Quality control product for nucleic acid detection of bacillus plague and virulence gene of bacillus plague as well as preparation method and application of quality control product

Abstract

The invention relates to the technical field of genetic engineering and molecular detection, and particularly provides a quality control product for nucleic acid detection of bacillus plague and virulence genes thereof as well as a preparation method and application of the quality control product, and comprises a recombinant artificial chromosome vector, an engineering bacterium and a preparation method and an application scene of the engineering bacterium. The artificial chromosome engineering bacteria are constructed by designing and preferably selecting conserved target sequences of four bacillus plague detection key genes, so that the problems of poor biological safety, insufficient stability and limited broad spectrum of a traditional quality control product are solved, clinical sample characteristics can be effectively simulated, nucleic acid stability and batch-to-batch consistency are ensured, and the application prospect is wide. A standardized reference system is provided for nucleic acid detection of the bacillus plague, and the method can be widely applied to the fields of laboratory quality control and public health safety prevention and control.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of genetic engineering and gene detection technology, and particularly relates to a Yersinia pestis species and its virulence gene nucleic acid detection quality control product and a preparation method and application thereof. BACKGROUND

[0002] Yersinia pestis is a gram-negative short bacillus, which is the pathogen causing plague. Plague is listed as a class A infectious disease in China, and its high infectivity and lethality pose a serious threat to public health safety. At present, nucleic acid detection techniques such as PCR and qPCR have become the core means for Yersinia pestis detection due to their high sensitivity, and common detection targets include universal detection genes such as 3a gene, chromosome 392 site gene chro392, and key virulence genes such as capsular antigen F1 encoding gene caf1 and plasminogen activator encoding gene pla. The presence and expression level of these genes directly reflect the pathogenic ability of Yersinia pestis, and are important indicators for evaluating its virulence level and epidemic risk. To ensure the reliability and accuracy of Yersinia pestis nucleic acid detection results, it is crucial to establish a scientific and stable quality control system. However, the standardization and quality control of current Yersinia pestis nucleic acid detection still face many technical challenges. The existing commercial quality control products mainly use plasmid DNA or inactivated strains, both of which have significant limitations. Conventional plasmid DNA lacks the natural chromatin structure, and cannot accurately simulate the extraction efficiency and amplification behavior of chromatin genomic DNA in clinical samples, which may lead to biased detection results. Although inactivated strains retain the integrity of bacterial chromatin genome, there are bio-safety risks, such as the safety risk of residual live bacteria due to incomplete inactivation, and the poor stability of strain culture and passage, making it difficult to ensure the consistency and uniformity of batches. In addition, the key virulence genes caf1 and pla of Yersinia pestis have significant sequence differences between strains, and traditional quality control products containing only a single strain sequence may lead to missed detection of variant strains by detection reagents, so it is urgent to develop quality control products that can cover multiple types of strains to verify the broad-spectrum and universality of the detection method.

[0003] In terms of bio-safety and standardization, the use of live Yersinia pestis or clinical samples as quality control materials requires strict operation in a biosafety level three (BSL-3) laboratory, which greatly limits its operability. Although synthetic DNA fragments avoid bio-safety risks, they cannot simulate the physical behavior of long chromosomal DNA during nucleic acid extraction, such as adsorption loss, which affects the accuracy of quantitative results. Although bacterial artificial chromosome (BAC) technology has the advantage of stably carrying large fragments of DNA, its traditional application is mainly focused on gene library construction or protein expression fields, such as baculovirus-insect cell system protein expression, and has not been innovatively applied to solve the quality control product design problem of pathogen nucleic acid detection.

[0004] At present, there is a obvious technical blank in the field of quality control products for BAC system, how to construct a combined quality control product which has no biological risk, can reserve the characteristics of chromosomes, covers multiple strains and has better stability than plasmids, becomes the key technical bottleneck of the industry which needs to be broken through. This breakthrough will have important significance for improving the accuracy and reliability of plague bacillus detection and protecting the public health monitoring and prevention of class A infectious diseases. SUMMARY

[0005] The application provides a quality control product for plague bacillus and virulence gene nucleic acid detection and a preparation method and application thereof. Through bioinformatics analysis, the application designs and optimizes the conserved target sequences of four commonly used key genes for plague bacillus detection, and integrates these sequences into an artificial chromosome to construct an engineering strain without biological safety hazards. The engineering strain shows excellent stability and the ability to simulate clinical samples in the nucleic acid extraction, amplification and detection process, solves the deficiencies of existing quality control products in biological safety, stability and broad-spectrum, and provides a standardized and universally applicable reference system for plague bacillus nucleic acid detection.

[0006] To achieve the above technical purposes, the technical scheme adopted by the application is:

[0007] A quality control product for plague bacillus and virulence gene nucleic acid detection, the quality control product is an engineering bacteria carrying a recombinant artificial chromosome vector, and the recombinant artificial chromosome vector comprises the following four conserved fragments of plague bacillus detection genes:

