Polypeptide and application thereof in enhancing immunity and / or resisting inflammation

Abstract

The invention relates to the technical field of biology, and particularly discloses a polypeptide and application thereof in enhancing immunity and / or resisting inflammation. The invention provides a polypeptide. The amino acid sequence of the polypeptide is shown as SEQ ID NO. 1. The compound has the dual functions of regulating immunity and resisting inflammation, on one hand, the immune function of cells under the normal condition can be enhanced, and on the other hand, cell inflammation can be relieved by reducing the phosphorylation level of key protein in an LTR4-NF-kappa B signal channel in the inflammatory state. The polypeptide is low in cytotoxicity, high in safety, simple in preparation method and low in cost, can be used as an ideal immune and anti-inflammatory regulator, and has good application potential and value.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a polypeptide and its application in enhancing immunity and / or resisting inflammation. Background Art

[0002] When animals or humans are young, weak, sick, stressed, or infected by pathogens, their immunity is often compromised, leading to secondary infections (bacterial or viral mixed infections) and inflammatory reactions (redness, heat, swelling, and pain). Currently, the traditional and widely used preventive and treatment strategies for infections and inflammation are antibiotics and hormonal anti-inflammatory drugs (such as hydrocortisone and dexamethasone). While these drugs can effectively control both infectious and non-infectious inflammation, their continued use can cause a variety of side effects, including severe disruptions in water and salt metabolism and in the metabolism of sugars, fats, and proteins, as well as adrenal cortex dysfunction, digestive system complications, and worsening infections. Furthermore, antibiotics are widely used in the livestock industry as health and growth promoters. The use of antibiotics or steroid-based anti-inflammatory drugs in the treatment of infections and inflammation presents significant challenges. While antibiotics can reduce or kill pathogens, they do not improve the body's immune function. On the contrary, the pathogens killed by antibiotics may produce endotoxins or exotoxins, which can exacerbate the inflammatory response and even lead to systemic inflammatory response syndrome (SIRS). This can cause fever, anorexia, excessive energy consumption, tissue breakdown, decreased immunity and production performance in animals, and even death in severe cases. Recent studies have shown that many antibiotics, while killing bacteria, can also trigger the release of endotoxins, namely lipopolysaccharides (LPS), from bacterial cell membranes, leading to LPS accumulation and inflammatory responses. LPS is commonly produced by cell breakdown in Gram-negative bacteria such as pathogenic Escherichia coli, Salmonella, Brucella, Proteus, swine influenza, and Haemophilus parasuis. It can trigger the release of various pro-inflammatory cytokines, such as TNF-α, interleukin-6 (IL-6), and IL-1β. It also induces the production of large amounts of free radicals, causing oxidative damage and thus impairing immunity. Therefore, reducing or eliminating endotoxin LPS and reducing oxidative damage to the body through antioxidant function can reduce or eliminate the inflammatory response of diseased animals or humans.

[0003] In summary, current antibiotics and glucocorticoids have significant drawbacks and are not suitable for sustained use. Therefore, developing a novel, safe, side-effect-free, environmentally friendly active peptide that simultaneously possesses immunomodulatory, antioxidant, anti-inflammatory, and endotoxin-dissolving properties has significant practical significance and enormous application prospects for both humans and animal husbandry, representing a new breakthrough and novel concept in anti-infection strategies.

[0004] The immune system protects the body from invasion by foreign microorganisms through its defenses and promptly eliminates aging and cancerous cells. However, when immune function is suboptimal, the body is highly susceptible to infection and can develop malignant tumors, worsening the patient's condition and making it difficult to treat. However, when the immune response is excessive, it can trigger intense inflammation in animals or humans, leading to damage and dysfunction of various physiological systems, thus disrupting normal metabolic processes and, in severe cases, even life-threatening. Thus, anti-inflammatory and immunity are two aspects of immune system function that are closely related, inseparable, and sometimes even overlapping. Therefore, in traditional medicine, the clear distinction between anti-inflammatory drugs and immunopotentiators is inconsistent with the body's actual needs and the interplay between anti-inflammatory and immune functions, and it significantly complicates and increases the potential for antagonism in clinical drug selection. Given this, the development of safe and effective formulations or drugs with bidirectional immunomodulatory properties to improve immune function in animals and humans is of great significance. Summary of the Invention

[0005] One of the purposes of the present invention is to provide a new hybrid peptide with both immune regulation and anti-inflammatory functions.

