1 was modified by adding a Mlu I restriction enzyme site immediately after the Sap I restriction enzyme site. The plasmid DNA for TCVm described in Example 11 was modified by adding a Mlu I restriction enzyme site immediately after the Sap I restriction enzyme site. The luciferase gene was cloned into the Nde I-Not I site of the multiple cloning site of these plasmid DNAs.

[0258] synRNAs were produced by in vitro transcription. DNA templates were linearized with Mlu I restriction enzyme and used for IVT to produce synRNAs: TCVm-LUC2 synRNA (Mlu I) and NOV2m-LUC2 synRNA (Mlu I). As a negative control, NOV2m-LUC2 synRNA was also linearized with Sap I, which cuts the LUC2 gene such that no LUC2 protein is formed (NOV2m-LUC2 synRNA (Sap I)). synRNAs were m1Ψ modified.

[0259] Intramuscular injection of synRNAs and luciferase assay. According to the manufacturer’s protocol, 20.0 pg of synRNA was complexed with Lipid Nanoparticles (LNP: InvivoFectamine 3.0, ThermoFisher). The synRNA / LNP complexes were injected directly into the muscle of the right thigh region of C57BL / 6 mice and BALB / c mice. The next day (day 1) and the following day (day 2), luciferase activity was monitored by an AMI HTX bioluminescence imaging system (Spectral Instruments Imaging, Tucson, AZ, USA). Results and conclusions

[0260] Representative bioluminescence images of the mouse luciferase assay are shown in FIG. 18A, and luciferase activity assessed by the bioluminescence imaging system is plotted in FIG. 18B. The results clearly show that TCVm-LUC2 (Mlul) is highly translated in vivo, even without the poly(A) tail. NOV2m-LUC2 (Mlul) also works, but with lower translation efficiency than TCVm-LUC2. These synRNAs without poly(A) are translatable in both C57BL / 6 and BALB / c. Example 15. EGFP protein expression from +ssRNA virus-based synRNAs containing a 5’-cap and a 3’-adenine homopolymer.

[0261] This example describes EGFP expression from +ssRNA virus-based synRNAs encoding EGFP (with a 5’-cap and a 3’-adenine homopolymer added). The synRNAs tested include: Control-EGFP synRNA, NOV2m-EGFP synRNA, TCVm-EGFP synRNA, and MNESVm-EGFP synRNA. Materials and methods

[0262] Cell culture. Newborn human dermal fibroblasts (HDFn) were purchased from ThermoFisher Scientific (Cat. No. C0045C) and cultured according to the manufacturer’s instructions.

[0263] DNA templates were generated by tail-PCR. DNA templates for in vitro transcription (IVT) were generated according to the protocol of Mandal and Rossi (2013). DNA fragments containing T7 promoter, 5’-UTR, EGFP CDS, and 3’-UTR were amplified from Control-EGFP, NOV2m-EGFP, TCVm-EGFP, and MNESVm-EGFP by tail-PCR using 3’-primers containing 0 (for A0), 20 (for A20), 30 (for A30), 60 (for A60), and 120 (for A120) thymidine (T) nucleotides. Control-EGFP synRNA containing the 3’-UTR of hemoglobin alpha adult chain 1 (Hba-a1) was as described in previous reports (Warren et al., 2010; Mandal and Rossi, 2013). The poly(A) tail of A120 is standard length (Warren et al., 2010). NOV2m-EGFP synRNA, TCVm-EGFP synRNA, and MNESVm-EGFP synRNA were as described in previous sections.

[0264] synRNAs were generated by in vitro transcription. IVT was performed using DNA templates to generate synRNAs. Based on the results presented above, NOV2m-EGFP and TCVm-EGFP are m1Ψ modified as they performed better compared to the unmodified version of the nucleosides. On the other hand, MNESVm-EGFP was used in the unmodified version of the nucleosides (Unm) as it performed better than the modified version of the nucleosides (m1Ψ) in the previously described experiments. A 5’-cap can be added to the synRNAs using standard methods. However, for convenience, CleanCap AG (Henderson 2021; Trilink) was used to add the 5’-cap (Cap 1 to synRNAs).

[0265] Control-EGFP synRNAs (A0, A20, A30, A60, A120), NOV2m-EGFP synRNAs (A0, A20, A30, A60, A120), TCVm-EGFP synRNAs (A0, A20, A30, A60, A120), and MNESVm-EGFP synRNAs (A0, A20, A30, A60, A120) were transfected into HDFn cells. On day -1, 3 x 10^4 HDFn cells / well were plated in 24-well plates. The following day, cells were transfected with 1.0 pg of synRNA using MessengerMax transfection reagent (ThermoFisher). Following synRNA transfection, HDFn cells were incubated at 33ºC or 37ºC for 24 hours with or without 250 ng / mL of B18R (Sigma).

[0266] EGFP expression. EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) on day 1 post-transfection. GFP positive (+) cells were presented as the percentage (%) of total cells with fluorescence intensity of GFP > 30 (all GFP+ cells), GFP > 300 (strong GFP+ cells), or GFP > 2000 (very strong GFP+ cells). Results and Conclusions

[0267] Control-EGFP synRNAs showed the expression pattern as expected. A0 and A20 showed no or very low translation (FIG. 19, FIG. 20, FIG. 21, FIG. 22). Starting from A30, to A60, and to A120, the translation efficiency gradually increased. The presence of temperature (33ºC or 37ºC) and B18R had little effect on the translation efficiency of control-EGFP synRNAs (FIG. 19, FIG. 20, FIG. 21, FIG. 22).

[0268] NOV2m synRNAs showed expression starting from A0. The translation efficiency was increased by adding A20 poly(A), and further increased by adding A30, A60, and A120. The presence of temperature (33ºC or 37ºC) and B18R had little effect on the translation efficiency of NOV2m synRNAs (FIG. 19, FIG. 20, FIG. 21, FIG. 22).

[0269] TCVm synRNAs showed strong expression starting from A0. However, the addition of A20 poly(A) decreased the translation efficiency from A0, and only by adding poly(A) longer than A30, the translation efficiency was increased to the level of A0. The presence of temperature (33ºC or 37ºC) and B18R had little effect on the translation efficiency of TCVm synRNAs (FIG. 19, FIG. 20, FIG. 21, FIG. 22).

[0270] MNESVm synRNA (Unm) showed strong expression from A0. However, the addition of A20 and A30 3'-poly(A) homopolymer decreased the translation efficiency from A0, and only by adding 3'-poly(A) homopolymer longer than A60, the translation efficiency increased to the level of A0. The temperature (33ºC or 37ºC) and the presence of B18R had little effect on the translation efficiency of MNESVm synRNA (Figures 19, 20, 21, 22).

[0271] Without the poly(A) tail, TCVm-EGFP synRNA (ml ) and MNESVm-EGFP synRNA (Unm) showed strong EGFP expression, followed by NOV2m-EGFP synRNA (ml ). Control-EGFP synRNA (ml ) showed no or very low EGFP expression. When the homopolymer of adenine was added, NOV2m-EGFP synRNA showed the best expression level under any length of 3'-poly(A) homopolymer (A20, A30, A60, A120) (Figures 19, 20, 21, 22). It is noteworthy that even with the standard A120 3'-poly(A) homopolymer length, NOV2m synRNA performed much better than the control synRNA, TCVm synRNA, and MNESVm synRNA. synRNAs are most commonly used under natural in vivo conditions (i.e., at 37ºC body temperature and in the absence of B18R). Under this condition, it is noteworthy that NOV2m synRNA with A20 and A30 showed equal or even stronger EGFP expression levels than the control synRNA containing the standard A120 3'-poly(A) homopolymer (Figures 19, 20, 21, 22), considering the short 3'-poly(A) homopolymer length required.

[0272] Accordingly, the present disclosure provides RNA molecules comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) of at least one protein, and a 3'- untranslated region (3'-UTR) and a subsequent short poly(A) homopolymer, wherein the 5'-UTR and the 3'-UTR are derived from a +ssRNA virus. These novel synRNAs containing a short poly(A) homopolymer can be used to express high levels of a protein of interest, while providing the advantage of manufacturing and purification by using an oligo(dT) column, if necessary. Example 16. Expression of full-length human dystrophin protein (DMD) from +ssRNA virus-based synRNA in vitro.

[0273] This example describes the successful expression of large protein DMD from +ssRNA virus-based synRNAs in vitro. Materials and Methods

[0274] Cell culture. Newborn human dermal fibroblasts (HDFn) were purchased from ThermoFisher Scientific (Cat. No. C0045C) and cultured according to the manufacturer’s instructions.

[0275] Plasmid DNA production. This example used a NOV2m synRNA with a 3’-adenine homopolymer of 28 residues (NOV2m-A28). To simplify the synRNA production process, 28 adenines were inserted immediately after the 3’-UTR of the NOV2m vector (depicted in FIG. 1C), followed by digestion with an Ndel restriction enzyme site to linearize the plasmid DNA. The full-length CDS of the human dystrophin protein (transcript variant Dp427m, NCBI Accession No. NM_004006) was cloned into the multiple cloning site of NOV2m-A28 (NOV2m-DMD-A28).

[0276] synRNA production by in vitro transcription. Plasmid DNA was linearized with Ndel and used for IVT to produce synRNA with mlY modification. CleanCap AG (Henderson 2021; Trilink) was used to add 5’-cap 1. The size of this NOV2m-DMD-A28 synRNA was 11.3 kb (FIG. 23A).

[0277] Transfection of NOV2m-DMD-A28 synRNA. 6 x 10^4 HDFn cells / well were plated in 4-well chamber slides. The next day, cells were transfected with 1.0 µg or 2.0 µg of NOV2m-DMD-A28 synRNA using MessengerMax transfection reagent (ThermoFisher). Following synRNA transfection, HDFn cells were incubated with 250 ng / mL of B18R (Sigma) for 24 hours at 37ºC.

[0278] Immunohistochemistry. Human DMD protein was detected by immunohistochemistry using an anti-dystrophin antibody (MANDYS 106: Millipore Sigma) that recognizes human DMD but not mouse DMD. Immunohistochemistry was performed according to standard methods. To visualize cell nuclei, samples were also stained with 4’,6-diamidino-2-phenylindole (DAPI). Results and Conclusions

[0279] Plasmid DNA containing the coding region of full-length DMD (transcript variant Dp427m, NCBI Accession No. NM_004006) and a 28-residue 3'-adenine homopolymer was successfully constructed. The plasmid DNA was amplified in E. coli following standard procedures. The plasmid DNA was linearized with Ndel restriction enzyme digestion and used directly as the DNA template for IVT. Unlike Example 15, which used tail-PCR to add the 3'-adenine homopolymer to the DNA template, the 28-adenine homopolymer has been incorporated into the plasmid DNA. Thus, the DNA template preparation is simpler, more efficient, and less costly compared to the tail-PCR method.

[0280] NOV2m-DMD-A28 synRNA (11.3 kb) was successfully produced by standard IVT methods. The nucleotide sequence of NOV2m-DMD-A28 synRNA is shown as SEQ ID NO: 42.

[0281] Upon delivery into HDFn cells by standard transfection methods, NOV2m-DMD-A28 synRNA produced DMD, which was detected by immunohistochemistry using an antibody against human DMD (MANDYS 106) (FIG. 23B). The transfection efficiency was high, and the DMD expression was strong (FIG. 23B).

[0282] Thus, the present disclosure demonstrates that large proteins (e.g., full-length human DMD) can be expressed from +ssRNA virus-based synRNAs in vitro. The present disclosure also demonstrates that the entire synRNA can be encoded in plasmid DNA, making the synRNA production process simple, efficient, and cost-effective. Example 17. Expression of full-length human dystrophin (DMD) from +ssRNA virus-based synRNA in vivo.

[0283] This example describes the successful expression of large protein DMD from +ssRNA virus-based synRNA in vivo. Materials and Methods

[0284] Mice. BALB / c mice were purchased from Jackson Laboratory and housed and handled according to protocols approved by the Institutional Animal Care and Use Committee (IACUC).

[0285] Production of plasmid DNA. This example used a NOV2msynRNA with a 3’- adenine homopolymer of 28 residues (NOV2m-A28). To simplify the synRNA production process, 28 adenines were inserted immediately after the 3’-UTR of the NOV2m vector (depicted in FIG. 1C), followed by digestion with Ndel restriction enzyme. DNA encoding a fusion protein of luciferase (LUC) and full-length human dystrophin protein (transcript variant Dp427m, NCBI Accession NM_004006) was cloned into the multiple cloning site of NOV2m-A28 (NOV2m-LUC-DMD-A28).

[0286] synRNA production by in vitro transcription. Plasmid DNA was linearized with Ndel and used for IVT to produce synRNA with mlΨ modification. A 5’-cap 1 was added using CleanCap AG (Henderson 2021; Trilink). The size of this NOV2m-LUC-DMD-A28 synRNA was 13.0 kb (FIG. 24A).