[0008] (1)鼠疫杆菌的3a基因保守片段,其核酸序列如SEQ ID NO.1所示,具体为:TTGCGTCTGTATTGCTGAGAAAAGAGCGAAGCTACGCGGAGATTTAT AACGATTTAGATGGCGACGTGGTTAATCTCTTTTTCGTTCTGCGCGATATGACACTGCGTGAATGCCTTATCGAGGCATTAATTTTAACCCCCTACTCTCGCGATGAATTTACCGATGCATACGGCGAAGCGGAAACGATGGTCGAGAGGGCGCGGAAATTAGTCATCAGGGCAACAATGGGATTTGGTTCTGCTGGCGCGACCAAGGGAACAACTGGTTTTCGGCTGGATACCAAACGCGGTTCGGCAACAGCTCAACACCTTTGGGCAAGGATGCCTGAAAACTTGGCAGCAGTTGGCCAGCGATTCGAGGGCGTTTTGGTAGAGAATCGTGATGCCGTCCAATGCATGTTAGACCATGACACAGTTTCAACGCTTCATTTTGTTGACCCGCCATACGTCCATGACACCCGCGTTATCTCATCCCGATATTACCGCCATGAAATGGACAATGATGCCCACCTAACCCTACTCGATACCGTCAATAACCTTGAGGGGATGGTAGTGCTTAGCGGCTACAACACGGATATGTACAACGACATTCTTACAGGCTGGCAAAAGCAGGAAAAACAGTCATCGGCTGCCGGACGGAAAGGCTCGGTTAAGCGCCTTGAGTGTCTGTGGCTGAGTCCTAATGTTTTGTCTGGGAGTAAAGCAGCATGA;

[0009] (2) The conserved fragment of chro392 gene of Yersinia pestis, the nucleic acid sequence of which is shown as SEQ ID NO. 2, specifically: ATGGTGTCTACGTCATTGAAATTTGGTGGGAAGATAATTGAG GAACTATCTCAAAAAATACCTTCATCACTCTTTGCTTTGAATGAATTGGTGAAGAATTCGTATGACGCATTCTCTCCAGATGTTACCATTACAGTAATTCCATCAGAGTTAAAGATAATAATTTCCGATTACGGAAACGGTATGTCGGTAGACGAAATTCATTCTTTATTTCATATATCAAAAAGCACTAAAAAATATGGTTGCGAAGTAAGTCAGAATGGAATAAAGAGAATTGTTCAAGGTTCAAAAGGACTGGGTTTTTTATCAGCCTTTAAGTTTGGTGATAAAGTTGAATGGAAAACATGTCAAAATGGTATATGTAGTGTTTTTTCTGTAAAAAAATCAGATTTAATATATAAAGATGACGTTTCTGGAATTAAGATTCCTATAACAACAGATTCTAGCAATAAGAATGGAACTGAGATTAGAATATTTACTAATCAACAAGATATGGATGAGTTACTATCTGACTTATCCGATGAAAAGATTGCGCGGAAATTAGCAGCATCAATGTTGGATGAATCCTTTAATGTTAAAATTAAGATTGAAAATAAAGATAAGATAATATCAACAAGTAAATTGAAGTCATTTCTTTTTGAGTGTGAACAGAGTCAACTTTTTTATGTGAAATACAATTTTTCTAAAGAAGAGATTGAGTTTTTTCATAAGGGGGATAA;

[0010] (3)鼠疫杆菌毒力基因caf1的保守片段,其核酸序列如SEQ ID NO.3所示,具体为:ATAAATGAAAAAAATCAGTTCCGTTATCGCCATTGCATTATTT GGAACTATTGCAACTGCTAATGCGGCAGATTTAACTGCAAGCACCACTGCAACGGCAACTCTTGTTGAACCAGCCCGCATCACTCTTACATATAAGGAAGGCGCTCCAATTACAATTATGGACAATGGAAACATCGATACAGAATTACTTGTTGGTACGCTTACTCTTGGCGGCTATAAAACAGGAACCACTAGCACATCTGTTAACTTTACAGATGCCGCGGGTGATCCCATGTACTTAACATTTACTTCTCAGGATGGAAATAACCACCAATTCACTACAAAAGTGATTGGCAAGGATTCTAGAGATTTTGATATCTCTCCTAAGGTAAACGGTGAGAACCTTGTGGGGGATGACGTCGTCTTGGCTACGGGCAGCCAGGATTTCTTTGTTCGCTCAATTGGTTCCAAAGGCGGTAAACTTGCAGCAGGTAAATACACTGATGCTGTAACCGTAACCGTATCTAACCAAT;

[0011] (4)鼠疫杆菌毒力基因pla的保守片段,其核酸序列如SEQ ID NO.4所示,具体为:AAATGAAGAAAAGTTCTATTGTGGCAACCATTATAACTATTCT GTCCGGGAGTGCTAATGCAGCATCATCTCAGTTAATACCAAATATATCCCCTGACAGCTTTACAGTTGCAGCCTCCACCGGGATGCTGAGTGGAAAGTCTCATGAAATGCTTTATGACGCAGAAACAGGAAGAAAGATCAGCCAGTTAGACTGGAAGATCAAAAATGTCGCTATCCTGAAAGGTGATATATCCTGGGATCCATACTCATTTCTGACCCTGAATGCCAGGGGGTGGACGTCTCTGGCTTCCGGGTCAGGTAATATGGATGACTACGACTGGATGAATGAAAATCAATCTGAGTGGACAGATCACTCATCTCATCCTGCTACAAATGTTAATCATGCCAATGAATATGACCTCAATGTGAAAGGCTGGTTACTCCAGGATGAGAATTATAAAGCAGGTATAACAGCAGGATATCAGGAAACACGTTTCAGTTGGACAGCTACAGGTGGTTCATATAGTTATAATAATGGAGCTTATACCGGAAACTTCCCGAAAGGAGTGCGGGTAATAGGTTATAACCAGCGCTTTTCTATGCCATATATTGGACTTGCAGGCCAGTATCGCATTAATGATTTTGAGTTAAATGCATTATTTAAATTCAGCGACTGGGTTCGGGCACATGATAATGATGAGCACTATATGAGAGATCTTACTTTCCGTGAGAAGACATCCGGCTCACGTTATTATGGTACCGTAATTAACGCTGGATATTATGTCACACCTAATGCCAAAGTCTTTGCGGAATTTACATACAGTAAATATGATGAGGGCAAAGGAGGTACTCAGACCATTGATAAGAATAGTGGAGATTCTGTCTCTATTGGCGGAGATGCTGCCGGTATTTCCAATAAAAATTATACTGTGACGGCGGGTCTGCAATATCGCTTCTGAGA;

[0012] Furthermore, the conserved fragment of the 3a gene of Yersinia pestis is 708 bp in size.