[0006] The present invention provides a polypeptide, the amino acid sequence of which is shown in SEQ ID NO.1.

[0007] Based on extensive research into the sequence, structure, and structure-activity relationship of the polypeptides MMO (amino acid sequence: QLNWD (NO. 2)) and TP5 (amino acid sequence: RKDVY (NO. 3)), this study designed a hybrid peptide, MP, with the amino acid sequence QLNWDRKDVY. MP exhibits bidirectional immunomodulatory properties: it can enhance immune function in normal or immunosuppressive states; and it can also suppress inflammation in inflammatory states.

[0008] Derivative polypeptides of hybrid peptide MP having the same function obtained by modification based on the amino acid sequence shown in SEQ ID NO.1 also belong to the scheme of the present invention, including but not limited to the following polypeptides: (1) A polypeptide obtained by adding a protein tag sequence to the C-terminus or N-terminus of the amino acid sequence shown in SEQ ID NO.1, for example, a polypeptide obtained by adding a His tag containing 6 His residues to the C-terminus or N-terminus of the amino acid sequence shown in SEQ ID NO.1; or a polypeptide obtained by adding a GST or C-Myc tag to the C-terminus or N-terminus of the amino acid sequence shown in SEQ ID NO.1; The skilled in the art should understand that, for the purpose of facilitating purification, polypeptide labeling and the like, adding tag sequences to both ends of the polypeptide is a routine technical means in the art, and will not affect the inherent functions and activities of the polypeptide itself, therefore, the MP derivative obtained by adding tag sequences to both ends of the hybrid peptide MP as shown in SEQ ID NO. 1 is also within the protection scope of the present application.

[0009] (2) a polypeptide obtained by performing one or more conservative amino acid substitutions on the amino acid sequence as shown in SEQ ID NO. 1.

[0010] The present application also provides a DNA molecule encoding the above-mentioned polypeptide.

[0011] The present application also provides a gene encoding the above-mentioned hybrid peptide having immunomodulatory, antioxidant, endotoxin-dissolving and anti-inflammatory functions.

[0012] In the case of knowing the amino acid sequence of the hybrid peptide MP, the skilled in the art can design the coding gene of the hybrid peptide MP with different nucleotide sequences according to the needs for polypeptide expression, based on the principle of codon degeneracy and the preference of different species for codon usage.

[0013] As an embodiment of the present application, the nucleotide sequence of the DNA molecule of the present application is shown in SEQ ID NO. 4. The gene as shown in SEQ ID NO. 4 is a hybrid peptide MP coding gene designed according to the codon preference of Escherichia coli. The gene sequence encoding the same functional protein with at least 80%, 85%, 90%, 95%, 98% or 99% homology to SEQ ID NO. 4 also belongs to the protection scope of the present application.

[0014] The present application also provides a biological material comprising the above-mentioned DNA molecule, and the biological material is an expression cassette, a recombinant vector or a host cell.

[0015] Further, the present application also provides a biological material containing the above-mentioned hybrid peptide coding gene, and the biological material includes a recombinant DNA, an expression cassette, a transposon, a plasmid vector, a bacteriophage vector, a viral vector or a host cell.

[0016] The host cell includes animal and plant cells or cell lines, microbial cells. The animal and plant cells or cell lines cannot develop into a complete whole body.

[0017] Preferably, the recombinant vector is an expression vector; the recombinant vector preferably further comprises a control element operably linked to the above-mentioned DNA molecule; the control element preferably is a promoter, a terminator and / or an enhancer; Preferably, the host cell is a bacterial, fungal or animal cell; wherein the bacteria preferably include Escherichia coli; and the fungus preferably includes yeast.

