A SNP molecular marker related to the number of primary lateral roots of upland cotton and application thereof

Abstract

The present application relates to the technical field of plant molecular biology, and particularly relates to a SNP molecular marker related to the number of primary lateral roots of Gossypium hirsutum and application. Through locating the key SNP marker on the A12 chromosome, early and efficient screening of high lateral root number germplasm can be realized, the level of the number of primary lateral roots of Gossypium hirsutum can be identified, early prediction of the number of primary lateral roots of Gossypium hirsutum can be realized, the number of primary lateral roots related genetic background analysis and the screening of materials with high lateral root number can be used, and the molecular marker assisted selection breeding of Gossypium hirsutum root system configuration related sites can be used, so that the new cotton variety with developed root system, strong stress resistance and high yield can be cultivated, and the present application has important theoretical value and application prospect for guaranteeing the sustainable development of the cotton industry.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of plant molecular biology, and particularly relates to a SNP molecular marker related to the number of primary lateral roots of Gossypium hirsutum and application. BACKGROUND

[0002] Gossypium hirsutum L. is one of the most important economic crops in the world, and its yield and fiber quality have a decisive influence on the textile industry and agricultural economy. The root architecture of cotton, especially the number of primary lateral roots, is directly related to the efficiency of water and nutrient absorption, the ability to resist lodging, and the adaptability to adversity stress, and is a key factor affecting the stable yield and high yield of cotton. Studies have shown that cotton varieties with developed primary lateral roots have stronger survival advantages in drought, saline-alkali and other non-biological stress environments, and have important significance for improving yield potential.

[0003] However, cotton root traits (such as the number of primary lateral roots) are complex quantitative traits, which are regulated by multiple genes and are easily disturbed by environmental factors. Traditional breeding methods rely on phenotype screening, which has problems such as long cycle, low efficiency, poor repeatability, and is difficult to realize precise improvement of root architecture. Although current research on cotton has covered the fields of yield, fiber quality and disease resistance, the genetic mechanism of root development, especially the number of lateral roots, is still weak. The existing technology has not fully excavated the key genetic loci regulating the number of primary lateral roots, resulting in a lack of reliable markers for molecular breeding, which seriously restricts the breeding process of high-yield and stress-resistant cotton varieties.

[0004] As an efficient genetic analysis tool, genome-wide association analysis (GWAS) can utilize the genetic diversity of natural populations to rapidly identify genetic variations significantly associated with target traits in the whole genome. This method does not require the construction of specific segregating populations, and can simultaneously locate multiple effect loci, providing high-precision molecular markers and candidate gene information for the genetic basis analysis of complex traits.

[0005] Therefore, in view of the current situation that the genetic basis of the number of primary lateral roots of Gossypium hirsutum is unknown and there is a lack of practical molecular markers, the use of GWAS technology to excavate SNP sites significantly associated with the number of primary lateral roots not only helps to reveal the molecular regulation mechanism of the trait, but also provides direct technical support for molecular marker-assisted selection breeding. SUMMARY

[0006] The purpose of the present application is to provide a SNP molecular marker related to the number of primary lateral roots of Gossypium hirsutum and application, to solve the problems existing in the prior art. The SNP molecular marker provided by the present application is associated with the number of primary lateral roots of Gossypium hirsutum, and can be used to identify the number level of primary lateral roots of Gossypium hirsutum, and realize early prediction of the stress resistance potential of Gossypium hirsutum.

[0007] To achieve the above object, the present application provides the following scheme:

[0008] The present application provides a SNP molecular marker related to the number of primary lateral roots of Gossypium hirsutum, which comprises one or more of a molecular marker 1, a molecular marker 2 and a molecular marker 3.

[0009] The nucleotide sequence of the molecular marker 1 is shown in SEQ ID NO. 1, and there is a G / A base mutation at the 22nd base of the nucleotide sequence.