[0013] Furthermore, the size of the conserved fragment of the chro392 gene of Yersinia pestis is 723 bp.

[0014] Furthermore, the conserved fragment of the Yersinia pestis virulence gene caf1 is 513 bp in size.

[0015] Furthermore, the conserved fragment of the Yersinia pestis virulence gene pla is 939 bp in size.

[0016] Furthermore, the method for constructing the recombinant artificial chromosome vector comprises the following steps:

[0017] S1. Obtain the full-length sequences of the 3a gene, chro392 gene, and virulence genes caf1 and pla of Y. pestis. Use a multiple sequence alignment tool to remove insertions and deletions to identify conserved fragments. Synthesize conserved fragments of the four Y. pestis detection genes and clone them into pUC plasmids.

[0018] S2. The conserved fragments of the four Yersinia pestis detection genes were amplified using the specific primer pairs 3a-MF / R, chro392-MF / R, caf1-MF / R, pla-MF / R and Q5 enzyme, respectively. The nucleic acid sequence of the specific primer 3a-MF is shown in SEQ ID NO.5, specifically: CTCTAGTACTTCTCGACA AGCTTGCGTCTGTATTGCTGAGAAAAGA; the nucleic acid sequence of the specific primer 3a-MR is shown in SEQ ID NO.6, specifically: AATTTCAATGACGTAGACCACCATTCATGCTGCTTTACTCCCAGA; the nucleic acid sequence of the specific primer chro392-MF is shown in SEQ ID NO.7, specifically: TCTGGGAGTAAAGCAGCATGAATGGTGTCTACGTCATTG AAATT; the nucleic acid sequence of the specific primer chro392-MR is shown in SEQ ID NO.8, specifically: TCTGGGAGTAAAGCAGCATGAATGGTGTCTACGTCATTG AAATT. NO.8, specifically: CTGATTTTTTTCATTTATTTATCCCCCTTATGAAAAAACTCAATCTC; the nucleic acid sequence of the specific primer caf1-MF is shown in SEQ ID NO.9, specifically: TAAATAAATGAAAAAAATCAGTTCCGTTATCGC; the nucleic acid sequence of the specific primer caf1-MR is shown in SEQ ID NO.10, specifically: AGAACTTTTCTTCATTTATTGGTTAGATACG GTTACGGTTAC; the nucleic acid sequence of the specific primer pla-MF is shown in SEQ ID NO.11, specifically: ATCTAACCAATAAATGAAGAAAAGTTCTATTGTGGCAA; the nucleic acid sequence of the specific primer pla-MR is shown in SEQ ID NO.12, specifically: TCCAGGGTCCTA GATCTGAATTCTCAGAAGCGATATTGCAGACC;

[0019] S3. Double digest the pBac-N-EGFP vector with EcoR I and Hind III restriction enzymes;

[0020] S4. Using a homologous recombination kit, the conserved fragments of the four Y. pestis detection genes were seamlessly connected to the linearized vector pBac-N-EGFP;

[0021] S5. Transform the ligation product into competent E. coli DH5α cells, screen positive clones by bacterial liquid PCR and verify by sequencing.

[0022] Furthermore, the method for preparing the engineered bacteria carrying the recombinant artificial chromosome vector comprises the following steps:

[0023] S1. The recombinant artificial chromosome vector was transformed into competent cells DH10Bac and cultured in LB solid medium containing kanamycin, tetracycline, gentamicin, X-Gal and IPTG;

[0024] S2. Pick a white monoclonal colony and inoculate it into LB liquid medium containing kanamycin, tetracycline, and gentamicin for expansion;

[0025] S3. The artificial chromosome DNA of the engineered bacteria was extracted and verified by PCR and sequencing analysis using specific primers pUC / M13-F and pUC / M13-R. The nucleic acid sequence of the specific primer pUC / M13-F is shown in SEQ ID NO.13, specifically: CCCAGTCACGACGTTGTAAAACG; the nucleic acid sequence of the specific primer pUC / M13-R is shown in SEQ ID NO.14, specifically: AGCGGATA ACAATTTCACACAGG.

[0026] Furthermore, the method for preparing the quality control product comprises the following steps:

[0027] S1. Heat-inactivate the engineered bacterial culture at 60°C for 1 hour;

[0028] S2. The inactivated engineered bacteria were serially diluted with phosphate buffered saline to extract bacterial artificial chromosome DNA at different concentrations;

[0029] S3. Determine the nucleic acid concentration in the quality control sample by digital PCR quantitative analysis;

[0030] S4. Dilute the control product of known concentration to obtain the finished quality control product of the required concentration.

[0031] Furthermore, the quality control product can be used for quality control of Yersinia pestis and its virulence gene nucleic acid detection and added to the reaction system as a positive control; it can be used to evaluate the analytical sensitivity, specificity, precision and repeatability of the Yersinia pestis nucleic acid detection kit; and it can be used to optimize the extraction efficiency of nucleic acid extraction reagents for long-fragment DNA target genes.

[0032] Beneficial effects of the present invention:

[0033] (1) By optimizing the designed conserved sequences, four key target genes of Yersinia pestis were integrated, overcoming the limitation of traditional quality control products that only contain a single strain sequence, and significantly improving the broad spectrum and versatility of the detection method.