[0018] Furthermore, the present invention provides a method for preparing the hybrid peptide, comprising: introducing a gene encoding the hybrid peptide into a host cell to express the hybrid peptide.

[0019] Preferably, the preparation method comprises: connecting the gene encoding the hybrid peptide MP to an expression vector to construct a recombinant expression vector, and introducing the recombinant expression vector into a host cell by a transgenic method to obtain a host cell introduced with the MP encoding gene.

[0020] The transgenic methods include heat stress transformation, electroporation, transfection, etc.

[0021] The host cells include but are not limited to animal and plant cells, and microbial cells.

[0022] Preferably, the host cell is Escherichia coli.

[0023] The present invention proves through in vitro experiments that the hybrid peptide MP can not only improve the body's normal immune activity and increase the expression of cytokines; but also can inhibit LPS-induced inflammatory response, reduce cytokine expression, and relieve inflammation during the inflammatory response, and has a good immune and anti-inflammatory bidirectional regulatory effect.

[0024] Based on the above functions, the present invention provides the use of the above polypeptides or DNA molecules or biomaterials in the preparation of products that enhance immunity and / or fight inflammation, in the preparation of products that increase the expression levels of macrophage cytokines IL-6 and IL-1β under normal conditions (non-inflammatory conditions), in the preparation of products that reduce the NO level in macrophage cells caused by LPS, in the preparation of products that reduce the increased expression levels of macrophage cytokines TNF-α and IL-6 and / or the increased iNOS transcription levels caused by LPS, and in the preparation of products that reduce the activation of the TLR4-NF-κB signaling pathway caused by LPS.

[0025] The present invention provides the use of the hybrid peptide or the hybrid peptide encoding gene or the biological material containing the hybrid peptide encoding gene in the preparation of immunomodulatory preparations.

[0026] Preferably, the immunomodulatory preparation is an immunopotentiator.

[0027] The present invention also provides the use of the hybrid peptide or the hybrid peptide encoding gene or the biological material containing the hybrid peptide encoding gene in the preparation of anti-inflammatory preparations.

[0028] The above-mentioned anti-inflammatory preparations or endotoxin-eliminating preparations can be used for the prevention and treatment of various inflammations or endotoxemias including LPS-induced inflammatory reactions.

[0029] The present invention also provides a medicine comprising the above polypeptide and a pharmaceutically acceptable carrier and / or excipient.

[0030] The present invention also provides application of the polypeptide in livestock and poultry breeding.

[0031] The present invention also provides an animal feed or feed additive, which comprises the above polypeptide.

[0032] In the medicine, animal feed or feed additive, the hybrid peptide can be used as an effective ingredient, or the hybrid peptide can be compounded with other active ingredients to form the effective ingredient of the product.

[0033] The beneficial effects of the present invention are at least: The present invention is the first to obtain an immune anti-inflammatory hybrid peptide MP by hybridizing MMO and TP5 through optimization and screening. The polypeptide MP has the functions of two parent peptides at the same time, that is, it has a bidirectional immune regulation function, and compared with the corresponding activities of the parent peptides MMO and TP5, its immune regulation activity and anti-inflammatory activity are stronger: under normal conditions, it can significantly improve the body's immune function; under inflammatory conditions, MP can also inhibit the body's inflammatory response and alleviate the damage to tissues caused by inflammatory responses; at the same time, MP has the advantages of low cytotoxicity, high safety, easy preparation and low cost. It can be used as an ideal immunomodulator and anti-inflammatory agent, and is widely used in the fields of medicine, food, feed, nutrition, etc. for humans and animals, and has great application value.

[0034] The preparation method of the hybrid peptide provided by the present invention can realize the large-scale and efficient preparation of the hybrid peptide MP. The prepared hybrid peptide MP has bidirectional immunomodulatory activity and has no obvious toxic side effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is a flow chart for the construction of the recombinant expression vector pCOLD-SUMO-MP in Example 1 of the present invention.

[0036] Figure 2 The results of the induction expression and HPLC purification of the recombinant protein in Example 1 of the present invention are shown in Figure 1. a is the result of IPTG-induced expression; b is the result of HPLC analysis after MP recombinant polypeptide digestion and purification.

