SNP molecular marker YAP1 gene g.75896359AT related to lambing traits of goats and application of SNP molecular marker YAP1 gene g.75896359AT

Abstract

The invention relates to the technical field of modern livestock breeding, in particular to an SNP molecular marker YAP1 gene g.75896359AT related to the lambing traits of goats and application of the SNP molecular marker YAP1 gene g.75896359AT. The SNP molecular marker is located at the 51bp position of a nucleotide sequence shown in SEQ ID NO.01, and the polymorphism of the SNP molecular marker is A / T. When the genotype of the polymorphic site contained in the molecular marker is AT or TT, the molecular marker corresponds to the lambing trait relative advantage of the goat to be detected. The molecular marker provided by the invention can be applied to the identification or prediction of the lambing state of the goat, can also be applied to the field of molecular breeding, and judges the genetic potential of the goat based on the analysis of the genotype of the goat; by optimizing the dominant allelotype of the SNP molecular marker, the lambing performance of the progeny of the goat can be improved, the SNP molecular marker is used for genetic improvement of breeding sheep, and the economic benefit of the mutton sheep breeding industry is effectively improved.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of modern livestock breeding technology, and particularly relates to a SNP molecular marker YAP1 gene g.75896359AT related to goat lambing traits and application. BACKGROUND

[0002] The reproductive performance of goats is an important factor restricting the development of the industry, and increasing the number of goat kids can not only increase the output of mutton, but also improve the breeding efficiency. The lambing traits of goats include the number of kids, the number of live kids, and the multiple birth rate, which have important influences on the lambing capacity of goats.

[0003] Single nucleotide polymorphism (SNP) has the characteristics of large quantity, wide distribution, low heterozygosity, good genetic stability, and suitability for high-throughput automatic detection, and can be used as a preferred tool for molecular breeding, gene mapping, and population evolution. With the aid of modern selection breeding technology, by adding molecular markers with significant effects to marker associated selection (MAS) and genomic selection (GS), the genetic improvement of the number of goat kids can be significantly improved, and the efficient development of the goat industry in China can be promoted. Genome-wide association studies (GWAS) technology can help to efficiently screen molecular markers with significant influences on phenotypes. Although GWAS technology has made significant progress, there are still some challenges, such as low data standardization quality and high cost of large population sequencing, which need to be solved in GWAS research. In modern livestock breeding, due to the large size of livestock and poultry populations, the use of high-depth sequencing for base information acquisition will result in high costs and reduce economic benefits, and the quality of low-depth sequencing data needs to be investigated. Therefore, in order to meet the requirements of large population sequencing, it is an important factor to improve the efficiency of SNP screening to provide low-cost and high-quality SNP site information for GWAS analysis.

[0004] The currently reported SNP sites related to the number of goat kids include the c.*454C>G site in the goat NFAT5 gene, the c.*1103G>A site in the goat RSAD2 gene, and the g.7919G>A site in the goat ZBP1 gene. Screening new SNP sites related to the number of goat kids can provide new molecular marker resources for molecular marker assisted selection of goats and accelerate the process of breeding improvement of goats.

[0005] Therefore, the present application is provided. SUMMARY

[0006] To solve the above technical problems, the present application provides a SNP molecular marker YAP1 gene g.75896359AT related to goat lambing traits and application.

[0007] Specifically, the technical solutions of the present application are as follows:

[0008] In the first aspect, the present application provides a SNP molecular marker related to goat lambing traits, which is located at the 51st bp of the nucleotide sequence shown in SEQ ID NO. 01, and the polymorphism thereof is A / T.

[0009] Preferably, the genotype of the polymorphic site contained in the SNP molecular marker is AT or TT, which corresponds to the relative advantage of the lambing traits of the goat to be tested.

[0010] Preferably, the genotype of the polymorphic site contained in the SNP molecular marker is AA, which corresponds to the relative disadvantage of the lambing traits of the goat to be tested.

[0011] The molecular marker screened by the present application can be applied to the genotype of the goat lambing number related gene or the correlation analysis of the goat lambing number, and provides a new molecular marker resource for the molecular marker assisted selection of the goat lambing number.

[0012] In the second aspect, the present application provides a substance for detecting the SNP molecular marker described in the first aspect, which includes PCR primers for amplifying the genomic DNA fragment of the SNP molecular marker or a kit containing the primers.