[0287] Intramuscular injection of synRNA and luciferase assay. 20.0 pg of NOV2m-LUC-DMD-A28 synRNA was complexed with Lipid Nanoparticles (LNP: InvivoFectamine 3.0, ThermoFisher) according to the manufacturer’s protocol. The synRNA / LNP complex was injected directly into the muscle of the right thigh region of BALB / c mice (day 0). The next day (day 1), luciferase activity was monitored by an AMI HTX bioluminescence imaging system (Spectral Instruments Imaging, Tucson, AZ, USA). Results and conclusions

[0288] Representative bioluminescence images of mice for visualization of luciferase activity are shown in FIG. 24B. Luciferase activity assessed by the bioluminescence imaging system is plotted in FIG. 24C. The results clearly show that the NOV2m-LUC-DMD-A28 synRNA was translated, resulting in the production of the fusion protein of LUC and full-length DMD in vivo.

[0289] The present disclosure demonstrates that large fusion proteins can be expressed from +ssRNA virus-based synRNAs in vivo. The present disclosure also demonstrates that entire synRNAs can be encoded in plasmid DNA, thereby making the synRNA production process simple, efficient, and cost-effective. Example 18. Expression of full-length human collagen type VII alpha-1 (VII) chain (COL7A1) protein from +ssRNA virus-based synRNAs in vitro.

[0290] This example describes the successful expression of large protein COL7A1 from +ssRNA virus-based synRNAs in vitro. Materials and Methods

[0291] Cell culture. Neonatal human dermal fibroblasts (HDFn) were purchased from ThermoFisher Scientific (Cat# C0045C) and cultured according to the manufacturer’s instructions.

[0292] Production of plasmid DNA. This example used NOV2m synRNA with a 3’-adenine homopolymer of 28 residues (NOV2m-A28). To simplify the synRNA production process, 28 adenines were inserted immediately after the 3’-UTR of the NOV2m vector (depicted in FIG. 1C), followed by digestion with an Ndel restriction enzyme site to linearize the plasmid DNA. The full-length CDS of the human collagen type VII alpha-1 (VII) chain (COL7A1) protein (NCBI Accession NM_000094) was cloned into the multiple cloning site of NOV2m-A28 (NOV2m-COL7A1-A28). A fusion protein of the full-length CDS of the COL7A1 protein (NCBI Accession NM_000094) and the luciferase (LUC2) protein was also cloned into the multiple cloning site of NOV2m-A28 (NOV2m-COL7A1-LUC-A28).

[0293] Production of synRNAs by in vitro transcription. Plasmid DNA was linearized with Ndel and used for IVT to produce synRNAs with mlΨ modification. CleanCap AG (Henderson 2021; Trilink) was used to add 5’-caps 1. The size of the NOV2m-DMD-A28 synRNA was 9.0 kb, and the size of NOV2m-COL7A1-LUC-A28 was 10.7 kb (FIG. 25A).

[0294] Transfection of NOV2m-COL7A1-A28 and NOV2m-COL7A1-LUC-A28 synRNAs. 6 x 10^4 HDFn cells / well were plated in 4-well chamber slides. The next day, cells were transfected with 1.0 µg of NOV2m-COL7A1-A28 synRNA or NOV2m-COL7A1-LUC-A28 synRNA using MessengerMax transfection reagent (ThermoFisher). In one condition, transfection was performed only once (1x transfection). In the other condition, transfection was repeated on days 2 and 3 (3x transfection). HDFn cells were incubated at 37°C with 250 ng / mL of B18R (Sigma) for 24 hours after synRNA transfection (1x transfection) or 24 hours after the third synRNA transfection (3x transfection).

[0295] Immunohistochemistry. Human COL7A1 protein expression was detected by immunohistochemistry using an anti-COL7A1 antibody (MCA597GA) that recognizes only human COL7A1 but not mouse COL7A1. Immunohistochemistry was performed according to standard methods. To visualize cell nuclei, samples were also stained with 4',6-diamidino-2-phenylindole (DAPI). Results and Conclusions

[0296] A plasmid DNA containing the full-length CDS of human type VII collagen α-1 (VII) chain (COL7A1) protein (NCBI accession number NM_000094) and a 28-residue 3'-adenine homopolymer was successfully constructed. The plasmid DNA was amplified in Escherichia coli using standard procedures. The plasmid DNA was linearized by digestion with the NdeI restriction enzyme and used directly as an IVT DNA template. Unlike Example 15, which used tail-PCR to add a 3'-adenine homopolymer to the DNA template, a 28-residue adenine homopolymer was incorporated into the plasmid DNA. Therefore, DNA template preparation is simpler, more efficient, and less costly than with tail-PCR.

[0297] Both NOV2m-COL7A1-A28 synRNA (9.0 kb) and NOV2m-COL7A1-LUC-A28 synRNA (10.7 kb) were successfully generated.

[0298] Both NOV2m-COL7A1-A28 synRNAs and NOV2m-COL7A1-LUC-A28 synRNAs produced COL7A1 protein and COL7A1-LUC fusion protein, respectively, after delivery into HDFn cells by standard transfection methods, as detected by immunohistochemistry using an antibody against human COL7A1 (Figure 25B). Transfection efficiency was high, and DMD expression was strong (Figure 25B).

[0299] Accordingly, the present disclosure demonstrates that large proteins (e.g., full-length human COL7A1) and even larger fusion proteins can be expressed in vitro from +ssRNA virus-based synRNA vectors. The present disclosure also demonstrates that entire synRNAs can be encoded in plasmid DNA, making the synRNA production process simple, efficient, and cost-effective. Example 19. EGFP protein expression from DENVm synRNAs containing 5'-cap and 3'-adenine homopolymer.

[0300] This example describes EGFP expression from DENVm synRNAs encoding EGFP (with 5'-cap and 3'-adenine homopolymer added). Materials and Methods

[0301] Cell culture. Neonatal human dermal fibroblasts (HDFn) were purchased from ThermoFisher Scientific (cat. no. C0045C) and cultured according to the manufacturer’s instructions.

[0302] DNA templates were generated by tail-PCR. DNA templates for in vitro transcription (IVT) were generated according to the protocol of Mandal and Rossi (2013). DNA fragments containing T7 promoter, 5'-UTR, EGFP CDS, and 3'-UTR were amplified from DENVm-EGFP by tail-PCR using 3'-primers containing 0 (for AO), 20 (for A20), 30 (for A30), 60 (for A60), and 120 (for A120) thymidine (T) nucleotides. DENVm-EGFP synRNAs were as described in the previous section.

[0303] SynRNAs were generated by in vitro transcription. IVT was performed using DNA templates to generate synRNAs.

[0304] Based on the results presented above, DENVm-EGFP synRNAs were used in their nucleoside-unmodified form (Unm). A 5'-cap was added to the synRNAs using standard methods. However, for convenience, CleanCap AG (Henderson 2021; Trilink) was used to add the 5'-cap (Cap 1 to the synRNAs).

[0305] DENVm-EGFP synRNAs (A0, A20, A30, A60, A120) were transfected into HDFn cells. On day -1, 3 x 10^4 HDFn cells / well were plated in 24-well plates. The following day, cells were transfected with 1.0 pg of synRNA using MessengerMax transfection reagent (ThermoFisher). Following synRNA transfection, HDFn cells were incubated at 33ºC or 37ºC for 24 hours with or without 250 ng / mL of B18R (Sigma).

[0306] EGFP expression. EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) on day 1 post-transfection. GFP positive (+) cells were presented as the percentage (%) of total cells with fluorescence intensity of GFP > 30 (all GFP+ cells), GFP > 300 (strong GFP+ cells), or GFP > 2000 (very strong GFP+ cells). Results and conclusions

[0307] DENVm synRNAs in their nucleoside-unmodified form (Umn) showed expression in vitro starting with A0. Translation efficiency was increased by adding A20 poly(A), and further increased by adding A30, A60, and A120. The presence of temperature (33ºC or 37ºC) or B18R did not have a very large impact on the translation efficiency of DENVm synRNAs (Unm) (Figure 26).

[0308] Accordingly, the present disclosure provides RNA molecules comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) of at least one protein, and a 3'- untranslated region (3'-UTR) and subsequently a short adenine homopolymer, wherein the 5'-UTR and the 3'-UTR are derived from a Dengue virus. Although Dengue viruses do not naturally have a poly-A at their 3' end, the current findings show that these novel synRNAs containing a short adenine homopolymer can be used to express high levels of a protein of interest, while providing advantages in manufacturing and purification by using an oligo(dT) column, if necessary. Example 20. EGFP protein expression from synRNAs with 5'-cap, 3'-poly(A) and 5'- and 3'-UTRs derived from SARS-CoV-2 virus.

[0309] This example describes EGFP expression from SARS-CoV-2 virus-based synRNAs encoding EGFP. Materials and Methods

[0310] Cell culture. Neonatal human dermal fibroblasts (HDFn) were purchased from ThermoFisher Scientific (Cat. No. C0045C) and cultured according to the manufacturer’s instructions.

[0311] Generation of DNA templates. Plasmid DNA containing a T7 promoter, 5'-UTR (from SARS-CoV-2), MCS, 3'-UTR (from SARS-CoV-2) and a 50-adenine homopolymer at the 3' end (Figure 27A) was synthesized. The EGFP coding region (SEQ ID NO: 5) was cloned into the MCS (SEQ ID NO: 8).

[0312] Generation of synRNAs by in vitro transcription. IVT was performed using the DNA templates to generate synRNAs named SARSVm. The nucleotide sequence of the 5' UTR of SARSVm is shown in SEQ ID NO: 37 and the nucleotide sequence of the 3'-UTR and adenine homopolymer is shown in SEQ ID NO: 38. Both unmodified in nucleosides synRNA (Unm) and modified in nucleosides synRNA (mlY) were synthesized and tested. A 5'-cap was added to the synRNAs using standard methods. However, for convenience, a 5'-cap was added using CleanCap AU (Henderson 2021; Trilink) (Cap 1 added to synRNA).

[0313] Transfection of SARSVm-EGFP into HDFn cells. On day -1, 3 x 10^4 HDFn cells / well were plated in a 24-well plate. The following day (day 0), cells were transfected with 1.0 µg of synRNA using the MessengerMax transfection reagent (ThermoFisher). Following synRNA transfection, HDFn cells were incubated at 33ºC or 37ºC for 24 hours with or without 250 ng / mL of B18R (Sigma).

[0314] EGFP expression. EGFP expression levels (fluorescence intensity) were measured by Moxi GO II (ORFLO) at day 1 post-transfection. GFP positive (+) cells were presented as the percentage (%) of total cells with fluorescence intensity of GFP > 30 (all GFP+ cells), GFP > 300 (strong GFP+ cells), or GFP > 2000 (very strong GFP+ cells). Results and conclusions

[0315] SARSVm synRNA in the nucleoside-modified form (mlY) showed strong expression under both temperature conditions (33ºC or 37ºC) and under both B18R (+) and B18R (-) conditions (Figure 27B). However, under the nucleoside-unmodified form (Unm), protein translation efficiency was low under all four conditions [33ºC or 37ºC; B18R (+) or B18R (-)] (Figure 27B).

[0316] Accordingly, the present disclosure provides an RNA molecule comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) of at least one protein, and a 3'- untranslated region (3'-UTR) followed by a short adenine homopolymer, wherein the 5'-UTR and the 3'-UTR are derived from a +ssRNA virus (naturally having an adenine homopolymer at its 3' end). Example 21. In vivo protein expression from NOV2m (A50), NOV2m (A30), DENVm (A50), and DENVm (A30) in muscle and skin.

[0317] This example describes the finding that +ssRNA virus-based synRNAs with a short adenine homopolymer can be efficiently translated in mouse muscle and skin. Materials and methods

[0318] Mice. BALB / c mice were purchased from Jackson Laboratory and housed and handled according to protocols approved by the Institutional Animal Care and Use Committee (IACUC).

[0319] Generation of plasmid DNA for IVT. NOV2m plasmid DNA was modified to contain a homopolymer of 50 adenines followed by a 3'-UTR and a subsequent Ndel restriction enzyme site for plasmid linearization. DENVm plasmid DNA was modified to contain a homopolymer of 50 adenines followed by a 3'-UTR and a subsequent Ndel restriction enzyme site for plasmid linearization. The luciferase gene was cloned into the MCS of both plasmid vectors.

[0320] synRNAs were generated by in vitro transcription. DNA templates were linearized with Ndel restriction enzyme and used for IVT to generate synRNAs: NOV2m(A50)-LUC synRNA and DENVm(A50)-LUC. Both unmodified synRNAs (Unm) and modified synRNAs (ml ) were synthesized and tested. 5’-caps were added to synRNAs using standard methods. However, for convenience, 5’-caps were added using CleanCap AG (Henderson 2021; Trilink) (Cap 1 added to synRNAs).

[0321] Intramuscular injection of synRNAs and luciferase assay. 20.0 pg of synRNA was complexed with Lipid Nanoparticles (LNP: InvivoFectamine 3.0, ThermoFisher) according to the manufacturer’s protocol. synRNA / LNP complexes were injected directly into the muscle of BALB / c mice. Luciferase activity was monitored by an AMI HTX bioluminescence imaging system (Spectral Instruments Imaging, Tucson, AZ, USA) starting the next day (day 1). Monitoring of luciferase activity was stopped when no signal could be detected anymore on day 8.