[0034] (2) The artificial chromosome technology was used to construct the engineered bacteria, which retained the physical properties of long-fragment DNA and could simulate the extraction behavior of chromosomal DNA in clinical samples, thus solving the problem that synthetic DNA fragments could not simulate adsorption loss.

[0035] (3) The engineered bacteria have been heat-inactivated, completely eliminating biosafety risks while maintaining the integrity and stability of the nucleic acid, making it easier to store and transport them over a long period of time.

[0036] (4) Digital PCR technology is used to perform absolute quantification of quality control products, ensuring the accuracy and batch consistency of quality control product concentrations, and providing a reliable standard for quality evaluation between laboratories.

[0037] By constructing engineered bacteria carrying artificial chromosomes, the present invention provides a quality control product that is bio-risk-free, stable, controllable, and broad-spectrum. It can be widely used in the standardization and quality control of plague bacillus nucleic acid detection, providing important technical support for public health safety. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is the electrophoresis diagram of the bacterial solution PCR identification of the pBac-YEPE plasmid vector in Example 2.

[0039] Figure 2 This is a map of the pBac-YEPE plasmid vector constructed in Example 2, with only the elements relevant to this application marked.

[0040] Figure 3 These are the results of the quality control product and plasmid nuclease resistance test of the Yersinia pestis caf1 gene target in Example 6.

[0041] Figure 4 These are the results of the quality control product and plasmid nuclease resistance test of the Yersinia pestis chro392 gene target in Example 6.

[0042] Figure 5 These are the results of the quality control product and plasmid nuclease resistance testing of the Yersinia pestis pla gene target in Example 6.

[0043] Figure 6 This is the result of validating the ability of the quality control product to monitor nucleic acid extraction in Example 7 for the target site of the Yersinia pestis caf1 gene.

[0044] Figure 7 This is the result of validating the nucleic acid extraction monitoring capability of the quality control product for the Yersinia pestis chro392 gene target in Example 7.

[0045] Figure 8 This is the result of verifying the ability of the quality control product to monitor nucleic acid extraction in Example 7 for the target site of the Yersinia pestis pla gene.

[0046] Figure 9 These are the results of the stability test of the quality control product for the Yersinia pestis caf1 gene target in Example 8.

[0047] Figure 10 These are the results of the stability test of the quality control product for the Yersinia pestis chro392 gene target in Example 8.

[0048] Figure 11 This is the result of the stability of the quality control product detected by the Yersinia pestis pla gene target in Example 8.

[0049] Figure 12 This is the curve of specific amplification of the Yersinia pestis caf1 gene target detection quality control product at different dilution gradients in Example 9.

[0050] Figure 13 These are the results of the linearity and amplification efficiency of the quality control product for the Yersinia pestis caf1 gene target detection in Example 9.

[0051] Figure 14 This is the curve of specific amplification of the Yersinia pestis chro392 gene target detection quality control product at different dilution gradients in Example 9.

[0052] Figure 15 These are the results of the linearity and amplification efficiency of the quality control product for the Yersinia pestis chro392 gene target detection in Example 9.

[0053] Figure 16 This is the curve of specific amplification of the Yersinia pestis pla gene target detection quality control product at different dilution gradients in Example 9.

[0054] Figure 17 These are the results of the linearity and amplification efficiency of the quality control product for the Yersinia pestis pla gene target detection in Example 9.

[0055] Figure 18 These are the results of the repeatability of the quality control product for the target site detection of the Yersinia pestis caf1 gene in Example 10.

[0056] Figure 19 These are the results of the repeatability of the quality control product for the Yersinia pestis chro392 gene target detection in Example 10.

[0057] Figure 20 This is the result of the repeatability of the quality control product for the Yersinia pestis pla gene target detection in Example 10. DETAILED DESCRIPTION

[0058] In order to enable those skilled in the art to better understand the technical solutions of the present invention, the present application will be further described in detail below with reference to the embodiments.

[0059] Example 1: Determination and synthesis of conserved fragments of Yersinia pestis target genes

[0060] The full-length sequences of the 3a gene, chro392 gene, and virulence genes caf1 and pla of different geographical isolates of Y. pestis were obtained from the NCBI database. Multiple sequence alignment was performed using MAFFT and Clustal Omega software. Obvious insertions and deletions were removed to ensure the accuracy and conservation of the alignment. Attention was paid to avoiding overlap with host or other non-target pathogen sequences in characteristic conserved regions.

[0061] Taking the 3a gene of Yersinia pestis as an example, a conserved region of 708 bp in length (SEQ ID NO. 1) was obtained from the 3a gene sequences of 20 different strains. Similarly, conserved fragments of the other three genes (SEQ ID NO. 2, SEQ ID NO. 3, and SEQ ID NO. 4) were determined. GenScript Biotech was commissioned to perform full gene synthesis and cloned into the conventional plasmid pUC57. The resulting plasmids included the pUC57-YEPE-3a-M plasmid containing the conserved sequence target fragment of the Yersinia pestis 3a gene, the pUC57-YEPE-chro392-M plasmid containing the conserved sequence target fragment of the Yersinia pestis chro392 gene, the pUC57-YEPE-caf1-M plasmid containing the conserved sequence target fragment of the Yersinia pestis virulence gene caf1, and the pUC57-YEPE-pla-M plasmid containing the conserved sequence target fragment of the Yersinia pestis virulence gene pla.

[0062] Example 2 Construction of pBac-YEPE Plasmid Vector of Yersinia pestis

[0063] 1. PCR Amplification and Purification of Conserved Fragments of Four Yersinia pestis Detection Genes

[0064] Specific primer pairs YEPE-3a-MF / R, YEPE-chro392-MF / R, YEPE-caf1-MF / R, and YEPE-pla-MF / R were designed, with sequences shown in SEQ ID NOs. 5-12 (see Table 1 for details) for the construction of the plasmid vector pBac-YEPE. PCR amplification was performed using the four specific primer pairs to obtain the four synthesized target fragments. The PCR reaction system is shown in Table 2. The PCR reaction procedure is shown in Table 3. After the reaction, the amplified product was subjected to agarose electrophoresis and purified using a Takara gel recovery kit to recover the target fragment.