[0010] The nucleotide sequence of the molecular marker 2 is shown in SEQ ID NO. 2, and there is a G / T base mutation at the 22nd base of the nucleotide sequence.

[0011] The nucleotide sequence of the molecular marker 3 is shown in SEQ ID NO. 3, and there is an A / G base mutation at the 25th base of the nucleotide sequence.

[0012] The present application provides a KASP primer set for amplifying the above-mentioned SNP molecular marker, which comprises one or more of a KASP primer set for amplifying the molecular marker 1, a KASP primer set for amplifying the molecular marker 2 and a KASP primer set for amplifying the molecular marker 3.

[0013] The KASP primer set for amplifying the molecular marker 1 comprises an allele-specific primer X with a nucleotide sequence shown in SEQ ID NO. 4, an allele-specific primer Y with a nucleotide sequence shown in SEQ ID NO. 5 and a common primer R with a nucleotide sequence shown in SEQ ID NO. 6.

[0014] The KASP primer set for amplifying the molecular marker 2 comprises an allele-specific primer X with a nucleotide sequence shown in SEQ ID NO. 7, an allele-specific primer Y with a nucleotide sequence shown in SEQ ID NO. 8 and a common primer R with a nucleotide sequence shown in SEQ ID NO. 9.

[0015] The KASP primer set for amplifying the molecular marker 3 comprises an allele-specific primer X with a nucleotide sequence shown in SEQ ID NO. 10, an allele-specific primer Y with a nucleotide sequence shown in SEQ ID NO. 11 and a common primer R with a nucleotide sequence shown in SEQ ID NO. 12.

[0016] The present application provides the use of the above-mentioned KASP primer set in the preparation of a product for identifying the number of primary lateral roots of Gossypium hirsutum.

[0017] Preferably, the product comprises a reagent, a kit or a chip.

[0018] The application provides a product for identifying the number of primary lateral roots of Gossypium hirsutum, which comprises the KASP primer group.

[0019] Preferably, the product comprises reagents, kits or chips.

[0020] The application provides the use of the SNP molecular marker, the KASP primer group or the product in identifying the number of primary lateral roots of Gossypium hirsutum.

[0021] The application provides a method for identifying the number of primary lateral roots of Gossypium hirsutum, comprising the following steps.

[0022] The KASP primer group is used for PCR amplification of the template, and genotyping is performed according to the amplification result.

[0023] Preferably, if the genotyping result of the molecular marker 1 is AA, the Gossypium hirsutum to be tested is determined as a Gossypium hirsutum variety with a large number of primary lateral roots, and if the genotyping result is GG, the Gossypium hirsutum to be tested is determined as a Gossypium hirsutum variety with a small number of primary lateral roots.

[0024] If the genotyping result of the molecular marker 2 is TT, the Gossypium hirsutum to be tested is determined as a Gossypium hirsutum variety with a large number of primary lateral roots, and if the genotyping result is GG, the Gossypium hirsutum to be tested is determined as a Gossypium hirsutum variety with a small number of primary lateral roots.

[0025] If the genotyping result of the molecular marker 3 is GG, the Gossypium hirsutum to be tested is determined as a Gossypium hirsutum variety with a large number of primary lateral roots, and if the genotyping result is AA, the Gossypium hirsutum to be tested is determined as a Gossypium hirsutum variety with a small number of primary lateral roots.

[0026] The application provides the use of the SNP molecular marker, the KASP primer group or the product in any one of the following,

[0027] (1) screening or predicting Gossypium hirsutum varieties with a large number of primary lateral roots;

[0028] (2) improving Gossypium hirsutum germplasm resources;

[0029] (3) Gossypium hirsutum breeding.

[0030] The application discloses the following technical effects:

[0031] The SNP molecular marker associated with the number of primary lateral roots of Gossypium hirsutum provided by the application is directly in the form of DNA, can be detected in various tissues and development stages of Gossypium hirsutum, is not limited by environmental conditions, planting seasons and plant growth states, is not affected by problems such as whether gene expression exists, does not need to analyze fragment length, and is suitable for rapid, large-scale and automatic screening.