[0013] In the third aspect, the present application provides the application of the above-mentioned molecular marker or the above-mentioned substance in at least one of the following:

[0014] (1) application in identifying goat lambing traits;

[0015] (2) application in predicting goat lambing traits;

[0016] (3) application in goat resource identification, improvement or molecular marker assisted breeding.

[0017] Preferably, the lambing traits include the average number of lambs.

[0018] Preferably, the breed of the goat includes Chubao black head goat.

[0019] In the fourth aspect, the present application provides a method for detecting goat reproductive traits, which comprises: detecting whether the single nucleotide of the N marker in the sequence shown in SEQ ID NO: 1 is A or T, and judging the goat reproductive traits based on the detection result.

[0020] Preferably, the application uses primers of the amplification sequence SEQ ID NO: 1 to genotype the material of the Zhu Bao He Tou sheep to be tested, if the genotype is AT or TT, the average lambing number of the individual to be tested is determined.

[0021] In a fifth aspect, the application provides a genetic breeding method for improving the lambing number of goats, determining the SNP molecular marker of the breeding goat in the core group of goats, the SNP molecular marker is located at the 51st bp of the nucleotide sequence shown in SEQ ID NO. 01, and the polymorphism is A / T; and making a corresponding selection according to the SNP molecular marker of the goat: selecting the individual with the 51st base of AT type and / or TT type in the SNP marker for the next generation breeding of the breeding goat, and eliminating the AA type individual, so as to increase the frequency of the gene C at this site generation by generation, thereby improving the lambing performance of the offspring goats.

[0022] Beneficial effects:

[0023] The application provides a SNP molecular marker YAP1 gene g.75896359AT related to the lambing performance of goats and an application thereof, the SNP molecular marker is located at the 51st bp of the nucleotide sequence shown in SEQ ID NO. 01, and the polymorphism is A / T. When the genotype of the polymorphism site contained in the molecular marker is AT or TT, the relative advantage of the lambing performance of the goat to be tested corresponds. The molecular marker provided by the application can be applied to the identification or prediction of the lambing state of goats, and can also be applied to the field of molecular breeding. Based on the analysis of the genotype of the goat, the genetic potential of the goat is judged; by selecting the advantage allele of the SNP molecular marker, the lambing performance of the offspring goats can be improved, the genetic improvement of the breeding goat is used, and the economic benefit of the mutton sheep breeding industry is effectively improved. BRIEF DESCRIPTION OF DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the application or the prior art, the drawings needed to be used in the embodiments or prior art description will be described below.

[0025] Figure 1 : Manhattan plot of the lambing number of goats, the black circles and arrows point to the molecular marker screened by the application, and the marker is located on the 15th chromosome of the goat. DETAILED DESCRIPTION

[0026] The main purpose of the application is to screen a molecular marker g.75896359AT associated with the lambing number of goats, and to provide the application of the molecular marker in the detection of the lambing number of goats or the breeding of goats.

[0027] Firstly, the present application provides a goat SNP molecular marker, which is located at the 75896359th nucleotide site on chromosome 15 of the goat reference genome, the base at this site is A or T, and the nucleotide sequence of 50 bp upstream and downstream of the SNP site is shown as follows (SEQ ID NO: 1):

[0028] GAATGTTCCATGCCTATGGCAGCAGCCCGGTCAGAGGGGCTGAG GCAGATN(A / T)TGAAGAACAGCAGGAAGGCCGCTACAGCGGGGACAG AGCCGGTGAAAAGG.

[0029] The N at the 51st base of the above sequence is an A51-T51 allelic mutation, which causes nucleotide polymorphism in the sequence of SEQ ID NO: 1. The molecular marker can be used as a molecular marker for detecting the lambing number of goats, and when the 51st nucleotide in the sequence shown in SEQ ID NO: 1 is T, it is beneficial for the goat to have a higher average number of productive lambing.

[0030] The present application further provides a reagent or kit comprising primers for detecting the above-mentioned SNP molecular marker. Those skilled in the art can design primers that can amplify the sequence shown in SEQ ID NO: 1 according to the principle of primer design, in order to detect the SNP marker genotype related to the lambing number of goats in the present application, so as to predict the reproductive traits of goats, especially the average number of productive lambing.

[0031] The above-mentioned SNP molecular marker or the above-mentioned reagent or kit of the present application can be applied to the detection of goat reproductive traits or goat breeding; the goat reproductive trait is the average number of productive lambing of goats; and the breed of the goat is preferably black-headed sheep.

[0032] The present application further provides a method for detecting the lambing number of goats, which detects whether the single nucleotide marked by N in the above-mentioned sequence of SEQ ID NO: 1 of the goat is A or T.