[0322] Intradermal injection of synRNAs and luciferase assay. 20.0 pg of synRNA was dissolved in lactated Ringer’s solution. To test the effect of chitosan oligosaccharides on gene expression, synRNA was mixed with or without chitosan oligosaccharides (1.5 pg / ml final concentration). The final volume was 60 mI. Luciferase activity was monitored by an AMI HTX bioluminescence imaging system (Spectral Instruments Imaging, Tucson, AZ, USA) starting the next day (day 1). Monitoring of luciferase activity was stopped when no signal could be detected anymore on day 13. Results and conclusions

[0323] Muscle: Luciferase activity as a result of intramuscular injection of synRNAs was evaluated by a bioluminescence imaging system and the results are plotted in Figure 28. The results show that all NOV2m(A50), NOV2m(A30), DENVm(A50) and DENVm(A30) were translated at high levels in vivo. Although the differences are small, the homopolymer of 50 adenines was more effective than the homopolymer of 30 adenines. Nucleoside modifications helped to increase the translation efficiency of NOV2m but not DENVm in muscle. Overall, modified or unmodified DENVm(A50) performed better than NOV2m(A50).

[0324] Skin: Luciferase activity as a result of intradermal injection of synRNAs was evaluated by a bioluminescence imaging system and the results are plotted in Figure 29. The results show that all NOV2m (A50), NOV2m (A30), DENVm (A50), and DENVm (A30) were translated at high levels in vivo. However, for both NOV2m and DENVm, the effect of the 50-mer of adenines was better than the 30-mer of adenines. Nucleoside modification did not make much difference, but for NOV2m, the modified synRNA was more effective than the unmodified synRNA, while for DENVm, the unmodified synRNA was more effective than the modified synRNA. Interestingly, the chitosan oligosaccharide significantly enhanced luciferase expression under all tested conditions: NOV2m (mlΨ), NOV2m (Unm), DENVm (mlΨ), and DENVm (Unm). Overall, NOV2m (A50, mlΨ) was more effective than the others, but DENVm (A50, Unm) performed at a comparable level. Example 22. Expression of full-length human dystrophin protein (DMD) from +ssRNA virus-based synRNAs in vivo.

[0325] This example describes the successful expression of a large protein, full-length human dystrophin protein, from +ssRNA virus-based synRNAs in vivo. Materials and Methods

[0326] Mice: BALB / c mice were purchased from Jackson Laboratory and housed and handled according to protocols approved by the Institutional Animal Care and Use Committee (IACUC).

[0327] Generation of plasmid DNA. This example used a NOV2m synRNA with a 3'- adenine 28-mer (NOV2m-A28). To simplify the synRNA production process, 28 adenines were inserted immediately after the 3'-UTR of the NOV2m vector (depicted in Figure 1C), followed by digestion with an Ndel restriction enzyme site to linearize the plasmid DNA. The full-length CDS of the human dystrophin protein (DMD) gene (transcript variant Dp427m, NCBI Accession Number NM_004006) was cloned into the multiple cloning site of NOV2m-A28 (NOV2m-DMD-A28).

[0328] SynRNA was generated by in vitro transcription. Plasmid DNA was linearized with NdeI and used for IVT to generate synRNA with an m1Ψ modification. A 5'-cap was added using CleanCapAG (Henderson 2021; Trilink). The size of the NOV2m-DMD-A28 synRNA was 11.3 kb (Figure 23A).

[0329] Intramuscular injection of synRNA. 20.0 µg of NOV2m-DMD-A28 synRNA was complexed with InvivoFectamine 3.0 (ThermoFisher) according to the manufacturer's protocol. The synRNA / Invivofectamine complex was injected directly into the muscles of BALB / c mice (day 0). One day after injection, the mice were sacrificed, and the skeletal muscle at the injection site was dissected for immunostaining.

[0330] Immunohistochemistry. Human DMD protein was detected by immunohistochemistry using an anti-dystrophin antibody (MANDYS106: Millipore Sigma) that recognizes only human DMD but not mouse DMD. Mouse and human DMD proteins were detected by immunohistochemistry using an anti-dystrophin antibody (AB15277: Abcam) that recognizes both mouse and human DMD. Immunohistochemistry was performed according to standard methods. To visualize cell nuclei, samples were also stained with 4',6-diamidino-2-phenylindole (DAPI). Confocal microscopy images were obtained. Results and Conclusions

[0331] Representative immunostaining images are shown in Figure 31. Muscle sections were stained with an anti-human DMD antibody (MANDYS106), which does not recognize mouse dystrophin but does recognize human dystrophin (top panel). Untreated muscle showed no staining, but muscle injected with NOV2m-DMD-A28 synRNA (two representative images) demonstrated the production and correct localization of human dystrophin (top panel). Furthermore, muscle sections stained with an anti-mouse DMD antibody (AB15277), which recognizes both mouse and human dystrophin, demonstrated correct localization of mouse (and human) dystrophin proteins in both untreated and NOV2m-DMD-A28 synRNA-injected muscle (bottom panel).

[0332] This disclosure demonstrates that large proteins (such as full-length human dystrophin) can be expressed in vivo from synRNA based on a +ssRNA virus. The resulting dystrophin can be correctly localized in mouse skeletal muscle. Example 23. Restoration of muscle strength in mutant mice by intramuscular injection of +ssRNA virus-based synRNA encoding human dystrophin.

[0333] This example describes the successful restoration of skeletal muscle function in mutant mice lacking mouse dystrophin by intramuscular injection of +ssRNA virus-based synRNA encoding full-length human dystrophin. Materials and Methods

[0334] Mice: D2.mdx mice, also known as D2.B10-Dmd mdx / J mice, purchased from Jackson Laboratory. According to the Jackson Laboratory website, “D2.B10 (DBA / 2- congenic) Dmd mdx D2.mdx mice (also known as DBA / 2J-mdx or D2-mdx mice) can be an excellent model of Duchenne muscular dystrophy as it recapitulates several human features of DMD muscle pathology (lower hindlimb muscle weight, fewer muscle fibers, increased fibrosis and fat accumulation, and muscle weakness) better than strains with this mutant allele in other genetic backgrounds”. DBA / 2 mice (wild-type control, recommended by Jackson Laboratory) were also purchased from Jackson Laboratory. Mice were housed and handled according to protocols approved by the Institutional Animal Care and Use Committee (IACUC).

[0335] Production of plasmid DNA. This example used a NOV2m synRNA with a 3’-adenine homopolymer of 28 residues (NOV2m-A28). To simplify the synRNA production process, 28 adenines were inserted immediately after the 3’-UTR of the NOV2m vector (depicted in Figure 1C), followed by digestion with an Ndel restriction enzyme site to linearize the plasmid DNA. The full-length CDS of the human dystrophin (DMD) gene (transcript variant Dp427m, NCBI Accession Number NM_004006) was cloned into the multiple cloning site of NOV2m-A28 (NOV2m-DMD-A28).

[0336] synRNA production by in vitro transcription. Plasmid DNA was linearized with Ndel and used for IVT to produce synRNA with ml Ψ modification. A 5’-cap 1 was added using CleanCap AG (Henderson 2021; Trilink). The size of this NOV2m-DMD-A28 synRNA was 11.3 kb (Figure 23A).

[0337] Intramuscular injection of synRNA. 20.0 pg of NOV2m-DMD-A28 synRNA was complexed with InvivoFectamine 3.0 (ThermoFisher) according to the manufacturer’s protocol. D2.mdx mutant mice received approximately 4 pg (12 pL) of NOV2m-DMD-A28 synRNA in 3 intramuscular injections in the ventral forelimb and 2 intramuscular injections in the dorsal forelimb using a 31G needle: 20 pg (60 pL) total in the right and left forelimb each.

[0338] Muscle strength measurement: Peak muscle strength of the forelimb was measured by a grip strength meter (Harvard apparatus). Measurements were taken twice, 30 minutes apart. Peak muscle strength was normalized to mouse body weight and the average of the two measurements was used for analysis. Results and conclusions

[0339] D2.mdx mutant mice (Coley, Bogdanik et al. 2016; Hammers, Hart et al. 2020) and wild-type DBA / 2 mice received approximately 4 pg (12 pL) of NOV2m-DMD-A28 synRNA in 3 intramuscular injections in the ventral forelimb and 2 intramuscular injections in the dorsal forelimb using a 31G needle: 20 pg (60 pL) total in the right and left forelimb each. Injections started at week 11 and were given once a week for a total of 6 injections. The final injection was at 16 weeks of age. One week after the final injection (measured at 17 weeks of age), peak muscle strength of the forelimb was measured by a grip strength meter. Measurements were taken twice, 30 minutes apart. Peak muscle strength was normalized to mouse body weight and the average of the two measurements was used for analysis. Figure 32A shows peak muscle strength one week after the final injection (measured at 17 weeks of age). The NOV2m-DMD-A28 synRNA injected group showed statistically significant (* p < 0.05) muscle strength recovery compared to the non-injected group (D2.mdx) and the control mRNA-LUC injected group (D2.mdx-LUC). There was no statistically significant difference between the D2.mdx-DMD group and the wild-type DBA / 2 group. There were no safety findings related to injection or treatment for the NOV2m-DMD-A28 synRNA injected group.

[0340] We also tested whether a single intramuscular injection of NOV2m-DMD-A28 synRNA could restore muscle strength in D2.mdx mutant mice. To minimize damage to muscle tissue by the 31G needle (0.261 mm outer diameter), we used a 34G needle (0.159 mm outer diameter). 20 pg of NOV2m-DMD-A28 synRNA was mixed with Invivofactamine (ThermoFisher) in a total volume of 60 pL. Using a 34G needle, D2.mdx mutant mice received a single intramuscular injection of 4 pg (12 pL) of mRNA-DMD in 3 sites in the ventral forelimbs and 2 sites in the dorsal forelimbs: 20 pg (60 pL) total in each of the right and left forelimbs. The injections were performed at 18 weeks of age. Three weeks later, at 21 weeks of age, peak muscle strength of the forelimbs was measured by a grip strength meter (Harvard apparatus). Measurements were taken twice, 30 minutes apart. Peak muscle strength was normalized to mouse body weight and the average of the two measurements was used for analysis.