[0032] The application can realize early and efficient screening of high lateral root number germplasm by locating the key SNP marker on chromosome A12, can be used for identifying the level of the first lateral root number of upland cotton, realizing early prediction of the first lateral root number of upland cotton, and can also be used for analyzing the genetic background related to the first lateral root number and screening materials with more lateral root numbers, and molecular marker assisted selection breeding of the root system configuration related sites of upland cotton, accelerating the cultivation of new cotton varieties with developed root system, strong stress resistance and high yield, and has important theoretical value and application prospect for guaranteeing the sustainable development of the cotton industry. It can be seen that the SNP molecular marker provided by the application can be applied to fine mapping, cloning and whole genome selection of breeding materials of the lateral root number related genes of upland cotton, improve the efficiency and accuracy of strong root and stress resistance molecular breeding of upland cotton, and accelerate the cultivation process of new strong root and stress resistance varieties of upland cotton. BRIEF DESCRIPTION OF DRAWINGS

[0033] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0034] Figure 1 Manhattan plot (A and C) and QQ plot (B and D) obtained by whole genome association analysis of the first lateral root number trait of upland cotton;

[0035] Figure 2 LD block analysis for the first lateral root number trait of cotton on chromosome A12;

[0036] Figure 3 Haplotype analysis for the first lateral root number of cotton on chromosome A12; wherein, A is the haplotype typing result of LRA12 interval (A12: 79366669-79826485); B is the first lateral root number investigation result of two kinds of haplotypes on the 8th day of water culture; C is the first lateral root number investigation result of two kinds of haplotypes on the 12th day of water culture; **** represents P<0.0001;

[0037] Figure 4 Genotyping map of molecular marker 1 in Example 4;

[0038] Figure 5 Genotyping map of molecular marker 2 in Example 4;

[0039] Figure 6 Genotyping map of molecular marker 3 in Example 4. DETAILED DESCRIPTION

[0040] The following detailed description of various example embodiments of the application will not be considered limiting of the application, but rather as a description of certain aspects, features, and embodiments of the application.

[0041] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. Additionally, for a range of values of a parameter, unless otherwise stated, each intervening value of the parameter, as well as any other stated or intervening value of the parameter, is encompassed. The intervening values of the parameter are obtained by simply "slicing" or interpolating the range of values of the parameter disclosed. The upper and lower limits of these intervening values of the parameter are also encompassed.

[0042] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. In case of conflict, the content of the present specification will control.

[0043] Various modifications and changes can be made to the specific embodiments of the application described herein without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those of ordinary skill in the art from the description and examples presented herein. The description and examples are illustrative of the application and are not intended to limit the scope of the application.

[0044] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean including, but not limited to.

[0045] Example 1

[0046] 1. Test materials and investigation of the number of primary lateral roots

[0047] The natural population cotton germplasm used was provided by the Medium-term Germplasm Bank of the Cotton Institute of the Chinese Academy of Agricultural Sciences, and included 383 Upland cotton core germplasms. The core germplasm collection covers the main genetic diversity of Upland cotton, providing a rich material basis for the genetic analysis of the root system traits of the application. The 383 Upland cotton core germplasms are shown in Tables 1-4.