[0037] Figure 3The results of the cytotoxicity assay of the hybrid peptide MP against mouse macrophages RAW 264.7 in Example 2 and the hemolytic activity assay of the hybrid peptide MP against sheep erythrocytes in Example 3 are shown. (a) shows the hemolytic activity assay of the hybrid peptide MP and its parent peptides MMO and TP5 against sheep erythrocytes; (b) shows the cytotoxicity assay of the hybrid peptide MP and its parent peptides MMO and TP5 against mouse macrophages RAW 264.7.

[0038] Figure 4 These are the results of assaying the immunomodulatory activity of the hybrid peptide MP in Example 4 of the present invention on mouse macrophage RAW 264.7 cells. a) The results of assaying the activation levels of the mouse macrophage immune factor IL-6 by the hybrid peptide MP and its parent peptides MMO and TP5; b) The results of assaying the activation levels of the mouse macrophage immune factor IL-1β by the hybrid peptide MP and its parent peptides MMO and TP5. Indicates that there is a significant difference between the two (p<0.5).

[0039] Figure 5 Figure 5 shows the effect of the hybrid peptide MP on NO secretion in the LPS-induced mouse macrophage RAW 264.7 inflammation model. a shows the effect of the hybrid peptide MP and its parent peptides MMO and TP5 on NO secretion in the LPS-induced cellular inflammation model; b shows the concentration gradient effect of the hybrid peptide MP on NO reduction in the LPS-induced cellular inflammation model. Indicates that there is a significant difference between the two (p<0.0001).

[0040] Figure 6 Figure 5 shows the effects of the hybrid peptide MP on immune factor secretion and corresponding gene transcription levels in the LPS-induced mouse macrophage RAW 264.7 inflammation model. (a) shows the reduction in TNF-α (a) by the hybrid peptide MP in the LPS-induced cellular inflammation model; (b) shows the reduction in IL-6 (b) by the hybrid peptide MP in the LPS-induced cellular inflammation model; (c) shows the effect of the hybrid peptide MP on the TNF-α gene transcription level in the LPS-induced cellular inflammation model; (d) shows the effect of the hybrid peptide MP on the IL-6 gene transcription level in the LPS-induced cellular inflammation model; and (e) shows the effect of the hybrid peptide MP on the iNOS gene transcription level in the LPS-induced cellular inflammation model. Indicates that there is a significant difference between the two (p < 0.01). Indicates that there is a significant difference between the two (p < 0.001). Indicates that there is a significant difference between the two (p<0.0001).

[0041] Figure 7 Figure 5 shows the effect of the hybrid peptide MP in Example 5 of the present invention on the activation levels of key proteins in the TLR4-NF-κB signaling pathway in the LPS-induced mouse macrophage RAW 264.7 inflammatory model. a shows the immunoblotting results of the hybrid peptide MP on the expression levels of key proteins in the TLR4-NF-κB signaling pathway; b, c, and d show the grayscale analysis results of the phosphorylation expression levels of p65, IKK, and IKBα proteins, respectively; e shows the grayscale value analysis results of iNOS protein expression levels. DETAILED DESCRIPTION

[0042] The preferred embodiments of the present invention will be described in detail below with reference to the examples. It should be understood that the following examples are provided for illustrative purposes only and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0043] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods. Unless otherwise specified, the materials, reagents, etc. used in the following examples are all commercially available or prepared according to conventional methods in the art.

[0044] Example 1 Preparation of immune anti-inflammatory hybrid peptide MP 1. Construction of recombinant expression vector Based on the amino acid sequence of the hybrid peptide MP (sequence shown in SEQ ID NO. 1) and the codon preference of E. coli, the coding gene of the hybrid peptide MP (sequence shown in SEQ ID NO. 4 (CAACTAAATTGGGATCGTAAGGACGTGTAC)) was designed and synthesized, and ligated with the expression vector pCOLD-SUMO-CTPQ (modified based on the commercial vector pCOLD-TF (TaKaRa, No. 3365)), and transformed into E. coli DH5α competent cells to construct the recombinant expression vector pCOLD-SUMO-MP. The vector construction process is shown in the figure. Figure 1 shown.