[0341] As shown in Figure 32B, the NOV2m-DMD-A28 synRNA injected group (n = 5) showed muscle strength recovery, while the non-injected control group (n = 4) did not show muscle strength recovery. This indicates that a single NOV2m-DMD-A28 synRNA injection not only restored muscle strength in D2.mdx mutant mice, but also that the dystrophin produced was stable in the injection site and remained for at least 3 weeks. References Ball et al., (1992). Replication of Nodamura Virus after Transfection of Viral RNA into Mammalian Cells in Culture..Journal Of Virology, 66(4):2326-2334. Coley et al., (2016). Effect of genetic background on the dystrophic phenotype in mdx mice. Human Molecular Genetics, 25(1): 130-145. Dorrington et al., (2009). ICTV Virus Taxonomy Profile: Tetraviridae. Fang et al., (2022). Advances in COVID-19 mRNA vaccine development.Signal Transduction and Targeted Therapy, 7(1):94. Hammers et al., (2020). The D2.mdx mouse as a preclinical model ofthe skeletal muscle pathology associated with Duchenne muscular dystrophy.Scientific Reports, 10:14070. Henderson et al., (2021). Cap 1 Messenger RNA Synthesis with Co-transcriptional CleanCap® Analog by In Vitro Transcription. CurrentProtocols, 1(2):e39. Holtkamp et al., (2006). Modification of antigen-encoding RNAincreases stability, translational efficacy, and T-cell stimulatory capacityof dendritic cells. Blood, 108(13): 4009–4017. Jackson et al., (2020). The promise of mRNA vaccines: a biotech andindustrial perspective. npj Vaccines, 5(1). Johnson et al., (2003). Recovery of infectivity from cDNA clones ofNodamura virus and identification of small nonstructural proteins. Virology,305(2): 436–451. Kinney et al., (1997). Construction of infectious cDNA clones for dengue 2 virus: strain 16681 and its attenuated vaccine derivative, strain pdk-53. Virology, 230(2):300-308. Kowalski et al., (2019). Delivering the Messenger: Advances in Technologies for Therapeutic mRNA Delivery. Molecular Therapy, 27(4): 710-728. Mandal and Rossi (2013). Reprogramming human fibroblasts to pluripotency using modified mRNA." Nat Protoc 8(3): 568-582. Mazeaud et al., (2018). The multiples fates of the flavivirus RNA genome during pathogenesis. Front Genet. 9:595. Mencin et al., (2023). Development and scale-up of oligo-dt monolithic chromatographic column for RNA capture through understanding of base-pairing interactions. Separation and purification technology 2023 vol. 304. Newman and Brown, (1976). Absence of poly (A) from the infective RNA of Nodamura virus. Journal of General Virology, 30(1): 137-140. Nicholson and Pasquinelli, (2019). Tales of Detailed Poly(A) Tails. Trends in Cell Biology, 29(3): 191-200. Nicholson and White (2011). 3’ cap-independent translation enhancers of positive-strand RNA plant viruses. Curr Opin Virol. 1(5):373-80. Reuter and Mathews (2010). RNAstructure: software for RNA secondary structure prediction and analysis. BMC Bioinformatics 11:129. Rosskopf et al., (2010). A 3’ terminal stem-loop structure in Nodamura virus RNA2 forms an essential cis-acting signal for RNA replication. Virus Research, 150(1-2): 12-21. Sachs et al., (1987). A single domain of yeast poly(A)-binding protein is necessary and sufficient for RNA binding and cell viability. Mol Cell Biol, 7(9): 3268-76. Sahul et al., (2019). ICTV virus taxonomy profile: Nodaviridae. Journal of General Virology, 100(1): 3-4. Simmonds et al., (2017): ICTV Virus Taxonomy Profile: Flaviviridae, Journal of General Virology, 98:2-3. Trepotec et al., (2019). Segmented poly(A) tails significantly reduce recombination of plasmid DNA without affecting mRNA translation efficiency or half-life. RNA, 25(4): 507-518. Vavilis et al. (2023). mRNA in the context of protein replacement therapy. Pharmaceutics. 15(1): 166.Wadhwa et al., (2020). Opportunities and challenges in the delivery of mRNA-based vaccines. Pharmaceutics, 12(2). Warren et al., (2010). Highly Efficient Reprogramming to Pluripotency and Directed Differentiation of Human Cells with Synthetic Modified mRNA. Cell Stem Cell, 7(5): 618-630. Sequence >SEQ ID NO: 1 (NOV1-EGFP RNA) GUAUUGAAUCCAAAACUCAAA AUGGUGAGCAAGGGCGAGGAGCUGUUCACCGGGGUGGUGCCCAUCCUGGUCGAGCUGGACGGCGACGUAAACGGCCACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACCCUCGUGACCACCCUGACCUACGGCGUGCAGUGCUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAAGGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUGGUGAACCGCAUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCCUGGGGCACAAGCUGGAGUACAACUACAACAGCCACAACGUCUAUAUCAUGGCCGACAAGCAGAAGAACGGCAUCAAGGUGAACUUCAAGAUCCGCCACAACAUCGAGGACGGCAGCGUGCAGCUCGCCGACCACUACCAGCAGAACACCCCCAUCGGCGACGGCCCCGUGCUGCUGCCCGACAACCACUACCUGAGCACCCAGUCCGCCCUGAGCAAAGACCCCAACGAGAAGCGCGAUCACAUGGUCCUGCUGGAGUUCGUGACCGCCGCCGGGAUCACUCUCGGCAUGGACGAGCUGUACAAGUGA UUCAUCGUCCCAUCUGACGAAACCCGAACUAGGCUUAUGCCAGUGGU >SEQ ID NO:2 (NOV2-EGFP RNA) GUAAACAACCAAUAACAUC AUGGUGAGCAAGGGCGAGGAGCUGUUCACCGGGGUGGUGCCCAUCCUGGUCGAGCUGGACGGCGACGUAAACGGCCACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACCCUCGUGACCACCCUGACCUACGGCGUGCAGUGCUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAAGGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUGGUGAACCGCAUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCCUGGGGCACAAGCUGGAGUACAACUACAACAGCCACAACGUCUAUAUCAUGGCCGACAAGCAGAAGAACGGCAUCAAGGUGAACUUCAAGAUCCGCCACAACAUCGAGGACGGCAGCGUGCAGCUCGCCGACCACUACCAGCAGAACACCCCCAUCGGCGACGGCCCCGUGCUGCUGCCCGACAACCACUACCUGAGCACCCAGUCCGCCCUGAGCAAAGACCCCAACGAGAAGCGCGAUCACAUGGUCCUGCUGGAGUUCGUGACCGCCGCCGGGAUCACUCUCGGCAUGGACGAGCUGUACAAGUGA UUCCACCCACAGAAGCGUUGACGACGCAAAACGUCCUUAAAGCGUUGACGACGCAAAACGUCCCCAAGCUCGUAGCACCGACCCUAUACCCAUCUCUAGGGUCUUCAACCUCUUGGU >SEQ ID NO:3 (NOV2M RNA, multicloning site) GUAAACAACCAAUAACAUC GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC UUCCACCCACAGAAGCGUUGACGACGCAAAACGUCCUUAAAGCGUUGACGACGCAAAACGUCCCCAAGCUCGUAGCACCGACCCUAUACCCAUCUCUAGGGUCUUCAACCUCUUGGU >SEQ ID NO: 4 (NOV2M-EGFP RNA) GUAAACAACCAAUAACAUC GGCGCGCCCUCAGCAUCGAUUGAAUUGGCCACC AUGGUGAGCAAGGGCGAGGAGCUGUUCACCGGGGUGGUGCCCAUCCUGGUCGAGCUGGACGGCGACGUAAACGGCCACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACCCUCGUGACCACCCUGACCUACGGCGUGCAGUGCUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAAGGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUGGUGAACCGCAUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCCUGGGGCACAAGCUGGAGUACAACUACAACAGCCACAACGUCUAUAUCAUGGCCGACAAGCAGAAGAACGGCAUCAAGGUGAACUUCAAGAUCCGCCACAACAUCGAGGACGGCAGCGUGCAGCUCGCCGACCACUACCAGCAGAACACCCCCAUCGGCGACGGCCCCGUGCUGCUGCCCGACAACCACUACCUGAGCACCCAGUCCGCCCUGAGCAAAGACCCCAACGAGAAGCGCGAUCACAUGGUCCUGCUGGAGUUCGUGACCGCCGCCGGGAUCACUCUCGGCAUGGACGAGCUGUACAAGUAG UCUAGAGucgACCCGGGCGGCCGC UUCCACCCACAGAAGCGUUGACGACGCAAAACGUCCUUAAAGCGUUGACGACGCAAAACGUCCCCAAGCUCGUAGCACCGACCCUAUACCCAUCUCUAGGGUCUUCAACCUCUUGGU >SEQ ID NO:5 (EGFP RNA) AUGGUGAGCAAGGGCGAGGAGCUGUUCACCGGGGUGGUGCCCAUCCUGGUCGAGCUGGACGGCGACGUAAACGGCCACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACCCUCGUGACCACCCUGACCUACGGCGUGCAGUGCUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAAGGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUGGUGAACCGCAUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCCUGGGGCACAAGCUGGAGUACAACUACAACAGCCACAACGUCUAUAUCAUGGCCGACAAGCAGAAGAACGGCAUCAAGGUGAACUUCAAGAUCCGCCACAACAUCGAGGACGGCAGCGUGCAGCUCGCCGACCACUACCAGCAGAACACCCCCAUCGGCGACGGCCCCGUGCUGCUGCCCGACAACCACUACCUGAGCACCCAGUCCGCCCUGAGCAAAGACCCCAACGAGAAGCGCGAUCACAUGGUCCUGCUGGAGUUCGUGACCGCCGCCGGGAUCACUCUCGGCAUGGACGAGCUGUACAAGUGA >SEQ ID NO:6 (NOV15' -UTR) GUAUUGAAUCCAAAACUCAAA >SEQ ID NO:7(NOV1 3′-UTR) UUCUCUCCCAUGAAACCCGAWATERAGGGCUUAUGCCAGUGGU >SEQ ID NO:8(MCS RNA) GGCGCGCCCUCAGCAUCGAUUCAUGGGCCGGCCGCGGCCGC >SEQ ID NO:9(NOV2-5'UTR) GUAACAACCAAUAACAUC >SEQ ID NO:10(NOV2-3'UTR) UUCCACCCACAGAGCGUUGACGCAAACGCUUAAAAGCGUUGACGACGCAAAACGUCCAAGCGUAGCACCCACCAUACCCAUCUCUAGGCUACCUCUUGGU >SEQ ID NO:11 (DENVM RNA, photo) AGUUGUUAGUAGUAGUACGUGGACCAGCAACCUUUUGAGGGAGCUAACCUUUUUUAAUUUAGAGAGAGAGACAACCCCUUUCCAAUAUUCCUG GGCGCGCCCUCAGCAUCGAUUCAUGGGCCGGCCGCGGCCGC AAAGCAAAACUAACAUGAAACAAGGCUAGAAGUCAGGUCGGAUUAAGCCAUAGUACGGAAAAAACUAUGCUACCUGUGAGCCCCGUCCAAGGACGUUAAAAGAAGUCAGGCCAUCAUAAAUGCCAUAGCUUGAGUAAACUAUGCAGCCUGUAGCUCCACCUGAGAAGGUGUAAAAAAUCCGGGAGGCCACAAACCAUGGAAGCUGUACGCAUGGCGUAGUGGACUAGCGGUUAGAGGAGACCCCUCCCUUACAAAUCGCAGCAACAAUGGGGGCCCAAGGCGAGAUGAAGCUGUAGUCUCGCUGGAAGGACUAGAGGUUAGAGGAGACCCCCCCGAAACAAAAAACAGGAUAUUGACGCUGGGAAACACCAGAGAUCCUGCUGUCUCCUCAGCAUCAUUCCAGGCACAGAACGCCAGAAAAUGGAAUGGUGCUGUUGAAUCAACAGGUUCU >SEQ ID NO: 12 (uncapped-DENVM RNA, multiple cloning site) GGUUGUUAGUCUACGUGGACCGACAAAGACAGAUUCUUUGAGGGAGCUAAGCUCAACGUAGUUCUAACAGUUUUUUAAUUAGAGAGCAGAUCUCUGAUCAAUAACCAACGGAAAAAGGCGAAAAACACGCCUUUCAAUAUCCUG GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC AAAGCAAAACUAACAUGAAACAAGGCUAGAAGUCAGGUCGGAUUAAGCCAUAGUACGGAAAAAACUAUGCUACCUGUGAGCCCCGUCCAAGGACGUUAAAAGAAGUCAGGCCAUCAUAAAUGCCAUAGCUUGAGUAAACUAUGCAGCCUGUAGCUCCACCUGAGAAGGUGUAAAAAAUCCGGGAGGCCACAAACCAUGGAAGCUGUACGCAUGGCGUAGUGGACUAGCGGUUAGAGGAGACCCCUCCCUUACAAAUCGCAGCAACAAUGGGGGCCCAAGGCGAGAUGAAGCUGUAGUCUCGCUGGAAGGACUAGAGGUUAGAGGAGACCCCCCCGAAACAAAAAACAGGAUAUUGACGCUGGGAAACACCAGAGAUCCUGCUGUCUCCUCAGCAUCAUUCCAGGCACAGAACGCCAGAAAAUGGAAUGGUGCUGUUGAAUCAACAGGUUCU >SEQ ID NO: 13 (BYDVM RNA, multiple cloning