[0048] Table 1 Upland cotton core germplasm

[0049]

[0050] Table 2 Upland cotton core germplasm

[0051]

[0052] Table 3 Upland cotton core collection

[0053]

[0054] Table 4 Upland cotton core collection

[0055]

[0056] To accurately investigate the primary lateral root development dynamics at early seedling stage, the following standardized hydroponic procedure was adopted:

[0057] (1) Seedling raising: seeds of 383 upland cotton core accessions were first raised using sand culture method to provide uniform initial germination environment;

[0058] (2) Transplanting and hydroponic culture: on the 4th day after sowing (when radicle had obviously elongated and cotyledon unfolded), seedlings were carefully transplanted into hydroponic boxes equipped with nutrient solution for culture. Culture conditions: hydroponic system was placed in a phytotron to ensure constant and suitable light, temperature and humidity conditions for cotton seedling growth. During the whole culture period (from transplanting to the end of investigation), 24-hour continuous oxygen supply was implemented to the nutrient solution to ensure sufficient oxygen supply for root system, simulating good aeration condition and promoting normal root development.

[0059] (3) Primary lateral root counting: on the 8th day after sowing (4th day after transplanting into hydroponic boxes) and the 12th day after sowing (8th day after transplanting into hydroponic boxes), the number of primary lateral roots of each seedling was counted at two key time points, respectively.

[0060] Primary lateral root was defined as the lateral root directly attached to the main root (radicle). Counting was performed under naked eye or appropriate magnifying lens to ensure accurate recording of the number of primary lateral roots of multiple biological replicates (usually multiple seedlings were planted for each accession) at each time point.

[0061] 2. Whole-genome re-sequencing and SNP detection

[0062] Total genomic DNA was extracted from young leaves of each accession using CTAB method. Subsequently, it was sent to a biological company for sequencing, and 150-bp double-end sequencing library was constructed according to the instruction. Sequencing was performed using Illumina HiSeq sequencing platform. After filtering low-quality double-end reads, clean data was obtained, with an average genome coverage depth of 14.6x.

[0063] The high-quality sequencing data was aligned to the reference genome of G. hirsutum TM-1 (reference genome version number: Gossypium hirsutum (AD1) 'TM-1' genome CRI_v1 (CRI TM-1 V1.0; Yang et al. Nature Communication, 2019)) using BWA software and adopting MEM algorithm (default parameters). Based on the BAM file generated in the alignment process, the single nucleotide polymorphism (SNP) was identified at the population level using SAMtools software. Finally, 1076652 high-quality SNPs were retained, which had a missing rate of ≤20% in the population and a minimum allele frequency (MAF) of ≥0.05, for subsequent analysis. The annotation information of the SNPs was obtained using ANNOVAR software.

[0064] 3. Genome-wide association analysis of primary lateral root number trait of G. hirsutum

[0065] Based on the phenotypic data of primary lateral root number of 383 G. hirsutum core germplasm at 8 days and 12 days after sowing at the seedling stage and the genotypic data of 1076652 high-quality SNPs (MAF > 0.05, missing rate ≤ 0.2), genome-wide association analysis was performed. Taking -log10(P) ≈ 6.0 as the Bonferroni correction threshold, the SNP sites greater than 6.0 were significant sites, and the significantly associated SNP sites were screened in the whole genome range. A total of 10 SNP sites significantly associated with the primary lateral root number of G. hirsutum were screened in the interval A12:79366669-79826485 on chromosome A12, and 3 representative SNP markers (Table 5) were selected for KASP marker development in this embodiment; the Manhattan plot and QQ plot obtained by genome-wide association analysis are shown in Figure 1

[0066] Table 5 SNP site information

[0067]

[0068] 4. Linkage disequilibrium block (LD block) analysis

[0069] Linkage disequilibrium (LD) analysis of the candidate interval LRA12 (A12:79366669-79826485) where the SNP sites are located was performed using Tassel 5.0, and it was found that the SNPs in the interval formed a strong linkage disequilibrium block (LD block) with a high LD coefficient (R 2 ) (> 0.8) Figure 2 ​). According to the genotyping results, the test materials can be divided into two haplotypes, HAP1 and HAP2 (A in the figure). Figure 3 At the early stage of cotton seedling development (8 days after sowing), the average number of primary lateral roots of the material carrying HAP1 haplotype was 31.11, while the average number of primary lateral roots of the material carrying HAP2 haplotype was 25.21. At 12 days after sowing, the average number of primary lateral roots of the material carrying HAP1 haplotype was 39.88, while the average number of primary lateral roots of the material carrying HAP2 haplotype was 33.46. By comparing the number of primary lateral roots between different haplotypes (two-tailed T test), it was found that at 8 days and 12 days after sowing, the number of primary lateral roots of HAP1 material was extremely significantly higher than that of HAP2 (P < 0.0001, Figure 3 B and C in the figure).