[0033] Preferably, the lambing number of the goat is the average number of productive lambing of the goat.

[0034] As a more preferred and specific embodiment, the present application uses primers for amplifying the sequence shown in SEQ ID NO: 1 to genotype the material of the goat to be tested, and the average number of productive lambing of the goat individual with genotype AT or TT is significantly higher than that of the AA individual.

[0035] The present application preferably uses the above-mentioned reagent or kit for detection.

[0036] The application also provides application of the single nucleotide polymorphism of the goat SNP site or a substance (reagent or kit) for detecting the single nucleotide polymorphism of the goat SNP site in detection or auxiliary detection of reproductive traits or goat breeding.

[0037] The application also provides a method for screening the SNP molecular marker, comprising the following steps:

[0038] ①extracting goat genomic DNA, performing whole genome low-depth and high-depth resequencing to obtain original sequencing data;

[0039] ②quality control of the original sequencing data, alignment to the goat reference genome, genetic variation detection and genotype filling of all autosomes of the sample by using the Sentieon+Beagle strategy, and obtaining high-quality SNP site data;

[0040] ③performing GWAS analysis on the SNP site and the average number of lambing of goats by using the FarmCPU model through the rMVP software, and obtaining the SNP molecular marker related to the number of lambing of the goat.

[0041] As a more specific embodiment, the low depth is 1-2x, and the high depth is 15-20x; preferably, the number of low depth is higher than that of high depth, so as to reduce the sequencing cost by genotype filling of the results of a small amount of high-depth sequencing to a large amount of low-depth sequencing.

[0042] The application also provides a genetic breeding method for improving the number of lambing of goats, determining the SNP molecular marker of the breeding goat in the goat core group, and making a corresponding selection according to the goat SNP molecular marker: selecting the individual with the 51st base AT type and / or TT type in the SNP marker for the next generation breeding of the breeding goat, and eliminating the individual with the AA type, so as to increase the frequency of the gene T at the site from generation to generation, and thus improve the lambing performance of the offspring goats.

[0043] In the following examples, the present application is verified by whole genome resequencing of 500 Dongbao black head sheep, in which 466 are sequenced at low depth of 1x and 34 are sequenced at high depth of 15x, aiming to genotype fill the high-depth sequencing results (less) with the low-depth sequencing results (more) to reduce the sequencing cost. Then, the resequencing data is aligned to the goat reference genome (genome version ARS1.2), and the SNP site data is obtained by using the Sentieon+Beagle strategy to detect genetic variations and genotype fill all autosomes of 500 samples, and then the GWAS research on the 12-month weight of goats is carried out, and finally the YAP1 gene related to goat reproduction is screened, and the SNP marker site is the 75896359th nucleotide site on chromosome 15 of the goat reference genome Capra hircus ARS1.2 version, and the base of the site is A or T. Referring to Ensembl, the nucleotide sequence of 50bp upstream and downstream of the SNP site is obtained, and the nucleotide sequence of the fragment is shown as SEQ ID NO: 1 (wherein the T at the 51st base is the nucleotide after allelic mutation). The GWAS analysis result shows that g.75896359AT is significantly related to the lambing number of goats, and the lambing number of individuals with genotypes AT or TT is significantly higher than that of AA individuals, indicating that T is an allele beneficial to the increase of lambing number. The molecular marker can be used as a molecular marker for detecting the lambing number of goats, and when the 51st nucleotide of the sequence shown in SEQ ID NO: 1 is T, it is beneficial to goats with higher lambing performance, which is of great significance to goat breeding and breeding.

[0044] The present application combines low-depth resequencing with genotype filling, and uses the GWAS analysis strategy to screen the significant SNP molecular marker affecting the lambing number of goats, which is used in molecular marker assisted selection and genome selection, and the genotype beneficial to the increase of the lambing number of goats is selected for breeding, so that the gene frequency of the dominant allele is increased generation by generation, and the process of sheep breeding improvement is accelerated, which brings great economic benefits to goat breeding. The present application verifies the influence effect of the SNP molecular marker on the lambing performance of goats, which can be applied to genetic improvement of improving the average lambing number of sheep, so as to improve the lambing performance of offspring, and further increase the market competitiveness of breeding enterprises.

[0045] In order to make the purpose, technical scheme and advantages of the present application clearer, the technical scheme in the present application will be described clearly and completely below. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor belong to the scope of protection of the present application.