site) GGUGAAGAUUGACCAUCUCACAAAAGCUGUUACGUGCUUGUAACACACUACGCGCCCGUUUUGUAUUCGGGAAGUAGUUGCGAAAACGGUCCCCUUAUUGCCUGACAAGCUAAGGGCCACCCUUCUUUCCCCACCGCCAUC GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC GUCUUAGCAAGCUCUGAGCCAGGAGAUGGACAUAAACCAUAGCAAUCCAACGUGUAACCGCAAUGGGGCAAACAACAGGUGAACCGUGUCCACGGGCCUGGUUACCGAAAGGAAAGCCAGUAUCCAACACAGCAAUGUGUUGGGGGUCACACCUUCGGGGUACUCUUAACGCUGACACUCGAAAGAGCAGUUCGGCAACCC >SEQ ID NO: 14 (No Cap-BYDVM RNA, multiple cloning site) GGUGAAGAUUGACCAUCUCACAAAAGCUGUUACGUGCUUGUAACACACUACGCGCCCGUUUUGUAUUCGGGAAGUAGUUGCGAAAACGGUCCCCUUAUUGCCUGACAAGCUAAGGGCCACCCUUCUUUCCCCACCGCCAUC GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC GUCUUAGCAAGCUCUGAGCCAGGAGAUGGACAUAAACCAUAGCAAUCCAACGUGUAACCGCAAUGGGGCAAACAACAGGUGAACCGUGUCCACGGGCCUGGUUACCGAAAGGAAAGCCAGUAUCCAACACAGCAAUGUGUUGGGGGUCACACCUUCGGGGUACUCUUAACGCUGACACUCGAAAGAGCAGUUCGGCAACCC >SEQ ID NO: 15 (BYDV2M RNA, multicloning site) GGUGAAGAUUGACCAUCUCACAAAAGCUGUUACGUGCUUGUAACACACUACGCGCCCGUUUUGUAUUCGGGAAGUAGUUGCGAAAACGGUCCCCUUAUUGCCUGACAAGCUAAGGGCCACCCUUCUUUCCCCACCGCCAUC GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC AGACAACACCACUAGCACAAAUCGGAUCCUGGGAAACAGGCAGAACUUCGGUUCGUAAGCUCGGGUAGGCCGUCAACCUACCGCCGUAUCGUAUUGUGUUUGGCCGGUCUUAGCAAGCUCUGAGCCAGGAGAUGGACAUAAACCAUAGCAAUCCAACGUGUAACCGCAAUGGGGCAAACAACAGGUGAACCGUGUCCACGGGCCUGGUUACCGAAAGGAAAGCCAGUAUCCAACACAGCAAUGUGUUGGGGGUCACACCUUCGGGGUACUCUUAACGCUGACACUCGAAAGAGCAGUUCGGCAACCC >SEQ ID NO: 16 (Cap-less-BYDV2M RNA, multicloning site) GGUGAAGAUUGACCAUCUCACAAAAGCUGUUACGUGCUUGUAACACACUACGCGCCCGUUUUGUAUUCGGGAAGUAGUUGCGAAAACGGUCCCCUUAUUGCCUGACAAGCUAAGGGCCACCCUUCUUUCCCCACCGCCAUC GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC AGACAACACCACUAGCACAAAUCGGAUCCUGGGAAACAGGCAGAACUUCGGUUCGUAAGCUCGGGUAGGCCGUCAACCUACCGCCGUAUCGUAUUGUGUUUGGCCGGUCUUAGCAAGCUCUGAGCCAGGAGAUGGACAUAAACCAUAGCAAUCCAACGUGUAACCGCAAUGGGGCAAACAACAGGUGAACCGUGUCCACGGGCCUGGUUACCGAAAGGAAAGCCAGUAUCCAACACAGCAAUGUGUUGGGGGUCACACCUUCGGGGUACUCUUAACGCUGACACUCGAAAGAGCAGUUCGGCAACCC >SEQ ID NO: 17 (MNESVM RNA, multicloning site) GGAGAUAUCGACCUGCCUGACCAGGCUGAGAUUGCGCUAGCCGGCGUAGUUGGUAUCUCUCGCGCAAGCGGGUUUGAAGGUGCGGCCUAUCUUAGGGGGGUAAAUUGUAACUUCGCACAAAGGC GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC GACAAACUCUCCGCCUAAUGUCUGAUGAUGUGAGGAACGUGGACUGUGAUGUGGUGGUGCGGUACCAUGGCUGGUCACCAUGGUAAUGCGUAGGGCAACACAGUUCAUUAAGACUCACUGAUGAUGGCACUAGGCACGGUUCACCCCCAUCCUUCGGGAGGGCUAUAGGGGGUGACCGGGUUACACCACCGGAAGACCGGAACAUUGCCUUUGGGCAGCCC >SEQ ID NO: 18 (Cap-less - MNESVM RNA, multiple cloning site) GGAGAUAUCGACCUGCCUGACCAGGCUGAGAUUGCGCUAGCCGGCGUAGUUGGUAUCUCUCGCGCAAGCGGGUUUGAAGGUGCGGCCUAUCUUAGGGGGGUAAAUUGUAACUUCGCACAAAGGC GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC GACAAACUCUCCGCCUAAUGUCUGAUGAUGUGAGGAACGUGGACUGUGAUGUGGUGGUGCGGUACCAUGGCUGGUCACCAUGGUAAUGCGUAGGGCAACACAGUUCAUUAAGACUCACUGAUGAUGGCACUAGGCACGGUUCACCCCCAUCCUUCGGGAGGGCUAUAGGGGGUGACCGGGUUACACCACCGGAAGACCGGAACAUUGCCUUUGGGCAGCCC >SEQ ID NO: 19 (PMVM RNA, multiple cloning site) GGUAUUGGCUGCAACCCAUACCUGAAG GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC ACCUGCCCAAGGUUAUCACAGGCUAGGACCGGCCUGAUAAAGGUCCGACUUGAUGUGCAGCUUCUUAGGUGCAUCUCGUAUAGAAGCGCUCUGGGACAUGACACCUUUGAGACAGCCGUACAGCAGUCACACGGGAGGCCACACCACCUUUGCAGAGGUGCCC UUGGGAAACCAAUGGUGUGGGGUGACACUGAUAUAGUCGUUAACGGUGUACUAAUCCAGAGUAGUUCAGUGCAGGGAAACCCGGGCCGUAAGCACGUGGAACUAUAUAACUUAAUCUCGCUGAGAAGAUUGGGGGGGAUUCAUGAAAUCCCCUCACCAGGCCC >SEQ ID NO:20 GGUAUUGGCUGCAACCCAUACCUGAAG GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC ACCUGCCCAAGGUUAUCACAGGCUAGGACCGGCCUGAUAAAGGUCCGACUUGAUGUGCAGCUUCUUAGGUGCAUCUCGUAUAGAAGCGCUCUGGGACAUGACACCUUUGAGACAGCCGUACAGCAGUCACACGGGAGGCCACACCACCUUUGCAGAGGUGCCC UUGGGAAACCAAUGGUGUGGGGUGACACUGAUAUAGUCGUUAACGGUGUACUAAUCCAGAGUAGUUCAGUGCAGGGAAACCCGGGCCGUAAGCACGUGGAACUAUAUAACUUAAUCUCGCUGAGAAGAUUGGGGGGGAUUCAUGAAAUCCCCUCACCAGGCCC >SEQ ID NO: 21 GGUAUUUAUAGAGAUCAGU GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC GGCUUCGCUUCCCGCCGGAAGACCGCGGCGGUUCUGUUCCUCCCACAGGAGUACGGCAACAACCCACCUUGGGAAAGUGGGGAUCCCAGCACUAACUCCUUUAACUAGGCGGGCGUGUUGGUUACAGUACGAGGGGACAGUACGCAUUGAAACUGAGCCCCACCACAACUCUCAUCCACAGGGUGGUUGGGACGCAGGUGUCGGAGGGAUCGCCAGCCCUCAGGAUAGUGAGCUCCCGCAGAGGGAUAAGCUGUCUCCCUGCGACGUAGUAGUAGAACACGUGGGAUAGGGGAUGACCUUGUCGACCGUUUGUCGGUCCCCUGCUCCUUAGAGCUGGCAAGGCGCCCAUUGGUUCUACAUUUCUACCAAAGUUGGUGGUGGAUGUCUCGCCCAAAAAGAUCAUAAACGCGCGGGAUAAGGCCCUCUCCACCUUCGCCGGGUAAGGCUAGAGUCAGCGCUGCAUGACUAUAACUUGCGGCCGAUCCAGUUGCACGACUGGUGGUCCCCCCCAGUGUCUCGGUAGUCUGCCGAGUGGGCGGUGGUCGGAUUCCACCACACCCUGCCACGAGGUGCGUGGAGACUUGGCCAGUCUAGGCUCGUCGUAAUUAGUAGCAGCGACGUUAAUCAACCCGUCCGGGCAUACAAUAGGACCGGUUGUGCUUCUUCCUCUCCUUCUUAGCCAGGUGGUUACCUCCCUGGCGCCC >SEQ ID NO: 22 (uncapped-PEMV2M RNA, multiple cloning site) GGUAUUUAUAGAGAUCAGU GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC GGCUUCGCUUCCCGCCGGAAGACCGCGGCGGUUCUGUUCCUCCCACAGGAGUACGGCAACAACCCACCUUGGGAAAGUGGGGAUCCCAGCACUAACUCCUUUAACUAGGCGGGCGUGUUGGUUACAGUACGAGGGGACAGUACGCAUUGAAACUGAGCCCCACCACAACUCUCAUCCACAGGGUGGUUGGGACGCAGGUGUCGGAGGGAUCGCCAGCCCUCAGGAUAGUGAGCUCCCGCAGAGGGAUAAGCUGUCUCCCUGCGACGUAGUAGUAGAACACGUGGGAUAGGGGAUGACCUUGUCGACCGUUUGUCGGUCCCCUGCUCCUUAGAGCUGGCAAGGCGCCCAUUGGUUCUACAUUUCUACCAAAGUUGGUGGUGGAUGUCUCGCCCAAAAAGAUCAUAAACGCGCGGGAUAAGGCCCUCUCCACCUUCGCCGGGUAAGGCUAGAGUCAGCGCUGCAUGACUAUAACUUGCGGCCGAUCCAGUUGCACGACUGGUGGUCCCCCCCAGUGUCUCGGUAGUCUGCCGAGUGGGCGGUGGUCGGAUUCCACCACACCCUGCCACGAGGUGCGUGGAGACUUGGCCAGUCUAGGCUCGUCGUAAUUAGUAGCAGCGACGUUAAUCAACCCGUCCGGGCAUACAAUAGGACCGGUUGUGCUUCUUCCUCUCCUUCUUAGCCAGGUGGUUACCUCCCUGGCGCCC >SEQ ID NO:23(TCVM RNA,多克隆位点) GGUAAUAUAUGCUUUCUACAACUCUCUCUCACUGGUCCUCCUACUUUGUCAUCUGAUUCCUGAAAUCAAACCGAUUCACACAUCCUACAACACACACGACUCAUCGAAGCAGCAACACAUAAGCAUCAACACUGGAA GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC UACGGUAAUAGUGUAGUCUUCUCAUCUUAGUAGUUAGCUCUCUCUUAUAUUAAGAAAAGAAAACAAAACCCCCAGUCGCUUUAUUUUGACCUGUGUUAGGGACCAAAAACGGUGGCAGCACUGUCUAGCUGCGGGCAUUAGACUGGAAAACUAGUGCUCUUUGGGUAACCACUAAAAUCCCGAAAGGGUGGGCUGUGGUGACCUUCCGAACUAAAAGAUAGCCUCCCUCCUCGCGCGGGGGGGGGGCCUGCCC >SEQ ID NO: 24 (Cap-less - TCVM RNA, multiple cloning site) GGUAAUAUAUGCUUUCUACAACUCUCUCUCACUGGUCCUCCUACUUUGUCAUCUGAUUCCUGAAAUCAAACCGAUUCACACAUCCUACAACACACACGACUCAUCGAAGCAGCAACACAUAAGCAUCAACACUGGAA GGCGCGCCCUCAGCAUCGAUUCAAUUGGGCCGGCCGCGGCCGC UACGGUAAUAGUGUAGUCUUCUCAUCUUAGUAGUUAGCUCUCUCUUAUAUUAAGAAAAGAAAACAAAACCCCCAGUCGCUUUAUUUUGACCUGUGUUAGGGACCAAAAACGGUGGCAGCACUGUCUAGCUGCGGGCAUUAGACUGGAAAACUAGUGCUCUUUGGGUAACCACUAAAAUCCCGAAAGGGUGGGCUGUGGUGACCUUCCGAACUAAAAGAUAGCCUCCCUCCUCGCGCGGGGGGGGGGCCUGCCC >SEQ ID NO: 25 (DENVM 5'-UTR) GUUGUUAGUCUACGUGGACCGACAAAGACAGAUUCUUUGAGGGAGCUAAGCUCAACGUAGUUCUAACAGUUUUUUAAUUAGAGAGCAGAUCUCUGAUCAAUAACCAACGGAAAAAGGCGAAAAACACGCCUUUCAAUAUCCUG >SEQ ID NO:26(DENVM 3’-UTR) AAAGCAAAACUAACAUGAAACAAGGCUAGAAGUCAGGUCGGAUUAAGCCAUAGUACGGAAAAAACUAUGCUACCUGUGAGCCCCGUCCAAGGACGUUAAAAGAAGUCAGGCCAUCAUAAAUGCCAUAGCUUGAGUAAACUAUGCAGCCUGUAGCUCCACCUGAGAAGGUGUAAAAAAUCCGGGAGGCCACAAACCAUGGAAGCUGUACGCAUGGCGUAGUGGACUAGCGGUUAGAGGAGACCCCUCCCUUACAAAUCGCAGCAACAAUGGGGGCCCAAGGCGAGAUGAAGCUGUAGUCUCGCUGGAAGGACUAGAGGUUAGAGGAGACCCCCCCGAAACAAAAAACAGGAUAUUGACGCUGGGAAACACCAGAGAUCCUGCUGUCUCCUCAGCAUCAUUCCAGGCACAGAACGCCAGAAAAUGGAAUGGUGCUGUUGAAUCAACAGGUUCU >SEQ ID NO:27(BYDV2M 5’-UTR) GGUGAAGAUUGACCAUCUCACAAAAGCUGUUACGUGCUUGUAACACACUACGCGCCCGUUUUGUAUUCGGGAAGUAGUUGCGAAAACGGUCCCCUUAUUGCCUGACAAGCUAAGGGCCACCCUUCUUUCCCCACCGCCAUC >SEQ ID NO:28(BYDV2M 3’-UTR) AGACAACACCACUAGCACAAAUCGGAUCCUGGGAAACAGGCAGAACUUCGGUUCGUAAGCUCGGGUAGGCCGUCAACCUACCGCCGUAUCGUAUUGUGUUUGGCCGGUCUUAGCAAGCUCUGAGCCAGGAGAUGGACAUAAACCAUAGCAAUCCAACGUGUAACCGCAAUGGGGCAAACAACAGGUGAACCGUGUCCACGGGCCUGGUUACCGAAAGGAAAGCCAGUAUCCAACACAGCAAUGUGUUGGGGGUCACACCUUCGGGGUACUCUUAACGCUGACACUCGAAAGAGCAGUUCGGCAACCC >SEQ ID NO: 29 (PMVM 5'-UTR) GGUAUUGGCUGCAACCCAUACCUGAAG >SEQ ID NO: 30 (PMVM 3'-UTR) ACCUGCCCAAGGUUAUCACAGGCUAGGACCGGCCUGAUAAAGGUCCGACUUGAUGUGCAGCUUCUUAGGUGCAUCUCGUAUAGAAGCGCUCUGGACAUGACACCUUUGAGACAGACCGUACAGCAGUCACACGGGACGCCACACCACCUUUGCAGAGGUGCCCUUGGGAAACCAAUGGUGUGGGGUGACACUGAUUAGUCGUUAACGGUGUACUAAUCCAGAGUAGUUCAGUGCAGGGGAAACCCGGGCCGUAAGCACGUGGAACUAUAUAACUUAAUCUCGCUGAGAAGAUUGGGGGGGAUUCAUGAAAUCCCCUCACCAGGCCC >SEQ ID NO: 31 (PEMV2M 5'-UTR) GGUAUUUAUAGAGAUCAGU >SEQ ID NO: 32 (PEMV2M 3'-UTR) GGCUUCGCUUCCCGCCGGAAGACCGCGGCGGUUCUGUUCCUCCCACAGGAGUACGGCAACAACCCACCUUGGGAAAGUGGGGAUCCCAGCACUAACUCCUUUAACUAGGCGGGCGUGUUGGUUACAGUACGAGGGGACAGUACGCAUUGAAACUGAGCCCCACCACAACUCUCAUCCACAGGGUGGUUGGGACGCAGGUGUCGGAGGGAUCGCCAGCCCUCAGGAUAGUGAGCUCCCGCAGAGGGAUAAGCUGUCUCCCUGCGACGUAGUAGUAGAACACGUGGGAUAGGGGAUGACCUUGUCGACCGUUUGUCGGUCCCCUGCUCCUUAGAGCUGGCAAGGCGCCCAUUGGUUCUACAUUUCUACCAAAGUUGGUGGUGGAUGUCUCGCCCAAAAAGAUCAUAAACGCGCGGGAUAAGGCCCUCUCCACCUUCGCCGGGUAAGGCUAGAGUCAGCGCUGCAUGACUAUAACUUGCGGCCGAUCCAGUUGCACGACUGGUGGUCCCCCCCAGUGUCUCGGUAGUCUGCCGAGUGGGCGGUGGUCGGAUUCCACCACACCCUGCCACGAGGUGCGUGGAGACUUGGCCAGUCUAGGCUCGUCGUAAUUAGUAGCAGCGACGUUAAUCAACCCGUCCGGGCAUACAAUAGGACCGGUUGUGCUUCUUCCUCUCCUUCUUAGCCAGGUGGUUACCUCCCUGGCGCCC >SEQ ID NO:33(MNESVM 5’-UTR) GGAGAUAUCGACCUGCCUGACCAGGCUGAGAUUGCGCUAGCCGGCGUAGUUGGUAUCUCUCGCGCAAGCGGGUUUGAAGGUGCGGCCUAUCUUAGGGGGGUAAAUUGUAACUUCGCACAAAGGC >SEQ ID NO:34(MNESVM 3’-UTR) GACAAACUCUCCGCCUAAUGUCUGAUGAUGUGAGGAACGUGGACUGUGAUGUGGUGGUGCGGUACCAUGGCUGGUCACCAUGGUAAUGCGUAGGGCAACACAGUUCAUUAAGACUCACUGAUGAUGGCACUAGGCACGGUUCACCCCCAUCCUUCGGGAGGGCUAUAGGGGGUGACCGGGUUACACCACCGGAAGACCGGAACAUUGCCUUUGGGCAGCCC >SEQ ID NO: 35 (TCVM 