[0070] The relationship between the three KASP molecular markers developed and the haplotype in the LRA12 interval is shown in Table 6. When the genotype of the three molecular markers is G-G-A, the haplotype belongs to HAP2, and the phenotype is fewer primary lateral roots; and when the genotype of the three molecular markers is A-T-G, the haplotype belongs to HAP1, and the phenotype is more primary lateral roots.

[0071] Table 6 Correspondence between KASP markers and haplotypes in the LRA12 interval

[0072]

[0073] Example 2 Development of molecular markers and primer pairs

[0074] Based on the SNP site information in Table 6 and the sequence of the haplotype, related molecular markers were developed. The nucleotide sequences of the molecular markers are as follows, and the nucleotide sequences of the primer pairs used to amplify the molecular markers are shown in Table 7.

[0075] The sequence of the molecular marker is as follows:

[0076] The nucleotide sequence of the molecular marker 1 is shown in SEQ ID NO. 1, which is specifically as follows:

[0077] TTCTTTCGCGAGTTTATTCCAKATATAGTGCTCACATACATATTTTAAAAA; K is G or A.

[0078] The nucleotide sequence of the molecular marker 2 is shown in SEQ ID NO. 2, which is specifically as follows:

[0079] TCCCTCTCCTCTCACGAATTTKTTTTGCCTTGTTGCGGTTTTGTCGTCTT; K is G or T.

[0080] The nucleotide sequence of the molecular marker 3 is shown as SEQ ID NO. 3, specifically:

[0081] TACAGGTTTGTACCCGAAAACACAKAAAGCGAGAATCAGCGAAAGCCAAA; K is A or G.

[0082] Table 7 Information of primer pairs for amplifying molecular markers

[0083]

[0084] Note: The bold part is the FAM tag sequence, and the underlined part is the HEX tag sequence.

[0085] Example 3

[0086] A method for identifying the number of primary lateral roots of the test upland cotton, the steps are as follows:

[0087] The DNA of the test upland cotton plant was extracted by CTAB method (Zheng et al., 2021). The DNA quality and concentration were detected by NanoDrop 2000 spectrophotometer, and the DNA concentration for KASP genotyping was controlled at 50-60 ng / μL.

[0088] The allele sequences of SNPs in the extraction site region and their upstream and downstream extension sequences (29 bp upstream and 30 bp downstream) were extracted, KASP primers were designed by Perl script (Steele et al., 2018), and were synthesized by Sheng Wu Bioengineering (Shanghai) Co., Ltd. (Table 7).

[0089] The primer pairs in Table 7 were used for KASP reaction, wherein the genotyping was performed on an Applied Biosystems®QuantStudio™ 6 instrument (384-well plate). First, the primer mixture was configured, as shown in Table 8.

[0090] Table 8 Primer mixture

[0091]

[0092] The PCR reaction system (5 μL reaction system) comprises: 2.5 μL HiGeno 2x Probe Mix A, 0.07 μL KASP primer, 10-250 ng DNA sample and the balance of sterile water. The PCR program is as follows: (1) 95°C pre-denaturation for 10 minutes; (2) 95°C denaturation for 20 seconds, 61°C-55°C annealing and extension for 40 seconds (10 cycles, each cycle decreases by 0.6°C); (3) 95°C denaturation for 20 seconds, 55°C annealing and extension for 40 seconds (33 cycles); (4) 25°C reading result. The genotype data is obtained by using the built-in QuantStudioTM real-time fluorescence quantitative software, and the sample typing result is determined according to the fluorescence signal: the red-labeled sample (HEX fluorescence-labeled) and the blue-labeled sample (FAM fluorescence-labeled) respectively represent two homozygous genotypes, and the green-labeled sample is a heterozygous genotype.