[0045] 2. Construction of Escherichia coli engineered bacteria expressing hybrid peptide MP The recombinant expression vector pCOLD-SUMO-MP constructed in step 1 above was transformed into the Escherichia coli BL21 (DE3) strain as follows: the competent Escherichia coli BL21 (DE3) cells were placed on ice and 100 ng of pCOLD-SUMO-MP plasmid was added and mixed evenly. The plasmid was transformed according to the Escherichia coli heat shock transformation method and plated. Positive transformants were verified and identified by PCR to obtain Escherichia coli engineered bacteria expressing the hybrid peptide MP.

[0046] 3. Induced expression and purification of hybrid peptide MP The E. coli engineered bacteria constructed in step 2 were inoculated into a 500 mL conical flask containing 50 mL LB liquid medium, cultured at 37°C and 180 rpm for 12 h, then the incubator temperature was adjusted to 15°C, and then 0.5 mM IPTG was added to induce expression for 24 h. The induced expression results are shown in Figure 2 Since MP has a small molecular weight, it is difficult to detect it directly by protein gel running. After enterokinase digestion at 30°C overnight and purification, the present invention uses high performance liquid chromatography to detect MP. The specific conditions are as follows: Column: C18 Phenomenex Luna (130 A, 3.5 μm, 4.6 × 250 mm); Temperature: 35°C; Flow rate: 1 ml / min; Buffer A: 0.1% (v / v) TFA in water; Buffer B: 0.1% (v / v) TFA in acetonitrile; Detection wavelength: 220 nm; gradient elution: 0-20 min, 0-60% Buffer B, the sum of Buffer A and Buffer B is 100%.

[0047] The purified peptide was dissolved in a mixed solution of 98% 0.1% (v / v) formic acid aqueous solution and 2% (v / v) acetonitrile and tested on an instrument.

[0048] Test results such as Figure 2 The b in.

[0049] Example 2 Effect of hybrid peptide MP on the survival rate of mouse macrophages Macrophage RAW264.7 cells in the logarithmic growth phase were inoculated into 96-well plates, with an initial cell culture density of 1×10 4 / mL, 100 μL per well, incubated overnight at 37°C, 5% CO2, and then added a series of concentration gradients (0-100 μg / mL) of hybrid peptide MP, MMO (abbreviated as M, sequence as shown in SEQ ID NO.2 (QLNWD)) and TP5 (abbreviated as P, sequence as shown in SEQ ID NO.3 (RKDVY)) solutions. After incubation for 24 hours, the effect of polypeptide MP on the survival rate of mouse macrophages was detected using the CCK8 assay. The results are shown in Figure 2. Figure 3 As shown in b, the cytotoxicity of the hybrid peptide MP is lower than that of its parent peptides MMO and TP5, and the survival rate of macrophages is greater than 80% in the concentration range of 0-100 μg / mL, indicating that the hybrid peptide MP has low cytotoxicity and high safety.

[0050] Example 3 Hemolytic activity of hybrid peptide MP on sheep blood cells First, the above-mentioned polypeptides were diluted to different concentrations of stock solution (100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 μg / mL); an equal volume of PBS was added to fresh sheep red blood cells (100 mL), mixed, and centrifuged at 3000 rpm for 5 min, and the supernatant was discarded; an appropriate amount of PBS was added to resuspend the blood cells and the above centrifugation steps were repeated until the supernatant was clear and colorless; 50 mL of PBS was added and pipetted to mix to obtain 8% sheep red blood cells; 10 μL of polypeptides of different concentrations were added to a 96-well cell culture plate, and then 90 μL of 8% sheep red blood cell suspension was added to each well and incubated in a 37°C incubator for 1 h; the culture plate was centrifuged at 3000 rpm for 5 min, 80 μL of supernatant was transferred to an enzyme-labeled plate, and the OD414 was measured using a multifunctional enzyme reader. The absorbance was measured at 40 nm, and the hemolytic rate of the peptide was calculated using the following formula: Sheep red blood cell hemolysis % = [(A-A0) / A1] × 100%. A is the absorbance of the peptide group, A0 is the absorbance of the PBS group, and A1 is the absorbance of the 0.1% Triton X-100 group.