5'-UTR) GGUAAUAUAUGCUUUCUACAACUCUCUCUCACUGGUCCUCCUACUUUGUCAUCUGAUUCCUGAAAUCAAACCGAUUCACACAUCCUACAACACACACGACUCAUCGAAGCAGCAACACAUAAGCAUCAACACUGGAA >SEQ ID NO: 36 (TCVM 3'-UTR) UACGGUAAUAGUGUAGUCUUCUCAUCUUAGUAGUUAGCUCUCUCUUAUUAUAGAAAAGAAAACAAAACCCCCAGUCGCUUUAUUUUGACCUGUGUUAGGGACCAAAAACGGUGGCAGCACUGUCUAGCUGCGGGCAUUAGACUGGAAAACUAGUGCUCUUUGGGUAACCACUAAAAUCCCGAAAGGGUGGGCUGUGGUGACCUUCCGAACUAAAAGAUAGCCUCCCUCCUCGCGCGGGGGGGGGGCCUGCCC >SEQ ID NO: 37 (SARSVM 5'-UTR) AUUAAAGGUUUAUACCUUCCCAGGUAACAAACCAACCAACUUUCGAUCUCUUGUAGAUCUGUUCUCUAAACGAACUUUAAAAUCUGUGUGGCUGUCACUCGGCUGCAUGCUUAGUGCACUCACGCAGUAUAAUUAAUAACUAAUUACUGUCGUUGACAGGACACGAGUAACUCGUCUAUCUUCUGCAGGCUGCUUACGGUUUCGUCCGUGUUGCAGCCGAUCAUCAGCACAUCUAGGUUUCGUCCGGGUGUGACCGAAAGGUAAG >SEQ ID NO: 38 (SARS VM 3'-UTR + 50A) CAAUCUUUAAUCAGUGUGUAACAUUAGGGAGGACUUGAAAGAGCCACCACAUUUUCACCGAGGCCACGCGGAGUACGAUCGAGUGUACAGUGAACAAUGCUAGGGAGAGCUGCCUAUAUGGAAGAGCCCUAAUGUGUAAAAUUAAUUUUAGUAGUGCUAUCCCCAUGUGAUUUUAAUAGCUUCUUAGGAGAAUGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA >SEQ ID NO: 39 (COL1A1 COL1A2 COL1A1 collagen coding region RNA: coding region for exemplary self-cleaving peptide underlined) GGCUCCGGAGAGGGCAGAGGAAGUCUGCUAACAUGCGGUGACGUCGAGGAGAAUCCUGGCCCA GGGUCGGGUCAAUGUACUAACUACGCUUUGUUGAAACUCGCUGGCGAUGUUGAAAGUAACCCC GGUCCU >SEQ ID NO: 40 (EPO multimer coding region RNA: coding region for exemplary self-cleaving peptide underlined) AUGGGGGUGCACGAAUGUCCUGCCUGGCUGUGGCUUCUCCUGUCCCUGCUGUCGCUCCCUCUGGGCCUCCCAGUCCUGGGCGCCCCACCACGCCUCAUCUGUGACAGCCGAGUCCUGGAGAGGUACCUCUUGGAGGCCAAGGAGGCCGAGAAUAUCACGACGGGCUGUGCUGAACACUGCAGCUUGAAUGAGAAUAUCACUGUCCCAGACACCAAAGUUAAUUUCUAUGCCUGGAAGAGGAUGGAGGUCGGGCAGCAGGCCGUAGAAGUCUGGCAGGGCCUGGCCCUGCUGUCGGAAGCUGUCCUGCGGGGCCAGGCCCUGUUGGUCAACUCUUCCCAGCCGUGGGAGCCCCUGCAGCUGCAUGUGGAUAAAGCCGUCAGUGGCCUUCGCAGCCUCACCACUCUGCUUCGGGCUCUGGGAGCCCAGAAGGAAGCCAUCUCCCCUCCAGAUGCGGCCUCAGCUGCUCCACUCCGAACAAUCACUGCUGACACUUUCCGCAAACUCUUCCGAGUCUACUCCAAUUUCCUCCGGGGAAAGCUGAAGCUGUACACAGGGGAGGCCUGCAGGACAGGGGACAGA GGUUCUGGCGUGAAACAGACUUUGAAUUU UGACCUUCUCAAGUUGGCGGGAGACGUGGAGUCCAACCCAGGGCCC AUGGGGGUGCACGAAUGUCCUGCCUGGCUGUGGCUUCUCCUGUCCCUGCUGUCGCUCCCUCUGGGCCUCCCAGUCCUGGGCGCCCCACCACGCCUCAUCUGUGACAGCCGAGUCCUGGAGAGGUACCUCUUGGAGGCCAAGGAGGCCGAGAAUAUCACGACGGGCUGUGCUGAACACUGCAGCUUGAAUGAGAAUAUCACUGUCCCAGACACCAAAGUUAAUUUCUAUGCCUGGAAGAGGAUGGAGGUCGGGCAGCAGGCCGUAGAAGUCUGGCAGGGCCUGGCCCUGCUGUCGGAAGCUGUCCUGCGGGGCCAGGCCCUGUUGGUCAACUCUUCCCAGCCGUGGGAGCCCCUGCAGCUGCAUGUGGAUAAAGCCGUCAGUGGCCUUCGCAGCCUCACCACUCUGCUUCGGGCUCUGGGAGCCCAGAAGGAAGCCAUCUCCCCUCCAGAUGCGGCCUCAGCUGCUCCACUCCGAACAAUCACUGCUGACACUUUCCGCAAACUCUUCCGAGUCUACUCCAAUUUCCUCCGGGGAAAGCUGAAGCUGUACACAGGGGAGGCCUGCAGGACAGGGGACAGA GGCUCCGGAGAGGGCAGAGGAAGUCUGCUAACAUGCGGUGACGUCGAGGAGAAUCCUGGCCCA AUGGGGGUGCACGAAUGUCCUGCCUGGCUGUGGCUUCUCCUGUCCCUGCUGUCGCUCCCUCUGGGCCUCCCAGUCCUGGGCGCCCCACCACGCCUCAUCUGUGACAGCCGAGUCCUGGAGAGGUACCUCUUGGAGGCCAAGGAGGCCGAGAAUAUCACGACGGGCUGUGCUGAACACUGCAGCUUGAAUGAGAAUAUCACUGUCCCAGACACCAAAGUUAAUUUCUAUGCCUGGAAGAGGAUGGAGGUCGGGCAGCAGGCCGUAGAAGUCUGGCAGGGCCUGGCCCUGCUGUCGGAAGCUGUCCUGCGGGGCCAGGCCCUGUUGGUCAACUCUUCCCAGCCGUGGGAGCCCCUGCAGCUGCAUGUGGAUAAAGCCGUCAGUGGCCUUCGCAGCCUCACCACUCUGCUUCGGGCUCUGGGAGCCCAGAAGGAAGCCAUCUCCCCUCCAGAUGCGGCCUCAGCUGCUCCACUCCGAACAAUCACUGCUGACACUUUCCGCAAACUCUUCCGAGUCUACUCCAAUUUCCUCCGGGGAAAGCUGAAGCUGUACACAGGGGAGGCCUGCAGGACAGGGGACAGA GGGUCGGGUCAAUGUACUAACUACGCUUUGUUGAAACUCGCU GGCGAUGUUGAAAGUAACCCCGGUCCU AUGGGGGUGCACGAAUGUCCUGCCUGGCUGUGGCUUCUCCUGUCCCUGCUGUCGCUCCCUCUGGGCCUCCCAGUCCUGGGCGCCCCACCACGCCUCAUCUGUGACAGCCGAGUCCUGGAGAGGUACCUCUUGGAGGCCAAGGAGGCCGAGAAUAUCACGACGGGCUGUGCUGAACACUGCAGCUUGAAUGAGAAUAUCACUGUCCCAGACACCAAAGUUAAUUUCUAUGCCUGGAAGAGGAUGGAGGUCGGGCAGCAGGCCGUAGAAGUCUGGCAGGGCCUGGCCCUGCUGUCGGAAGCUGUCCUGCGGGGCCAGGCCCUGUUGGUCAACUCUUCCCAGCCGUGGGAGCCCCUGCAGCUGCAUGUGGAUAAAGCCGUCAGUGGCCUUCGCAGCCUCACCACUCUGCUUCGGGCUCUGGGAGCCCAGAAGGAAGCCAUCUCCCCUCCAGAUGCGGCCUCAGCUGCUCCACUCCGAACAAUCACUGCUGACACUUUCCGCAAACUCUUCCGAGUCUACUCCAAUUUCCUCCGGGGAAAGCUGAAGCUGUACACAGGGGAGGCCUGCAGGACAGGGGACAGA GGAAGCGGAG CUACUAACUUCAGCCUGCUGAAGCAGGCUGGAGACGUGGAGGAGAACCCUGGACCU AUGGGGGUGCACGAAUGUCCUGCCUGGCUGUGGCUUCUCCUGUCCCUGCUGUCGCUCCCUCUGGGCCUCCCAGUCCUGGGCGCCCCACCACGCCUCAUCUGUGACAGCCGAGUCCUGGAGAGGUACCUCUUGGAGGCCAAGGAGGCCGAGAAUAUCACGACGGGCUGUGCUGAACACUGCAGCUUGAAUGAGAAUAUCACUGUCCCAGACACCAAAGUUAAUUUCUAUGCCUGGAAGAGGAUGGAGGUCGGGCAGCAGGCCGUAGAAGUCUGGCAGGGCCUGGCCCUGCUGUCGGAAGCUGUCCUGCGGGGCCAGGCCCUGUUGGUCAACUCUUCCCAGCCGUGGGAGCCCCUGCAGCUGCAUGUGGAUAAAGCCGUCAGUGGCCUUCGCAGCCUCACCACUCUGCUUCGGGCUCUGGGAGCCCAGAAGGAAGCCAUCUCCCCUCCAGAUGCGGCCUCAGCUGCUCCACUCCGAACAAUCACUGCUGACACUUUCCGCAAACUCUUCCGAGUCUACUCCAAUUUCCUCCGGGGAAAGCUGAAGCUGUACACAGGGGAGGCCUGCAGGACAGGGGACAGAUAA >SEQ ID NO: 41 (TERT / TERC RNA in MNESVM + 50A RNA: TERT and TERC coding regions underlined) AGATATCGACCTGCCTGACCAGGCTGAGATTGCGCTAGCCGGCGTAGTTGGTATCTCTCGCGCAAGCGGGTTTGAAGGTGCGGCCTATCTTAGGGGGGTAAATTGTAACTTCGCACAAAGGCGCGCCACC ATGCCGCGCGCTCCCC GCTGCCGAGCCGTGCGCTCCCTGCTGCGCAGCCACTACCGCGAGGTGCTGCCGCTGGCCACGTTCGTGCGGCGCCTG GGGCCCCAGGGCTGGCGGCTGGTGCAGCGCGGGGACCCGGCGGCTTTCCGCGCGCTGGTGGCCCAGTGCCTGGTGTG CGTGCCCTGGGACGCACGGCCGCCCCCCGCCGCCCCCTCCTTCCGCCAGGTGTCCTGCCTGAAGGAGCTGGTGGCCC GAGTGCTGCAGAGGCTGTGCGAGCGCGGCGCGAAGAACGTGCTGGCCTTCGGCTTCGCGCTGCTGGACGGGGCCCGC GGGGGCCCCCCCGAGGCCTTCACCACCAGCGTGCGCAGCTACCTGCCCAACACGGTGACCGACGCACTGCGGGGGAG CGGGGCGTGGGGGCTGCTGCTGCGCCGCGTGGGCGACGACGTGCTGGTTCACCTGCTGGCACGCTGCGCGCTCTTTG TGCTGGTGGCTCCCAGCTGCGCCTACCAGGTGTGCGGGCCGCCGCTGTACCAGCTCGGCGCTGCCACTCAGGCCCGG CCCCCGCCACACGCTAGTGGACCCCGAAGGCGTCTGGGATGCGAACGGGCCTGGAACCATAGCGTCAGGGAGGCCGG GGTCCCCCTGGGCCTGCCAGCCCCGGGTGCGAGGAGGCGCGGGGGCAGTGCCAGCCGAAGTCTGCCGTTGCCCAAGA GGCCCAGGCGTGGCGCTGCCCCTGAGCCGGAGCGGACGCCCGTTGGGCAGGGGTCCTGGGCCCACCCGGGCAGGACG CGTGGACCGAGTGACCGTGGTTTCTGTGTGGTGTCACCTGCCAGACCCGCCGAAGAAGCCACCTCTTTGGAGGGTGC GCTCTCTGGCACGCGCCACTCCCACCCATCCGTGGGCCGCCAGCACCACGCGGGCCCCCCATCCACATCGCGGCCAC CACGTCCCTGGGACACGCCTTGTCCCCCGGTGTACGCCGAGACCAAGCACTTCCTCTACTCCTCAGGCGACAAGGAG CAGCTGCGGCCCTCCTTCCTACTCCTCTCTCTGAGGCCCAGCCTGACTGGCGCTCGGAGGCTCGTGGAGACCATCTTTCTGGGTTCCAGGCCCTGGATGCCAGGGACTCCCCGCAGGTTGCCCCGCCTGCCCCAGCGCTACTGGCAAATGCGGC CCCTGTTTCTGGAGCTGCTTGGGAACCACGCGCAGTGCCCCTACGGGGTGCTCCTCAAGACGCACTGCCCGCTGCGA GCTGCGGTCACCCCAGCAGCCGGTGTCTGTGCCCGGGAGAAGCCCCAGGGCTCTGTGGCGGCCCCCGAGGAGGAGGA CACAGACCCCCGTCGCCTGGTGCAGCTGCTCCGCCAGCACAGCAGCCCCTGGCAGGTGTACGGCTTCGTGCGGGCCT GCCTGCGCCGGCTGGTGCCCCCAGGCCTCTGGGGCTCCAGGCACAACGAACGCCGCTTCCTCAGGAACACCAAGAAG TTCATCTCCCTGGGGAAGCATGCCAAGCTCTCGCTGCAGGAGCTGACGTGGAAGATGAGCGTGCGGGACTGCGCTTG GCTGCGCAGGAGCCCAGGGGTTGGCTGTGTTCCGGCCGCAGAGCACCGTCTGCGTGAGGAGATCCTGGCCAAGTTCC TGCACTGGCTGATGAGTGTGTACGTCGTCGAGCTGCTCAGGTCTTTCTTTTATGTCACGGAGACCACGTTTCAAAAG AACAGGCTCTTTTTCTACCGGAAGAGTGTCTGGAGCAAGTTGCAAAGCATTGGAATCAGACAGCACTTGAAGAGGGT GCAGCTGCGGGAGCTGTCGGAAGCAGAGGTCAGGCAGCATCGGGAAGCCAGGCCCGCCCTGCTGACGTCCAGACTCC GCTTCATCCCCAAGCCTGACGGGCTGCGGCCGATTGTGAACATGGACTACGTCGTGGGAGCCAGAACGTTCCGCAGA GAAAAGAGGGCCGAGCGTCTCACCTCGAGGGTGAAGGCACTGTTCAGCGTGCTCAACTACGAGCGGGCGCGGCGCCC CGGCCTCCTGGGCGCCTCTGTGCTGGGCCTGGACGATATCCACAGGGCCTGGCGCACCTTCGTGCTGCGTGTGCGGG CCCAGGACCCGCCGCCTGAGCTGTACTTTGTCAAGGTGGATGTGACGGGCGCGTACGACACCATCCCCCAGGACAGG CTCACGGAGGTCATCGCCAGCATCATCAAACCCCAGAACACGTACTGCGTGCGTCGGTATGCCGTGGTCCAGAAGGC CGCCCATGGGCACGTCCGCAAGGCCTTCAAGAGCCACGTCTCTACCTTGACAGACCTCCAGCCGTACATGCGACAGT TCGTGGCTCACCTGCAGGAGACCAGCCCGCTGAGGGATGCCGTCGTCATCGAGCAGAGCTCCTCCCTGAATGAGGCC AGCAGTGGCCTCTTCGACGTCTTCCTACGCTTCATGTGCCACCACGCCGTGCGCATCAGGGGCAAGTCCTACGTCCA GTGCCAGGGGATCCCGCAGGGCTCCATCCTCTCCACGCTGCTCTGCAGCCTGTGCTACGGCGACATGGAGAACAAGC TGTTTGCGGGGATTCGGCGGGACGGGCTGCTCCTGCGTTTGGTGGATGATTTCTTGTTGGTGACACCTCACCTCACC CACGCGAAAACCTTCCTCAGGACCCTGGTCCGAGGTGTCCCTGAGTATGGCTGCGTGGTGAACTTGCGGAAGACAGT GGTGAACTTCCCTGTAGAAGACGAGGCCCTGGGTGGCACGGCTTTTGTTCAGATGCCGGCCCACGGCCTATTCCCCT GGTGCGGCCTGCTGCTGGATACCCGGACCCTGGAGGTGCAGAGCGACTACTCCAGCTATGCCCGGACCTCCATCAGA GCCAGTCTCACCTTCAACCGCGGCTTCAAGGCTGGGAGGAACATGCGTCGCAAACTCTTTGGGGTCTTGCGGCTGAA GTGTCACAGCCTGTTTCTGGATTTGCAGGTGAACAGCCTCCAGACGGTGTGCACCAACATCTACAAGATCCTCCTGC TGCAGGCGTACAGGTTTCACGCATGTGTGCTGCAGCTCCCATTTCATCAGCAAGTTTGGAAGAACCCCACATTTTTC CTGCGCGTCATCTCTGACACGGCCTCCCTCTGCTACTCCATCCTGAAAGCCAAGAACGCAGGGATGTCGCTGGGGGC CAAGGGCGCCGCCGGCCCTCTGCCCTCCGAGGCCGTGCAGTGGCTGTGCCACCAAGCATTCCTGCTCAAGCTGACTC GACACCGTGTCACCTACGTGCCACTCCTGGGGTCACTCAGGACAGCCCAGACGCAGCTGAGTCGGAAGCTCCCGGGG ACGACGCTGACTGCCCTGGAGGCCGCAGCCAACCCGGCACTGCCCTCAGACTTCAAGACCATCCTGGACTGA GCGGCCGCGACAAACTCTCCGCCTAATGTCTGATGATGTGAGGAACGTGGACTGTGATGTGGTGGTGCGGTACCATGGCTGGTCACCATGGTAATGCGTAGGGCAACACAGTTCATTAAGACTCACTGATGATGGCACTAGGCACGGTTCACCCCCATCCTTCGGGAGGGCTATAGGGGGTGACCGGGTTACACCACCGGAAGACCGGAACATTGCCTTTGGGCAGCCCCAACCCCTGATGAGTCCGTGAGGACGAAACGGTAGGAATTCCTACCGTC GGGTTGCGGAGGGTGGGCCTGGGAGGGGTGGTGGC CATTTTTTGTCTAACCCTAACTGAGAAGGGCGTAGGCGCCGTGCTTTTGCTCCCCGCGCGCTGTTTTTCTCGCTGAC TTTCAGCGGGCGGAAAAGCCTCGGCCTGCCGCCTTCCACCGTTCATTCTAGAGCAAACAAAAAATGTCAGCTGCTGG CCCGTTCGCCCCTCCCGGGGACCTGCGGCGGGTCGCCTGCCCAGCCCCCGAACCCCGCCTGGAGGCCGCGGTCGGCC CGGGGCTTCTCCGGAGGCACCCACTGCCACCGCGAAGAGTTGGGCTCTGTCAGCCGCGGGTCTCTCGGGGGCGAGGG CGAGGTTCAGGCCTTTCAGGCCGCAGGAAGAGGAACGGAGCGAGTCCCCGCGCGCGGCGCGATTCCCTGAGCTGTGG GACGTGCACCCAGGACTCGGCTCACACATGC CACCGGAGTCGACTCCGGTCTGATGAGTCCGTGAGGACGAAGCATGTACTTAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA >SEQ ID NO:42 (NOV2M-DMD-28A MRNA) GUAAACAACCAAUAACAUCGCGAUCGCC UUCCACCCACAGAAGCGUUGACGACGCAAAACGUCCUUAAAGCGUUGACGACGCAAAACGUCCCCAAGCUCGUAGCACCGACCCUAUACCCAUCUCUAGGGUCUUCAACCUCUUGGUAAAAAAAAAAAAAAAAAAAAAAAAAAAA