[0065] Table 1 Nucleic acid sequences of amplification primers of conserved sequences

[0066]

[0067] Table 2 PCR reaction system

[0068]

[0069] Table 3 PCR reaction program

[0070]

[0071] 2. Preparation of Linearized Vector pBac-N-EGFP

[0072] The plasmid pBac-N-EGFP was double-digested with restriction endonucleases Hind III and EcoR I. The digestion reaction system is shown in Table 4, and the digestion procedure is shown in Table 5. The linear vector pBac-N-EGFP was purified and recovered using a Takara gel recovery kit for fragment ligation.

[0073] Table 4 Enzyme digestion reaction system

[0074] Components Addition amount pBac1-N-EGFP plasmid 1.5 μg Restriction endonuclease EcoRI 1.0μL Restriction endonuclease Hind III 1.0μL 10×M buffer 5.0μL <![CDATA[ddH2O]]> Add to 50 μL

[0075] Table 5 Enzyme digestion reaction procedures

[0076] temperature time 37℃ 3h

[0077] 3. Ligation of linear vector and target fragment

[0078] Using Takara's homologous recombination kit HD Cloning Plus: Seamlessly ligate the target fragment (SEQ ID NOs. 1-4) into the linearized vector pBac-N-EGFP. 10 μL of the reaction mixture is as shown in Table 6. Ligate at 50°C for 15 minutes.

[0079] Table 6 Ligation reaction system

[0080] Components Addition amount 5×In-Fusion HD Enzyme Premix 2μL YEPE-3a-M (SEQ ID NO. 1) 50-100ng YEPE-chro392-M (SEQ ID NO. 2) 50-100ng YEPE-caf1-M (SEQ ID NO. 3) 50-100ng YEPE-pla-M (SEQ ID NO. 4) 50-100ng Linear vector pBac-N-EGFP 50-100ng ddH2O Add to 10 μL

[0081] 4. Conversion

[0082] Add the ligation product to Takara competent E. coli DH5α cells and mix gently. After placing on ice for 30 minutes, place in a 42°C water bath for 45 seconds. Immediately remove the cell and place on ice for 2 minutes. Add 700 μL of SOC liquid medium (previously incubated at 37°C) and incubate at 37°C with shaking (180 rpm) for 1 hour. Spread an appropriate amount onto an LB plate containing 100 μg / mL ampicillin. Finally, incubate the plate inverted at 37°C overnight.

[0083] 5. Positive Plasmid Identification

[0084] Two monoclonal colonies were picked and PCR was performed on the bacterial solution using the specific primer pairs YEPE-3a-MF / R, YEPE-chro392-MF / R, YEPE-caf1-MF / R and YEPE-pla-MF / R (sequences shown in SEQ ID NO. 5-12, see Table 1 for details). The PCR reaction system is shown in Table 7, and the PCR reaction procedure is shown in Table 8. After the reaction, a small amount of the amplified product was taken for agarose gel electrophoresis detection, and the results screened out monoclonal colonies with the target bands, such as Figure 1 The clones that were positive for PCR in the bacterial solution were extracted and sequenced. The sequence was identical to the designed conserved sequence and was named pBac-YEPE plasmid vector. The map is shown in Figure 2 shown.

[0085] Table 7 PCR reaction system

[0086]

[0087] Table 8 PCR reaction program

[0088]

[0089] Example 3 Construction and Verification of Engineered Bacteria Carrying Recombinant Artificial Chromosome Vectors

[0090] 1. Construction of engineered bacteria carrying recombinant artificial chromosome vectors

[0091] Add 100 ng of pBac-YEPE plasmid to competent DH10Bac cells and place on ice for 30 minutes. Heat shock the cells in a 42°C water bath for 80 seconds, then immediately place on ice for 3 minutes. Add 700 μL of LB medium and incubate at 37°C with a shaker at 200 rpm for 4 hours. Spread 200 μL of the culture medium evenly onto a fixed LB medium containing 50 μg / mL kanamycin, 7 μg / mL tetracycline, 10 μg / mL gentamicin, 40 μg / mL X-Gal, and 40 μg / mL IPTG. Incubate the plate upside down in a 37°C incubator for 48 hours.

[0092] Positive white monoclonal colonies were picked and transferred to 4 mL of LB liquid medium containing 50 μg / mL kanamycin, 7 μg / mL tetracycline, and 10 μg / mL gentamicin, and cultured at 37°C and 200 rpm for 20 h. The artificial chromosome DNA of the engineered bacteria (i.e., the DNA containing the sequence shown in SEQ ID NO. 1-4) was extracted using the Omega BAC / PAC large basic plasmid extraction kit.

[0093] 2. PCR Verification of Artificial Chromosomes of Engineered Bacteria

[0094] 1 μg of artificial chromosome DNA of the engineered bacteria was taken as a template, and specific primers pUC / M13-F and pUC / M13-R were used for PCR verification and sequencing (sequences are shown as SEQ ID NO. 13-14, see Table 9 for details). After PCR identification and sequencing alignment, no error was found, and the next step experiment was carried out. The PCR reaction system is shown in Table 10, and the PCR amplification reaction conditions are shown in Table 11.