[0046] The endpoints and any values ​​of the ranges disclosed in this specification are not limited to the exact ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be considered to be specifically disclosed herein.

[0047] In the description of this specification, the reference terms "one embodiment", "some embodiments", "specific implementation methods", or "some specific implementation methods" and the like mean that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the embodiments of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine different embodiments or examples described in this specification and features of different embodiments or examples without contradiction.

[0048] Unless otherwise specified, the materials and reagents used in the following examples are all commercially available. Experimental methods without specific conditions specified in the examples are generally performed under conventional conditions or the conditions recommended by the manufacturer.

[0049] Example 1

[0050] This embodiment provides a whole genome resequencing method, which is as follows:

[0051] 1. Blood sample collection and leukocyte separation.

[0052] Use a veterinary lancet to collect 5 mL of blood from the goat's jugular vein into an EDTA anticoagulant tube. Place the anticoagulant tube in an ice box with plenty of ice packs and bring it back to the laboratory. Store the sample in a refrigerator at 4°C for leukocyte extraction. The specific steps are as follows:

[0053] (1) Take 2-3 mL of blood sample and place it in a 10 mL EP tube.

[0054] (2) Add ultrapure water to the EP to make the total liquid volume 9 mL.

[0055] (3) Slowly turn the EP tube upside down 20 times and let it stand for 10 minutes.

[0056] (4) Place the EP tube into a centrifuge and centrifuge at 5000 rpm for 10 minutes.

[0057] (5) Slowly pour out the supernatant from the EP tube.

[0058] (6) Add ultrapure water again to make the total volume of the liquid 9 mL.

[0059] (7) Repeat steps (3), (4), and (5).

[0060] (8) After the separation of the white blood cells is completed, number them and place them in a -80°C refrigerator.

[0061] 2. Genomic DNA extraction and whole genome resequencing.

[0062] The genomic DNA extraction kit (item number: d3024) of Tianmo Biology was used to extract the DNA from the white blood cells, and the specific method is described in the instruction manual. The qualified genomic DNA was sent to Beijing Nuowozhengyuan Technology Co., Ltd. for secondary inspection and library construction, and PE150 whole genome resequencing was performed on the Huada Gene platform. The original data was obtained, and the format of the original data was FASTQ. 34 samples were subjected to high-depth whole genome resequencing, with an average sequencing depth of about 19.72x, and the total data size was 1.4T; 466 samples were subjected to low-depth whole genome resequencing, with an average sequencing depth of about 1.65x, and the total data size was 1.6T.

[0063] Example 2

[0064] This example provides a genomic alignment, genetic variation detection, and genotype filling method, which is as follows:

[0065] 1. Analysis of raw sequencing data and genomic alignment.

[0066] High-depth sequencing data and low-depth sequencing data use the same process for quality control.

[0067] (1) The raw data was filtered using Fastp software, and the filtering criteria were as follows: removing reads with a base quality value of less than 20, with a proportion of more than 30%; n-base reads with a proportion of more than 5%. After the above quality control steps, clean reads were obtained.

[0068] (2) The clean reads were aligned to the goat reference genome (Capra_hircus.ARS1.2) using BWA software.

[0069] (3) The sorted BAM file after alignment was obtained using Samtools software.

[0070] (4) Repeat reads were marked using Picard.

[0071] (5) Samtools software was used to construct an index.

[0072] 2. Variation site detection and genotype filling.

[0073] (1) GATK Haploytype Caller generates gvcf files for each sample respectively according to the chromosome number.

[0074] (2) GATK Combine GVCFs combines gvcf files of each sample of single chromosome.

[0075] (3) GATK Genotype GVCFs performs population SNP calling according to chromosomes.

[0076] (4) GATK Merge Vcfs combines population vcf files of autosomes.

[0077] (5) GATK Select Variants screens SNPs of population vcf files.

[0078] (6) GATK Variant Filtration marks false positive SNP sites.

[0079] (7) grep command filters marked SNP sites

[0080] (8) Plink software filters SNP sites (geno 0.1 --maf 0.05 --hwe 1e-06).

[0081] (9) Beagle software fills missing sites.

[0082] (10) Population genomic genetic variation detection and typing are performed using Sentieon Haplotyper and GVCFtyper modules.

[0083] (11) Genotype filling is performed using Beagle, and finally 26131221 high-quality SNPs are obtained.

[0084] Example 3

[0085] The present example provides the application of the rs669481944 molecular marker typing method in goat lambing number association analysis, which is as follows:

[0086] Association analysis of rs669481944 molecular marker and goat lambing number.