Claims

1. An RNA molecule comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein The 3'-UTR is Nodamura virus RNA2 (NOV2) 3'-UTR or a fragment thereof, or Nodamura virus RNA1 (NOV1) 3'-UTR or a fragment thereof, wherein the fragment is at least 40 nucleotides in length, and The CDS is heterologous to NOV2 or NOV1 and replaces the open reading frame of the Nodamura virus capsid protein of NOV2 or the open reading frame of the Nodamura virus RNA-dependent RNA polymerase (RdRp).

2. The RNA molecule of claim 1, wherein the 3'-UTR is NOV2 3'-UTR.

3. The RNA molecule of claim 2, wherein the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 10, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:

10.

4. The RNA molecule of claim 1, wherein the 3'-UTR is NOV1 3'-UTR.

5. The RNA molecule of claim 4, wherein the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:

7.

6. The RNA molecule according to claim 1, comprising: (i) the nucleotide sequence of SEQ ID NO: 6 as the 5'-UTR and the nucleotide sequence of SEQ ID NO: 7 as the 3'-UTR; or (i) the nucleotide sequence of SEQ ID NO: 9 as the 5'-UTR and the nucleotide sequence of SEQ ID NO: 10 as the 3'-UTR.

7. An RNA molecule comprising a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein The 3'-UTR comprises a viral 3'-UTR or a fragment thereof, wherein the fragment is at least 40 nucleotides in length, The CDS is heterologous to the virus and replaces at least a portion of the open reading frame of the virus, and The virus is a positive-sense single-stranded RNA (+ssRNA) virus, and the viral genome lacks a poly (A) tail.

8. The RNA molecule of claim 7, wherein the virus is a member of a virus family selected from the group consisting of Nodaviviridae, Flaviviridae, and Tetraviridae.

9. The RNA molecule of claim 8, wherein the virus is a member of the Nodaviridae family.

10. The RNA molecule of claim 9, wherein the virus is Nodamura virus or Flockhouse virus.

11. The RNA molecule of claim 8, wherein the virus is a member of the Flaviviridae family.

12. The RNA molecule of claim 11, wherein the virus is dengue virus.

13. The RNA molecule of claim 7, wherein the virus is a plant virus.

14. The RNA molecule of claim 13, wherein the plant virus is barley yellow dwarf virus (BYDV), maize necrotic streak virus (MNESV), millet mosaic virus (PMV), pea ear mosaic virus-2 (PEMV2), or turnip crinkle virus (TCV).

15. The RNA molecule of any one of claims 1-14, comprising at least one modified nucleoside.

16. The RNA molecule of claim 15, wherein the at least one modified nucleoside comprises "5mC + Ψ", "m1Ψ", "5moU" or "Ψ", optionally wherein the at least one modified nucleoside comprises "m1Ψ", optionally wherein the at least one modified nucleoside comprises "5mC + Ψ".

17. The RNA molecule of any one of claims 1-16, wherein the at least one CDS comprises two or more CDSs of two or more different proteins.