[0095] After the reaction, a small amount of amplification product was taken for agarose gel electrophoresis detection, and the results showed that the target band size was correct, containing the target gene and part of the vector junction region sequence. The correct size of the PCR product was taken for sequencing, and the sequence was the same as the designed conservative sequence, indicating that the engineered bacteria carrying the artificial chromosome were successfully constructed.

[0096] Table 9 primer sequence

[0097] Primer name Primer sequence (5'-3') pUC / M13-F CCCAGTCACGACGTTGTAAAACG(SEQ ID NO.13) pUC / M13-R AGCGGATAACAATTTCACACAGG(SEQ ID NO.14)

[0098] Table 10 PCR reaction system

[0099]

[0100] Table 11 PCR reaction conditions

[0101]

[0102] Example 4: Strain preservation of engineered bacteria carrying artificial chromosome and its use method

[0103] 1. Strain preservation of engineered bacteria carrying artificial chromosome:

[0104] Prepare the strain preservation solution: sterilize the glycerol and LB liquid medium by dispensing, so that the LB medium is prepared to a final concentration of LB medium containing 50 μg / mL kanamycin, 7 μg / mL tetracycline, 10 μg / mL gentamicin, and glycerol is diluted 1:1.

[0105] Take 500 μL of its bacterial solution for preservation, add 500 μL of diluted glycerol, mix evenly, and place in a 1.5 mL EP tube, label the strain number, strain name, preservation date, and operator information, then backup the glycerol bacteria in the -80°C refrigerator.

[0106] 2. Use method of engineered bacteria carrying artificial chromosome:

[0107] Take out the glycerol bacteria, rewarm at room temperature until melted; take out a small amount of bacterial liquid for coating, culture in LB fixed culture medium containing 50 μg / mL kanamycin, 7 μg / mL tetracycline, 10 μg / mL gentamicin, 40 μg / mL X-Gal, 40 μg / mL IPTG, and invert the plate in a 37°C constant temperature incubator for 48 h. Pick positive white monoclonal colonies into 4 mL of LB liquid medium containing 50 μg / mL kanamycin, 7 μg / mL tetracycline, 10 μg / mL gentamicin, and culture at 37°C, 200 rpm for 20 h. The bacterial liquid is used to extract artificial chromosome DNA for subsequent quality control product test experiments.

[0108] Example 5 Preparation of plague bacillus quality control product raw materials and finished products

[0109] 1. Heat inactivation of engineered bacteria carrying artificial chromosome culture

[0110] Put the centrifuge tube containing the engineered bacteria culture into a 60°C water bath. Make sure it is well sealed to avoid leakage of the contents during heating. After heating for 1 hour, take out the inactivated culture as the engineered bacteria quality control product raw material.

[0111] 2. Preparation of bacterial artificial chromosome DNA extraction

[0112] Dilute the engineered bacteria quality control product raw material with phosphate buffer saline diluent by 10-fold gradient dilution to obtain 1.00E+09 to 1.00E+01 copies / mL of engineered bacteria. Use the MagaBio plus viral DNA / RNA purification kit (Hangzhou Bio-Rad Science and Technology Co., Ltd., item number BSC86S1E) to extract nucleic acids in engineered bacteria quality control products of different concentrations. Follow the kit instructions to obtain the purified nucleic acid solution finally.

[0113] 3. Digital PCR (ddPCR) quantitative analysis

[0114] Use the above extracted nucleic acid as a template to determine the copy number of nucleic acid using digital PCR method, as follows. Prepare the PCR reaction system, transfer the prepared reaction system to the digital PCR instrument for testing, the ddPCR reaction system is shown in Table 12, the ddPCR reaction conditions are shown in Table 13, and the absolute concentration of the target nucleic acid in the sample is directly obtained, thereby calculating the nucleic acid concentration in the plague bacillus quality control product.

[0115] Table 12 ddPCR reaction system

[0116] Components Addition amount PCR reaction solution 19 μL Enzyme mixture 1 μL sample 5μL

[0117] Table 13 ddPCR reaction conditions

[0118]

[0119] 4. Preparation of engineered bacteria quality control product

[0120] The Yersinia pestis quality control product raw material of known concentration is diluted to obtain the desired different concentrations of Yersinia pestis engineered bacteria quality control product.

[0121] Example 6 Nuclease resistance verification of engineered bacteria quality control product

[0122] The engineered bacteria quality control product prepared in Example 5 and the pUC57 conventional plasmid (hereinafter referred to as plasmid) in Example 1 (both are E8 copies / mL) were respectively treated with DNase I (Thermo #EN0521) at 37°C for 30 min (the working concentration is 0.1 U per ng of nucleic acid), and then inactivated at 70°C for 10 min, while not being treated as a control, and each group was repeated twice in parallel. Then the samples in each group were accumulated and diluted 100 times, and then Q-PCR detection was performed, the Q-PCR reaction system is shown in Table 14, the Q-PCR reaction conditions are shown in Table 15, and the primers and probes are shown in Table 16, and each sample was detected twice. The results are shown in Tables 17-19. Figure 3-5 , The Q-PCR detection results of the engineered bacteria quality control product before and after DNase I digestion have no difference, while the results of the plasmid before and after DNase I digestion have a large difference, indicating that the Yersinia pestis engineered bacteria quality control product prepared by the application has superior nuclease resistance, which is much higher than that of the conventional plasmid.

[0123] Table 14 ddPCR reaction conditions

[0124] Components Addition amount PCR reaction solution 19 μL Enzyme mixture 1 μL sample 5μL

[0125] Table 15 Q-PCR reaction conditions

[0126]

[0127] Table 16 Yersinia pestis chro392, caf1 and pla target primer and probe sequence table

[0128]

[0129] Table 17 Yersinia pestis quality control product and plasmid nuclease treatment result data table 1

[0130]

[0131] Note: NoCt no detection; an increase in CT value indicates that the template is degraded by nuclease.