[0051] The results are as follows Figure 3 As shown in a, the hemolytic activity of MP on sheep erythrocytes was always less than 5% within the tested concentration range (10-100 μg / mL), indicating that it has high safety.

[0052] Example 4 Immunomodulatory activity of hybrid peptide MP in mouse macrophages The hybrid peptide MP and its parent peptides MMO and TP5 were diluted with DMEM culture medium to prepare a peptide solution with a concentration of 100 μg / mL. The effects of the hybrid peptide MP and its parent peptides MMO and TP5 on the secretion of cytokines such as IL-β and IL-6 by mouse macrophages RAW264.7 under normal conditions were detected. A normal group (Control, referred to as CON), experimental group 1 (MP), experimental group 2 (TP5, referred to as P), and experimental group 3 (MMO, referred to as M) were set up. The normal group did not receive any treatment. After overnight culture of the cells, experimental groups 1, 2, and 3 were added with MP, P, or M solutions with a final concentration of 100 μg / mL. The cytokines IL-6 and IL-1β were detected by ELISA, and the results are shown in the figure. Figure 4 As shown, the hybrid peptide MP can significantly increase the expression of cytokines IL-6 and IL-1β in mouse macrophages under normal conditions, and the expression of cytokines IL-6 and IL-1β in macrophages in the MP group is higher than that in the MMO group and TP5 group. This shows that the hybrid peptide MP has an immunomodulatory effect and can enhance the immune activity of cells under normal conditions, and its immune-enhancing effect is better than that of its parent peptides MMO and TP5.

[0053] Example 5 Anti-inflammatory activity of hybrid peptide MP in mouse macrophages 1. Detection of NO RAW 264.7 cells were plated at 3.0 × 10 5 The cells were seeded at a density of 100 μg / mL in a 96-well plate and cultured for 12 hours. After incubation for 12 hours, different final concentrations of the above peptides (0, 1, 5, 10, 20, 40, 60, 80 and 100 μg / mL) were added to each well and incubated for another 3 hours. Subsequently, LPS was added to each well at a final concentration of 100 ng / mL and incubated for another 24 hours. The cell culture supernatant was collected for nitric oxide (NO) detection. NO levels were quantified by Griess reagent. Specifically, 50 μL of Griess reagent A and 50 μL of Griess reagent B were sequentially added to 50 μL of culture medium supernatant, and the absorbance of the reaction mixture was measured at 540 nm. The results are shown in Figure 2. Figure 5 As shown, the hybrid peptide MP can significantly reduce the increase in NO levels in RAW 264.7 cells caused by LPS, and the effect is significantly stronger than its parent peptides MMO and TP5. Through concentration gradient studies, it was found that within the concentration range of 0-100 μg / mL, MP's ability to scavenge NO increased with increasing peptide concentration. At 100 μg / mL, the NO level was almost reduced to the same level as the control group. Cell activity assays also showed that within this concentration range, MP had no significant toxicity to cells.

[0054] 2. Detection of Cytokines RAW 264.7 cells were plated at 2.0 × 10 cells per well. 6 Cells were seeded at a density of 100 μg / mL in 6-well plates and cultured for 12 hours. After 12 hours of incubation, 100 μg / mL of MP was added to each well and incubated for another 3 hours. Subsequently, LPS was added to each well at a final concentration of 100 ng / mL and incubated for another 24 hours. After 24 hours of incubation with LPS, the cell supernatant was collected and the levels of IL-6 and TNF-α were measured using ELISA kits. The results are shown in Figure 2. Figure 6 As shown in a and b: the LPS modeling group caused the increase in the levels of TNF-α and IL-6 in the cells, while the treatment group with the addition of MP was able to significantly reduce the levels of cytokines, that is, MP can alleviate the inflammation of RAW 264.7 caused by LPS.