[0093] The fluorescence signal is converted and presented in the form of a chart by using the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ), and the genotype result is output according to the color difference. The chart is divided into X and Y axes, and each data point represents an independent DNA sample. Samples with the same genotype will gather together. The homozygous genotype (blue dot, red dot) is close to the X and Y axes, and the heterozygous genotype (green dot) is close to the diagonal line.

[0094] When the genotype identified by the primer of molecular marker 1 is AA, it is located close to the X axis (blue dot FAM), which is a Upland cotton variety with more primary lateral roots; when the genotype is GG, it is located close to the Y axis (red dot HEX), which is a Upland cotton variety with fewer primary lateral roots; when the genotype identified by the primer pair of molecular marker 2 is TT, it is located close to the X axis (blue dot FAM), which is a Upland cotton variety with more primary lateral roots, and when the genotype is GG, it is located close to the Y axis (red dot HEX), which is a Upland cotton variety with fewer primary lateral roots; when the genotype identified by the primer of molecular marker 3 is GG, it is located close to the X axis (blue dot FAM), which is a Upland cotton variety with more primary lateral roots, and when the genotype is AA, it is located close to the Y axis (red dot HEX), which is a Upland cotton variety with fewer primary lateral roots.

[0095] Example 4

[0096] In this example, haplotype materials with extreme primary lateral root number were screened from 383 resequencing natural populations (383 Upland cotton core germplasm in Example 1), and water culture was carried out (the specific steps are the same as in Example 1). The genotypes of the three molecular markers in the test sample were identified by the method of Example 3, and the results are shown in Table 9, the genotyping diagram of molecular marker 1 is shown in Figure 4 , the genotyping diagram of molecular marker 2 is shown in Figure 5The genotyping map of molecular marker 3 is shown as Figure 6

[0097] Table 9: Sample test results

[0098]

[0099] Note: **** represents P < 0.0001, significant difference reaches extremely significant difference.

[0100] As shown in Table 9, the three SNP markers screened by the present application are all closely linked to the traits.

[0101] Example 5

[0102] In this example, haplotype materials with extremely large number of primary lateral roots were screened from 383 resequencing natural populations (383 upland cotton core germplasm in Example 1), and water culture was performed (the specific steps are the same as in Example 1). The genotypes of the three molecular markers in the test samples were identified by the method of Example 3, and the results are shown in Table 10.

[0103] Table 10: Sample test results

[0104]

[0105] As shown in Table 10, the three SNP markers screened by the present application are all closely linked to the traits.

[0106] As shown in Table 10, the three SNP markers screened by the present application are all closely linked to the traits.

[0107] The above-described examples are only descriptions of preferred modes of the present application, and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those of ordinary skill in the art shall fall within the protection scope determined by the claims of the present application.​