[0132] Table 18 Yersinia pestis quality control product and plasmid nuclease treatment result data table 2

[0133]

[0134] Note: NoCt is not detected; an increase in CT value indicates that the template is degraded by nucleases.

[0135] Table 19. Data Table 3 for the treatment of Yersinia pestis quality control products and plasmid nuclease

[0136]

[0137] Note: NoCt is not detected; an increase in CT value indicates that the template is degraded by nucleases.

[0138] Example 7 Capacity Verification of Yersinia pestis Quality Control for Nucleic Acid Extraction Monitoring

[0139] The Yersinia pestis engineered bacteria quality control products with a concentration of 5.00E+06 copies / mL and 5.00E+03 copies / mL and the pUC57 conventional plasmid were subjected to nucleic acid extraction and non-extraction comparative tests (QPCR reaction conditions were the same as in Example 6). The results are shown in Tables 20-22, Figure 6-8 As shown, the quality control product of Yersinia pestis engineered bacteria must be detected through nucleic acid extraction, and cannot be detected without nucleic acid extraction, while the plasmid can be detected regardless of whether nucleic acid extraction is performed and the Ct value is the same, indicating that the quality control product of Yersinia pestis engineered bacteria prepared by the present invention can effectively monitor the nucleic acid extraction link, while conventional plasmids do not have this effect.

[0140] Table 20 Results of the quality control products and plasmid extraction monitoring capability verification of Yersinia pestis engineered bacteria Table 1

[0141]

[0142] Note: NoCt was not detected.

[0143] Table 21 Data table 2 of the monitoring capability verification results of Yersinia pestis engineered bacteria quality control products and plasmid extraction

[0144]

[0145] Note: NoCt was not detected.

[0146] Table 22 Data table 3 of the monitoring capability verification results of Yersinia pestis engineered bacteria quality control products and plasmid extraction

[0147]

[0148] Note: NoCt was not detected.

[0149] Example 8 Stability Test of Engineering Bacteria Quality Control

[0150] According to the standard JJF1343-2022 “Standard Material Valuation and Uniformity, Stability Evaluation”, the stability is stored at 4℃, 25℃ and 37℃ for 0 days and 5 days, respectively. Two units are extracted at each temperature at each time point, and Q-PCR detection (QPCR reaction conditions are the same as in Example 6) is performed twice for each unit. The detection results are shown in Tables 23-25, Figure 9-11 The detection results of the Yersinia bacteria engineering bacteria quality control product stored at different temperatures are not significantly different. The Ct value of the plasmid stored at 4℃ is smaller, and the Ct value stored at 25℃ and 37℃ is significantly larger. It shows that the Yersinia bacteria engineering bacteria quality control product prepared by the application has outstanding and excellent stability, and the conventional plasmid has poor stability.

[0151] Table 23 Ct value statistical results of Yersinia bacteria engineering bacteria quality control product storage stability at 4℃, 25℃ and 37℃ Table 1

[0152]

[0153] Note: No Ct is not detected; CT value increase indicates template degradation.

[0154] Table 24 Ct value statistical results of Yersinia bacteria engineering bacteria quality control product storage stability at 4℃, 25℃ and 37℃ Table 2

[0155]

[0156] Note: No Ct is not detected; CT value increase indicates template degradation.

[0157] Table 25 Ct value statistical results of Yersinia bacteria engineering bacteria quality control product storage stability at 4℃, 25℃ and 37℃ Table 3

[0158]

[0159] Note: No Ct is not detected; CT value increase indicates template degradation.

[0160] Example 9 Linear and amplification efficiency of Yersinia bacteria quality control product

[0161] The engineering bacteria quality control product and the pUC57 conventional plasmid were diluted by 10 times at a starting concentration of 1E+09 copies / mL to obtain a series of gradient dilution products. After nucleic acid extraction, Q-PCR detection (QPCR reaction conditions are the same as in Example 6) was performed, and each concentration was repeated twice. The results are shown in Table 26, Figure 12-17 According to “Performance Evaluation Requirements for Quantitative Methods of Biotechnology Nucleic Acid Target Sequences qPCR Method and dPCR Method” (GB / T42077-2022), the linear correlation coefficient and amplification efficiency of the engineering bacteria quality control product meet the standards (R 2>0.99, and the amplification efficiency E is in the range of 0.9-1.1), while the plasmid amplification efficiency E=1.31 significantly exceeds the standard range. This shows that the Y. pestis engineered bacteria quality control prepared by the present invention has good linearity and amplification efficiency and is more suitable for quality control or quantitative detection of Y. pestis nucleic acid detection than conventional plasmids.

[0162] Table 26 Results of the test on Yersinia pestis engineered bacteria quality control products and plasmid gradient dilution

[0163]

[0164] Example 10: Repeatability test of Yersinia pestis engineered bacteria quality control product

[0165] After nucleic acid extraction of the Y. pestis engineered bacteria quality control product with a concentration of 5.00E+03 copies / mL, 16 parallel qPCR tests were performed using primer probes targeting Y. pestis caf1, chro392, and pla (see Example 6 for details). The test results are shown in Tables 27 and Figure 18-20 The Ct values ​​of the quality control products were consistent across repeated tests, and the coefficient of variation (CV) of the Ct values ​​across repeated tests was no greater than 5%. These results demonstrate that the quality control products for Yersinia pestis engineered bacteria developed by the present invention have good repeatability when used for testing and can meet the quality control requirements for nucleic acid testing.