[0055] 3. Fluorescence Quantitative PCR Assay RAW 264.7 cells were plated at 2.0 × 10 cells per well. 6 Cells were seeded at a density of 100 μg / mL in 6-well plates and cultured for 12 hours. After 12 hours of incubation, 100 μg / mL of MP was added to each well and incubated for another 3 hours. Subsequently, lipopolysaccharide (LPS) was added to each well at a final concentration of 100 ng / mL and incubated for another 24 hours. After the incubation, the cell pellet was collected for RNA extraction. The RNA was then converted to cDNA and subjected to RT-PCR. The test results are shown in Figure 2. Figure 6 As shown in Figures c, d, and e, the transcriptional expression trends of the cytokines TNF-α and IL-6 were consistent with the ELISA results. In addition, the transcriptional levels of iNOS and NO secretion were also consistent. These results indicate that MP can alleviate the inflammatory response of RAW 264.7 cells induced by LPS at the transcriptional level.

[0056] 4. Western Blotting RAW 264.7 cells were plated at 2.0 × 10 cells per well. 6The cells were seeded at a density of 100 cells / mL in 6-well plates and cultured for 12 hours. After incubation for 12 hours, 100 μg / mL of MP was added to each well and incubated for another 3 hours. Subsequently, LPS was added to each well at a final concentration of 100 ng / mL and incubated for another 6 hours. After the incubation, the cell pellet was collected for protein extraction. Protein extraction was performed using RIPA lysis buffer (with protease inhibitors added in proportion), and the protein concentration was determined by the BCA method. Protein electrophoresis was performed using Tris-Glycine SDS-PAGE gel, and then the protein was transferred to a PVDF membrane. After the membrane was blocked with 5% skim milk, it was incubated with the target protein primary antibody overnight, and the HRP-labeled secondary antibody was added the next day for binding, and finally developed using a chemiluminescence imager. The results are shown in Figure 2. Figure 7 As shown in the figure, LPS treatment led to increased phosphorylation levels of IKK, IKBα, and P65 proteins, indicating that the LPS model was successfully established. When incubated with MP, the phosphorylation levels of IKK, IKBα, and P65 proteins were significantly reduced, indicating that MP can reduce the activation of the TLR4-NF-κB signaling pathway caused by LPS. At the same time, MP also downregulated the expression of iNOS, a protein regulated downstream of TLR4-NF-κB. These results indicate that hybrid peptide MP can alleviate the inflammatory response of RAW 264.7 cells induced by LPS.

[0057] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.

Claims

1. A polypeptide, characterized in that The amino acid sequence is shown in SEQ ID NO.

1.

2. A DNA molecule, characterized in that Encodes the polypeptide according to claim 1.

3. The DNA molecule according to claim 2, characterized in that The nucleotide sequence is shown in SEQ ID NO.

4.

4. A biomaterial, characterized in that Comprising the DNA molecule according to claim 2 or 3, the biological material is an expression cassette, a recombinant vector or a host cell.

5. Use of the polypeptide according to claim 1, the DNA molecule according to claim 2 or 3, or the biomaterial according to claim 4 in the preparation of an immunity-enhancing and / or anti-inflammatory product.

6. Use of the polypeptide according to claim 1, the DNA molecule according to claim 2 or 3, or the biomaterial according to claim 4 in the preparation of a product for increasing the expression of the cytokines IL-6 and IL-1β in macrophages under normal conditions.

7. Use of the polypeptide according to claim 1, the DNA molecule according to claim 2 or 3, or the biomaterial according to claim 4 in preparing a product for reducing the NO level in macrophages induced by LPS, or for preparing a product for reducing the increased expression of cytokines TNF-α and IL-6 and / or the increased transcription level of iNOS in macrophages induced by LPS, or for preparing a product for reducing the activation of the TLR4-NF-κB signaling pathway induced by LPS.

8. A drug, characterized in that The invention comprises the polypeptide according to claim 1 and a pharmaceutically acceptable carrier and / or excipient.

9. Use of the polypeptide according to claim 1 in livestock and poultry breeding.

10. An animal feed or feed additive, characterized in that Comprising the polypeptide of claim 1.

Images