Claims

1. Application of KASP primer set in preparation of product for identifying number of primary lateral roots of Gossypium hirsutum, characterized in that, The KASP primer set comprises one or more of a KASP primer set for amplifying molecular marker 1, a KASP primer set for amplifying molecular marker 2 and a KASP primer set for amplifying molecular marker 3; The KASP primer set for amplifying molecular marker 1 comprises allele-specific primer X with a nucleotide sequence as shown in SEQ ID NO. 4, allele-specific primer Y with a nucleotide sequence as shown in SEQ ID NO. 5 and common primer R with a nucleotide sequence as shown in SEQ ID NO. 6; The KASP primer set for amplifying molecular marker 2 comprises allele-specific primer X with a nucleotide sequence as shown in SEQ ID NO. 7, allele-specific primer Y with a nucleotide sequence as shown in SEQ ID NO. 8 and common primer R with a nucleotide sequence as shown in SEQ ID NO. 9; The KASP primer set for amplifying molecular marker 3 comprises allele-specific primer X with a nucleotide sequence as shown in SEQ ID NO. 10, allele-specific primer Y with a nucleotide sequence as shown in SEQ ID NO. 11 and common primer R with a nucleotide sequence as shown in SEQ ID NO. 12; The nucleotide sequence of the molecular marker 1 is shown as SEQ ID NO. 1, and there is a G / A base mutation at the 22nd base of the nucleotide sequence; The nucleotide sequence of the molecular marker 2 is shown as SEQ ID NO. 2, and there is a G / T base mutation at the 22nd base of the nucleotide sequence; The nucleotide sequence of the molecular marker 3 is shown as SEQ ID NO. 3, and there is an A / G base mutation at the 25th base of the nucleotide sequence; If the genotyping result of the molecular marker 1 is AA, it is determined that the to-be-tested upland cotton is an upland cotton variety with more primary lateral root number, and if the genotyping result is GG, it is determined that the to-be-tested upland cotton is an upland cotton variety with less primary lateral root number; If the genotyping result of the molecular marker 2 is TT, it is determined that the to-be-tested upland cotton is an upland cotton variety with more primary lateral root number, and if the genotyping result is GG, it is determined that the to-be-tested upland cotton is an upland cotton variety with less primary lateral root number; If the genotyping result of the molecular marker 3 is GG, it is determined that the to-be-tested upland cotton is an upland cotton variety with more primary lateral root number, and if the genotyping result is AA, it is determined that the to-be-tested upland cotton is an upland cotton variety with less primary lateral root number.

2. Use according to claim 1, characterized in that, The product comprises reagents, kits or chips.

3. Application of KASP primer set in identifying the number of primary lateral roots of Gossypium hirsutum, characterized in that, The KASP primer set comprises one or more of a KASP primer set for amplifying molecular marker 1, a KASP primer set for amplifying molecular marker 2 and a KASP primer set for amplifying molecular marker 3; The KASP primer set for amplifying molecular marker 1 comprises allele-specific primer X with a nucleotide sequence as shown in SEQ ID NO. 4, allele-specific primer Y with a nucleotide sequence as shown in SEQ ID NO. 5 and common primer R with a nucleotide sequence as shown in SEQ ID NO. 6; The KASP primer set for amplifying the molecular marker 2 comprises an allele-specific primer X with the nucleotide sequence as shown in SEQ ID NO. 7, an allele-specific primer Y with the nucleotide sequence as shown in SEQ ID NO. 8, and a common primer R with the nucleotide sequence as shown in SEQ ID NO. 9; The KASP primer set for amplifying the molecular marker 3 comprises an allele-specific primer X with the nucleotide sequence as shown in SEQ ID NO. 10, an allele-specific primer Y with the nucleotide sequence as shown in SEQ ID NO. 11, and a common primer R with the nucleotide sequence as shown in SEQ ID NO. 12; The nucleotide sequence of the molecular marker 1 is shown in SEQ ID NO. 1, and a G / A base mutation exists at the 22nd base of the nucleotide sequence; The nucleotide sequence of the molecular marker 2 is shown in SEQ ID NO. 2, and a G / T base mutation exists at the 22nd base of the nucleotide sequence; The nucleotide sequence of the molecular marker 3 is shown in SEQ ID NO. 3, and an A / G base mutation exists at the 25th base of the nucleotide sequence; If the genotyping result of the molecular marker 1 is AA, it is determined that the tested upland cotton is an upland cotton variety with more primary lateral root number, and if the genotyping result is GG, it is determined that the tested upland cotton is an upland cotton variety with less primary lateral root number; If the genotyping result of the molecular marker 2 is TT, it is determined that the tested upland cotton is an upland cotton variety with more primary lateral root number, and if the genotyping result is GG, it is determined that the tested upland cotton is an upland cotton variety with less primary lateral root number; If the genotyping result of the molecular marker 3 is GG, it is determined that the tested upland cotton is an upland cotton variety with more primary lateral root number, and if the genotyping result is AA, it is determined that the tested upland cotton is an upland cotton variety with less primary lateral root number.