[0166] Table 27 Repeatability test results of Yersinia pestis engineered bacteria quality control products

[0167]

[0168] In summary, the pestis engineered bacteria quality control product prepared by the present invention has significant technical advantages over conventional plasmids and can provide more reliable quality control for nucleic acid detection. The quality control product exhibits extremely strong nuclease tolerance, and the test results are not affected after treatment with DNaseⅠ, effectively avoiding the risk of false negatives caused by nucleic acid degradation, while conventional plasmids are easily destroyed by enzymatic hydrolysis under the same conditions. Its unique design requires it to go through the nucleic acid extraction step before it can be detected, so that the operational effectiveness of the nucleic acid extraction link can be monitored throughout the process, ensuring the standardization of the process from sample processing to amplification, while conventional plasmids cannot achieve this key quality control function. In terms of stability, the quality control product maintains stable detection performance under different temperature conditions and is not affected by the storage environment, overcoming the detection deviation problem of conventional plasmids with temperature fluctuations. In addition, the quality control product has excellent amplification performance, the linear correlation coefficient and amplification efficiency both meet the ideal standards, the detection repeatability is good, and the coefficient of variation is controlled within 5%, providing an accurate and reliable standard reference for quantitative detection. These advantages make it an ideal quality control tool for Yersinia pestis nucleic acid detection, which can effectively improve the accuracy and reliability of clinical diagnosis and scientific research testing and meet high-standard quality control requirements.

Claims

1. A quality control product for detecting nucleic acid of Yersinia pestis and its virulence gene, characterized in that: The quality control product is an engineered bacterium carrying a recombinant artificial chromosome vector containing the following four conserved fragments of key genes for Yersinia pestis detection: (1) a conserved fragment of the 3a gene of Yersinia pestis, the nucleic acid sequence of which is shown in SEQ ID NO.1; (2) a conserved fragment of the chro392 gene of Yersinia pestis, the nucleic acid sequence of which is shown in SEQ ID NO. 2; (3) a conserved fragment of the Yersinia pestis virulence gene caf1, the nucleic acid sequence of which is shown in SEQ ID NO. 3; (4) A conserved fragment of the virulence gene pla of Yersinia pestis, the nucleic acid sequence of which is shown in SEQ ID NO.

4.

2. A quality control product for detecting nucleic acid of Yersinia pestis and its virulence genes according to claim 1, characterized in that: The conserved fragment of the 3a gene of Yersinia pestis is 708 bp in size; The conserved fragment of the chro392 gene of Yersinia pestis is 723 bp in size; The conserved fragment of the Yersinia pestis virulence gene caf1 is 513 bp in size; The conserved fragment of the Yersinia pestis virulence gene pla is 939 bp in size.

3. A quality control product for detecting nucleic acid of Yersinia pestis and its virulence gene according to claim 1, characterized in that: The method for constructing the recombinant artificial chromosome vector comprises the following steps: S1. Obtain the full-length sequences of the four Y. pestis detection genes, use a multiple sequence alignment tool to remove insertions and deletions to identify conserved fragments, synthesize the conserved fragments of the four Y. pestis detection genes, and clone them into pUC plasmids respectively; S2. Amplification of the four conserved fragments of the Yersinia pestis detection genes using specific primer pairs 3a-MF / R, chro392-MF / R, caf1-MF / R, pla-MF / R, and Q5 enzyme, respectively, wherein the nucleic acid sequences of the specific primer pairs 3a-MF / R, chro392-MF / R, caf1-MF / R, and pla-MF / R are shown in SEQ ID NOs. 5-12; S3. Double digest the pBac-N-EGFP vector with EcoR I and Hind III restriction enzymes; S4. Using a homologous recombination kit, the conserved fragments of the four Y. pestis detection genes were seamlessly ligated into the linearized vector pBac-N-EGFP; S5. Transform the ligation product into competent E. coli DH5α cells, screen positive clones by bacterial liquid PCR and verify by sequencing.

4. A quality control product for detecting nucleic acid of Yersinia pestis and its virulence gene according to claim 1, characterized in that: The method for preparing the engineered bacteria carrying the recombinant artificial chromosome vector comprises the following steps: S1. The recombinant artificial chromosome vector was transformed into competent cells DH10Bac and cultured in LB solid medium containing kanamycin, tetracycline, gentamicin, X-Gal and IPTG; S2. Pick a white monoclonal colony and inoculate it into LB liquid medium containing kanamycin, tetracycline, and gentamicin for expansion; S3. The artificial chromosome DNA of the engineered bacteria was extracted and verified by PCR and sequencing analysis using specific primers pUC / M13-F and pUC / M13-R. The nucleic acid sequence of the specific primer pUC / M13-F is shown in SEQ ID NO.13, and the nucleic acid sequence of the specific primer pUC / M13-R is shown in SEQ ID NO.

14.

5. A quality control product for detecting nucleic acid of Yersinia pestis and its virulence gene according to claim 1, characterized in that: The quality control product preparation method comprises the following steps: S1. Heat-inactivate the engineered bacterial culture at 60°C for 1 hour; S2. The inactivated engineered bacteria were serially diluted with phosphate buffered saline to extract bacterial artificial chromosome DNA at different concentrations; S3. Determine the nucleic acid concentration in the quality control sample by digital PCR quantitative analysis; S4. Dilute the control product of known concentration to obtain the finished quality control product of the required concentration.

6. Use of the quality control product according to any one of claims 1 to 7 in the detection of Yersinia pestis and its virulence gene nucleic acid, characterized in that: It can be used for quality control of nucleic acid detection of Yersinia pestis and its virulence genes and added to the reaction system as a positive control; it can be used to evaluate the analytical sensitivity, specificity, precision and repeatability of Yersinia pestis nucleic acid detection kits; and it can be used to optimize the extraction efficiency of nucleic acid extraction reagents for long-fragment DNA target genes.

Images