18. The RNA molecule of claim 17, wherein the two or more CDSs are operably linked to form a fusion protein comprising the two or more different proteins.

19. The RNA molecule of claim 17, wherein the two or more CDSs are separated from each other by an internal ribosome entry site (IRES).

20. The RNA molecule of claim 17, wherein the two or more CDSs are separated from each other by nucleotides encoding a flexible linker or a 2A self-cleaving peptide.

21. The RNA molecule of any one of claims 1-20, wherein the RNA molecule comprises a heterogenous adenine homopolymer at its 3' end of no more than about 60 nucleotides in length, optionally wherein the heterogenous adenine homopolymer is 20 to 60 nucleotides in length.

22. The RNA molecule of any one of claims 1-20, wherein the at least one protein is full-length human dystrophin or full-length human type VII collagen alpha-1 (VII) chain (COL7A1) protein.

23. A DNA template for the RNA molecule according to any one of claims 1 to 22, optionally wherein one or more first restriction enzyme sites are present between the 5'-UTR and the at least one coding region, and one or more second restriction enzyme sites are present between the at least one coding region and the 3'-UTR.

24. A plasmid comprising the DNA template according to claim 23, wherein the plasmid comprises a promoter upstream of the 5'UTR.

25. A host cell comprising the plasmid according to claim 24.

26. A recombinant virus comprising the RNA molecule according to any one of claims 1-22.

27. A method for expressing a protein, the method comprising contacting a mammalian cell with an RNA molecule according to any one of claims 1 to 22.

28. The method of claim 27, wherein the contacting is performed in vitro.

29. The method of claim 27, wherein the contacting is performed in vivo.

30. The method of any one of claims 27-29, wherein the contacting is performed in the presence of B18R protein.

31. An RNA molecule comprising, from 5' to 3', a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, a 3'-untranslated region (3'-UTR) and a homopolymer of adenine, wherein The 3'-UTR comprises a viral 3'-UTR or a fragment thereof, wherein the fragment is at least 40 nucleotides in length, The CDS and the homopolymer of adenine are heterologous to the virus, and The virus is a positive-sense single-stranded RNA (+ssRNA) virus, and the viral genome lacks a poly (A) tail.

32. The RNA molecule of claim 31 , wherein the adenine homopolymer is no more than about 60 nucleotides in length.

33. The RNA molecule of claim 32, wherein the adenine homopolymer is 20 to 60 nucleotides in length.

34. The RNA molecule of claim 31 , wherein the virus is a member of a virus family selected from the group consisting of Nodaviviridae, Flaviviridae, and Tetraviridae.

35. The RNA molecule of claim 31 , wherein the virus is a member of the Nodaviridae family.

36. The RNA molecule of claim 35, wherein the virus is Nodamura virus or Flockhouse virus.

37. The RNA molecule of claim 31 , wherein the virus is a member of the Flaviviridae family.

38. The RNA molecule of claim 37, wherein the virus is dengue virus.

39. The RNA molecule of claim 31 , wherein the virus is a plant virus.

40. The RNA molecule of claim 39, wherein the plant virus is barley yellow dwarf virus (BYDV), maize necrotic streak virus (MNESV), millet mosaic virus (PMV), pea ear mosaic virus-2 (PEMV2), or turnip crinkle virus (TCV).

41. The RNA molecule of any one of claims 31-40, comprising at least one modified nucleoside.

42. The RNA molecule of claim 41, wherein the at least one modified nucleoside comprises "5mC + Ψ", "m1Ψ", "5moU" or "Ψ", optionally wherein the at least one modified nucleoside comprises "m1Ψ", optionally wherein the at least one modified nucleoside comprises "5mC + Ψ".

43. The RNA molecule of any one of claims 31-42, wherein the at least one protein is full-length human dystrophin or full-length human type VII collagen alpha-1 (VII) chain (COL7A1) protein.

44. The RNA molecule of claim 31 , wherein the adenine homopolymer is between about 60 nucleotides and about 120 nucleotides in length.

45. An RNA molecule comprising, from 5' to 3', a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein The 3'-UTR comprises a viral 3'-UTR or a fragment thereof, wherein the fragment is at least 40 nucleotides in length, The CDS is heterologous to the virus and replaces at least the open reading frame of the RNA-dependent RNA polymerase of the virus, and The virus is a positive-sense single-stranded RNA (+ssRNA) virus.

46. ​​The RNA molecule of claim 45, wherein the RNA molecule further comprises an adenine homopolymer between 15 and 200 nucleotides in length downstream of the 3'-UTR.

47. The RNA molecule of claim 46, wherein the virus is a member of the Coronaviridae family.

48. The RNA molecule of claim 47, wherein the virus is severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2).

49. An RNA molecule comprising, from 5' to 3', a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein The 3'-UTR comprises a viral 3'-UTR or a fragment thereof, wherein the fragment is at least 40 nucleotides in length, The CDS encodes full-length human dystrophin or full-length human type VII collagen alpha-1 (VII) chain (COL7A1) protein and replaces at least a portion of the open reading frame of the virus, and The virus is a positive-sense single-stranded RNA (+ssRNA) virus.

50. The RNA molecule of claim 49, wherein the viral genome lacks a poly (A) tail.

51. The RNA molecule of claim 50, further comprising a heterologous adenine homopolymer at its 3' end, optionally wherein the adenine homopolymer is 20 to 60 nucleotides in length.

52. The RNA molecule of claim 49, wherein the genome of the virus comprises a poly(A) tail, and the RNA molecule further comprises the poly(A) tail.

53. The RNA molecule of claim 52, further comprising a heterologous adenine homopolymer at the 3' end of the poly(A) tail, optionally wherein the sum of the lengths of the poly(A) tail and the heterologous adenine homopolymer is between 20 and 120 nucleotides.

54. An RNA molecule comprising, from 5' to 3', a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein The 5'-UTR is a 5'-UTR of a dengue virus or a fragment thereof, and the 3'-UTR is a 3'-UTR of the dengue virus or a fragment thereof, wherein the fragment is at least 40 nucleotides in length, and The CDS is heterologous to the dengue virus and replaces the open reading frame of the dengue virus such that a portion of the open reading frame that interacts with the complementary sequence of the 3'-UTR to form a circular conformation remains in the RNA molecule.

55. The RNA molecule of claim 54, wherein the first start codon in the portion of the open reading frame retained in the RNA molecule is mutated so as not to initiate translation of a first corresponding genomic sequence, and the first corresponding portion of the 3'-UTR that interacts with the first start codon to form the circular conformation is mutated such that the mutated first start codon remains complementary to the mutated first corresponding portion of the 3'-UTR to form the circular conformation.

56. The RNA molecule of claim 55, wherein the second start codon in the portion of the open reading frame retained in the RNA molecule is mutated so as not to initiate translation of a second corresponding genomic sequence, and the second corresponding portion of the 3'-UTR that interacts with the second start codon to form the circular conformation is mutated such that the mutated second start codon remains complementary to the mutated second corresponding portion of the 3'-UTR to form the circular conformation.

57. The RNA molecule of any one of claims 54-56, further comprising a 5'-cap.

58. The RNA molecule according to any one of claims 54-57, wherein: (i) the 5'-UTR comprises the nucleotide sequence of SEQ ID NO:25, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:25; and (ii) the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 26, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:

26.

59. The RNA molecule of any one of claims 54-58, further comprising a homopolymer of adenine downstream of the 3'-UTR.

60. The RNA molecule of claim 59, wherein the adenine homopolymer is between about 30 nucleotides and about 60 nucleotides in length.

61. An RNA molecule comprising, from 5' to 3', a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein The 5'-UTR is a 5'-UTR of a plant virus or a fragment thereof, and the 3'-UTR is a 3'-UTR of a plant virus or a fragment thereof, wherein the fragment is at least 40 nucleotides in length, The CDS is heterologous to the plant virus and replaces at least a portion of the open reading frame of the plant virus, The virus is a positive-sense single-stranded RNA (+ssRNA) virus, the genome of which lacks a poly(A) tail, and The 3-UTR contains a 3'-cap-independent translation enhancer (3'-CITE).

62. The RNA molecule of claim 61 , further comprising a 5'-cap that is heterologous to the plant virus.

63. The RNA molecule of claim 61 or claim 62, further comprising a homopolymer of adenine that is heterologous to the plant virus.

64. The RNA molecule of claim 63, wherein the adenine homopolymer is between about 30 nucleotides and about 60 nucleotides in length.

65. The RNA molecule of any one of claims 61-64, wherein the plant virus is barley yellow dwarf virus (BYDV), maize necrotic streak virus (MNESV), millet mosaic virus (PMV), pea ear mosaic virus-2 (PEMV2), or turnip crinkle virus (TCV).

66. The RNA molecule of any one of claims 61-64, wherein the 3'-CITE is a BYDV-like translation element (BTE), a PMV-like translation element (PTE), an I-shaped secondary structure (ISS), or a T-shaped structure (TSS).

67. The RNA molecule of claim 66, wherein the 3'-CITE is a BTE.

68. The RNA molecule of claim 67, wherein: (i) the 5'-UTR comprises the nucleotide sequence of SEQ ID NO: 27, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 27; and (ii) the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 28, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:

28.

69. The RNA molecule of claim 66, wherein the 3'-CITE is PTE.

70. The RNA molecule of claim 69, wherein: (i) the 5'-UTR comprises the nucleotide sequence of SEQ ID NO: 29, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 29; and (ii) the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 30, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:

30.

71. The RNA molecule of claim 69, wherein: (i) the 5'-UTR comprises the nucleotide sequence of SEQ ID NO:31, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:31; and (ii) the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 32, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:

32.

72. The RNA molecule of claim 66, wherein the 3'-CITE is an ISS.

73. The RNA molecule of claim 72, wherein: (i) the 5'-UTR comprises the nucleotide sequence of SEQ ID NO:33, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:33; and (ii) the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 34, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:

34.

74. The RNA molecule of claim 66, wherein the 3'-CITE is a TSS.

75. The RNA molecule of claim 74, wherein: (i) the 5'-UTR comprises the nucleotide sequence of SEQ ID NO:35, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:35; and (ii) the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 36, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:

36.

76. An RNA molecule comprising, from 5' to 3', a 5'-untranslated region (5'-UTR), at least one coding sequence (CDS) for at least one protein, and a 3'-untranslated region (3'-UTR), wherein The 5'-UTR is a 5'-UTR of a virus or a fragment thereof, and the 3'-UTR is a 3'-UTR of the virus or a fragment thereof, the fragment being at least 40 nucleotides in length, The CDS is heterologous to the virus and replaces the open reading frame of the virus, and The virus is a positive-sense single-stranded RNA (+ssRNA) virus.

77. The RNA molecule of claim 76, wherein the viral 3'-UTR comprises a heterologous adenine homopolymer downstream of a homologous adenine homopolymer of the virus.

78. The RNA molecule of claim 77, wherein: (i) the 5'-UTR comprises the nucleotide sequence of SEQ ID NO:37, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:37; and (ii) the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 38, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:

38.

79. The RNA molecule of claim 76, wherein the at least one protein comprises full-length human dystrophin or full-length human type VII collagen alpha-1 (VII) chain (COL7A1).

80. The RNA molecule of claim 76, wherein the CDS comprises the nucleotide sequence of SEQ ID NO: 39, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:

39.

81. The RNA molecule of claim 76, wherein the CDS comprises the nucleotide sequence of SEQ ID NO: 40, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:

40.

82. The RNA molecule of claim 76, comprising the nucleotide sequence of SEQ ID NO: 41, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:

41.

83. The RNA molecule of any one of claims 76-82, wherein the 5'-UTR and the 3'-UTR form a circular conformation.

84. An RNA molecule comprising, from 5' to 3', a viral 5'-untranslated region (5'-UTR), a multiple cloning site (MCS) and a viral 3'-untranslated region (3'-UTR), wherein The virus is a positive-sense single-stranded RNA (+ssRNA) virus, and the MCS is 18 to 60 nucleotides in length.

85. The RNA molecule of claim 84, wherein the MCS comprises the nucleotide sequence of SEQ ID NO:

8.

86. The RNA molecule of claim 84, comprising the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:

3.

87. The RNA molecule of claim 84, comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 11-24, or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 11-24.

88. The RNA molecule of any one of claims 84-87, further comprising at least one coding sequence (CDS) for at least one protein located within the MCS or replacing a portion of the MCS.

89. A DNA template for the RNA molecule of any one of claims 31-88.

90. The DNA template of claim 89, wherein one or more first restriction enzyme sites are present between the 5'-UTR and the at least one coding region, and one or more second restriction enzyme sites are present between the at least one coding region and the 3'-UTR.

91. A plasmid comprising the DNA template of claim 90, wherein the plasmid comprises a promoter upstream of the 5'UTR.

92. A host cell comprising the plasmid of claim 91.

93. A recombinant virus comprising the RNA molecule of any one of claims 31-88.

94. A method for expressing a protein, the method comprising contacting a mammalian cell with an RNA molecule according to any one of claims 31-88.

95. The method of claim 94, wherein the contacting is performed in vitro.

96. The method of claim 94, wherein the contacting is performed in vivo.

97. The method of any one of claims 94-96, wherein the contacting is performed in the presence of a B18R protein.

Images