4. A method for identifying the number of primary lateral roots in Gossypium hirsutum, comprising the steps of, Comprise: using the KASP primer set in claim 1 as a template, performing PCR amplification on the template, and performing genotyping according to the amplification result; If the genotyping result of the molecular marker 1 is AA, it is determined that the tested upland cotton is an upland cotton variety with more primary lateral root number, and if the genotyping result is GG, it is determined that the tested upland cotton is an upland cotton variety with less primary lateral root number; If the genotyping result of the molecular marker 2 is TT, it is determined that the tested upland cotton is an upland cotton variety with more primary lateral root number, and if the genotyping result is GG, it is determined that the tested upland cotton is an upland cotton variety with less primary lateral root number; If the genotyping result of the molecular marker 3 is GG, it is determined that the tested upland cotton is an upland cotton variety with more primary lateral root number, and if the genotyping result is AA, it is determined that the tested upland cotton is an upland cotton variety with less primary lateral root number.

5. Application of KASP primer set in screening or predicting upland cotton varieties with high number of primary lateral roots, characterized in that, The KASP primer set comprises one or more of the KASP primer set for amplifying the molecular marker 1, the KASP primer set for amplifying the molecular marker 2, and the KASP primer set for amplifying the molecular marker 3; The KASP primer set for amplifying the molecular marker 1 comprises an allele-specific primer X with the nucleotide sequence as shown in SEQ ID NO. 4, an allele-specific primer Y with the nucleotide sequence as shown in SEQ ID NO. 5, and a common primer R with the nucleotide sequence as shown in SEQ ID NO. 6; The KASP primer set for amplifying the molecular marker 2 comprises an allele-specific primer X with the nucleotide sequence as shown in SEQ ID NO. 7, an allele-specific primer Y with the nucleotide sequence as shown in SEQ ID NO. 8, and a common primer R with the nucleotide sequence as shown in SEQ ID NO. 9; The KASP primer set for amplifying the molecular marker 3 comprises an allele-specific primer X with the nucleotide sequence as shown in SEQ ID NO. 10, an allele-specific primer Y with the nucleotide sequence as shown in SEQ ID NO. 11, and a common primer R with the nucleotide sequence as shown in SEQ ID NO. 12; The nucleotide sequence of the molecular marker 1 is shown in SEQ ID NO. 1, and a G / A base mutation exists at the 22nd base of the nucleotide sequence; The nucleotide sequence of the molecular marker 2 is shown in SEQ ID NO. 2, and a G / T base mutation exists at the 22nd base of the nucleotide sequence; The nucleotide sequence of the molecular marker 3 is shown in SEQ ID NO. 3, and an A / G base mutation exists at the 25th base of the nucleotide sequence; If the genotyping result of the molecular marker 1 is AA, the tested upland cotton is determined to be an upland cotton variety with more primary lateral root number, and if the genotyping result is GG, the tested upland cotton is determined to be an upland cotton variety with less primary lateral root number; If the genotyping result of the molecular marker 2 is TT, the tested upland cotton is determined to be an upland cotton variety with more primary lateral root number, and if the genotyping result is GG, the tested upland cotton is determined to be an upland cotton variety with less primary lateral root number; If the genotyping result of the molecular marker 3 is GG, the tested upland cotton is determined to be an upland cotton variety with more primary lateral root number, and if the genotyping result is AA, the tested upland cotton is determined to be an upland cotton variety with less primary lateral root number.

Images