[0087] (1) The phenotypes for genotype and lambing number association analysis were measured by professional technicians strictly according to the measurement specification. The live weight of the sheep was determined by weighing at 360±15 days of age, after fasting for 12-16h and water deprivation for 2h, and was expressed in kilograms (kg). A total of 500 samples were measured.

[0088] (2) GWAS analysis was performed on the SNP loci and the average number of lambs using the FarmCPU model using rMVP software.

[0089] The FarmCPU model uses a fixed-effect model and a random-effect model for iteration. The fixed-effect analysis model is as follows:

[0090] y=Xb+Z t u t +S i d i +e

[0091] Where y is the observer vector of the trait; b is the individual fixed effect vector, including the first three principal components of SNP, birth season, birth order and birth weight; u t is the nucleotide genotype matrix of t pseudo quantitative traits as fixed effects; X and Z t b and u respectively t The correlation matrix of S i is the i-th SNP marker, d i is the corresponding effect value; e is the random residual effect vector, which conforms to the normal distribution e~N(0,Iσ e 2 ).

[0092] The results of GWAS analysis showed that rs669481944 was significantly associated with goat litter size. The effects of different genotypes of this marker on goat litter size are shown in Table 1.

[0093] Table 1 Effects of different genotypes of rs669481944 on the number of litters born in goats

[0094]

[0095] Note: When the P value of the marker is <1E-05 (Bonferroni correction), it is considered significant.

[0096] As shown in Table 1, for the average number of lambs born of Chubao black-head sheep, the average number of lambs born of individuals with genotype AT or TT was significantly higher than that of AA individuals, indicating that T is an allele that is beneficial to increasing the number of lambs born.

[0097] It should be pointed out finally that the above embodiments are only the preferred embodiments of the present application, which are used to illustrate the technical solutions of the present application, but not to limit the same; although the present application has been described in detail with reference to the foregoing embodiments, it should be understood by those skilled in the art that the technical solutions recorded in the foregoing embodiments can be modified, or some technical features can be replaced equivalently; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application; therefore, any modification, equivalent replacement, improvement, etc. within the spirit and principles of the present application should be included in the protection scope of the present application.

Claims

1. A SNP molecular marker associated with goat lambing traits, characterized in that: The SNP molecular marker is located at the 51st bp of the nucleotide sequence shown in SEQ ID NO.01, and the polymorphism is A / T.

2. The SNP molecular marker according to claim 1, characterized in that The genotype of the polymorphic site contained in the SNP molecular marker is AT or TT, which corresponds to the relative advantage of the lambing trait of the goats to be tested.

3. The SNP molecular marker according to claim 1, characterized in that The genotype of the polymorphic site contained in the SNP molecular marker is AA, which corresponds to the relative disadvantage of the lambing trait of the goats to be tested.

4. A method for detecting a SNP molecular marker according to any one of claims 1 to 3, characterized in that: PCR primers for amplifying genomic DNA fragments including the SNP molecular marker or a kit containing the primers.

5. Use of the SNP molecular marker according to any one of claims 1 to 3 or the substance according to claim 4 in at least one of the following: (1) Application in identifying goat lambing traits; (2) Application in predicting goat lambing traits; (3) Application in goat resource identification, improvement or molecular marker-assisted breeding.

6. The use according to claim 5, characterized in that The lambing traits include average lamb number.

7. The use according to claim 6, characterized in that The breeds of goats include Chubao Blackhead sheep.

8. A method for detecting reproductive traits of goats, characterized in that: include: The single nucleotide labeled N in the sequence of goat SEQ ID NO: 1 is detected to determine whether it is A or T, and the reproductive traits of the goat are determined based on the detection results.

9. The method for detecting goat reproductive traits according to claim 8, wherein The genotype of the Chubao black-headed sheep to be tested is performed using primers amplifying the sequence SEQ ID NO:

1. If the genotype is AT or TT, the average lambing number of the tested individual is determined to be relatively advantageous.

10. A genetic breeding method for increasing goat litter size, characterized in that: Determine the SNP molecular markers described in claim 1 of the breeding sheep in the goat core group, and make corresponding selections based on the goat SNP molecular markers: for the successive breeding of breeding sheep, select individuals whose 51st base in the SNP marker is AT type and / or TT type, and eliminate AA type individuals, so as to increase the frequency of gene C at this site from generation to generation, thereby improving the lambing performance of offspring goats.

Images