Efficient silent high-throughput screening method

Abstract

The invention discloses an efficient silent high-throughput screening method, and relates to the technical field of genetic engineering, and the technical key points are as follows: according to a library vector sequence of a pregeneration silent screening technology, the library vector sequence is optimized as follows: 1, redundant DNA (deoxyribonucleic acid) sequences interfering Gibson assembly are removed; 2, two new restriction enzyme cutting sites of NheI and ClaI are introduced to linearize the library vector; 3, a homologous arm sequence assembled by Gibson is optimized; meanwhile, the electrotransformation process of a Gibson assembly reaction system is optimized, namely, electrotransformation is performed after a reaction product is purified, the electrotransformation efficiency is further improved, the library construction efficiency is remarkably improved through a series of technical step improvements, the iReSE technology is invented, the silence screening efficiency is improved through the technology, and the silence screening cost is lowered. And the silents can be identified and researched more efficiently.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, in particular to a high-efficiency silencer high-throughput screening method. BACKGROUND

[0002] The human genome includes 20,000 protein editing genes, which can be involved in the occurrence and development of many diseases, but these genes account for less than 2% of the human genome. The vast majority of the human genome does not participate in protein coding, and the non-coding regions composed of intergenic regions and intron regions have been considered to be non-functional for a long time. With the progress of technology and in-depth research, it is realized that there are a large number of non-coding cis-regulatory elements, such as promoters, enhancers and silencers, in these non-coding regions that can regulate gene transcription. Previous studies have shown that silencers play an important regulatory role in tissue and organ development, immune homeostasis and tumor occurrence and development, but due to the lack of efficient screening and identification methods, the basic characteristics, mechanism and functional regulation of silencers still need to be further studied.

[0003] The study of non-coding cis-regulatory elements is an important aspect of epigenetic research. Among the four non-coding cis-regulatory elements of promoters, enhancers, insulators and silencers, silencers are the least studied, and the academic community still lacks understanding of the basic genetics and epigenetics of silencers. This lack of understanding is largely due to the relative lag in silencer screening and identification research, which hinders the identification of silencer characteristics and thus hinders the study of the biological functions of silencers.

[0004] Therefore, the present application aims to provide a high-efficiency silencer high-throughput screening method to solve the above problems. SUMMARY

[0005] The purpose of the present application is to solve the above problems and provide a high-efficiency silencer high-throughput screening method. The present application uses the vector construction method of the previous generation of silencer screening technology, removes the redundant DNA sequence, optimizes the DNA sequence of the homologous arm, and also optimizes the library construction reaction system and the electroporation process. The iReSE (improved repressiveability of silencer elements) technology is invented, which improves the efficiency and enables more efficient identification and research of silencers.

[0006] In order to achieve the above purpose, the technical scheme of the present application is as follows:

[0007] The present application provides a high-efficiency silencer high-throughput screening method, which comprises the following steps:

[0008] S1, obtain DNA library fragments by ATAC-seq, DNase-seq, CUT&Tag or MNase-seq for constructing iReSE screening library;

[0009] S2, linearize the iReSE screening vector by double digestion, and linearize the end of the vector next to the homologous arm required for Gibson assembly, then use the iReSE screening vector to construct the screening library by the optimized library construction and electroporation method;

[0010] S3, package virus to infect cells for silencer screening;

[0011] S4, identify the silencer by sequencing and analysis.

[0012] S5, verify the silencer activity by luciferase reporter gene experiment, and verify the endogenous inhibition function of the silencer by CRISPR / Cas9 knockout experiment.

[0013] The specific steps of the above are:

[0014] 1. Constructing iReSE screening vector: construction of iReSE screening lentivirus vector pLNC-FdCasp9-Puro

[0015] Based on the process previously developed by Pang and Snyder team for pLenti-FKBP-delCasp9-Puro, first, UbC promoter and FKBP-delCaspase9-EGFP fusion fragment were amplified from pLEX-MCS UBC promoter vector (Addgene #128045) and pMSCV-F-del_Casp9.IRES.GFP plasmid (Addgene #15567) respectively using TransStart FastPfu DNA polymerase (TransGen #AP221). Then, the two elements were assembled into the XbaI and BamHI double-digested lentiCRISPRv2 backbone vector (Addgene #52961) by HieffClone Plus Multi one-step cloning kit (Yeasen #10912), which was located downstream of the EF-1 alpha promoter and upstream of the puromycin resistance gene (PuroR). Then, the U6 promoter to gRNA backbone region was removed by PacI and NheI double digestion, and replaced with a 40bp sequence containing NheI and ClaI restriction enzyme sites, which ensured that the homologous arm sequence was fully optimized.

[0016] 2. Optimized library construction and electroporation

[0017] First, pLNC-FdCasp9-PuroR plasmid was double digested by NheI and ClaI (ZYMO RESEARCH #C1004 purification column purification). DNA fragments were amplified by PCR using AmpliMix (Novo Protein #N330BF2) and primer pairs (program: 98°C 30s; 98°C 30s, 60°C 30s, 70°C 120s cycle 4 times; 70°C 120s). After the amplification product was purified by ChIP DNA purification kit (ZYMO RESEARCH #D5205), the library fragments were inserted into the digested vector upstream of the EF-1a promoter using NEBuilder HiFi DNA assembly premix (NEB #E2621). Each 20 μl assembly system contained 330 ng of digested vector, and the molar ratio of insert to vector was 5:1. After 60 minutes of incubation at 50°C, isopropanol precipitation purification was performed, and finally 5 μl of elution buffer (TIANGEN #RK120-02) was used to recover the product. 2 μl of purified product was electroporated into 25 μl of Endura electrocompetent cells (Lucigen #60242) using a Bio-Rad electroporator (#165-2100). The efficiency of electroporation was evaluated by counting the number of colonies on the ten-thousand-fold dilution plate and the one-hundred-thousand-fold dilution plate. Each electroporation of this technology obtained about 2.1 x 10 7

[0018] 3. Construction of iReSE library based on ATAC-seq

[0019] First, the ATAC-seq library construction experiment was performed, and the experimental method was as follows: Novo Protein's Chromatin Profile Kit for Illumina kit, item number N248) was used: 5 x 10 4 ​K562 cells were washed once with PBS and lysed with 50 μΐ of pre-chilled lysis buffer (10 mM Tris-HCl, 10 mM NaCl, 3 mM MgCl2, 0.1% NP40, 0.1% Tween20, 0.01% Digitonin, pH 7.4) on ice for 5 min, followed by washing with 950 μΐ of wash buffer (10 mM Tris-HCl, 10 mM NaCl, 3 mM MgCl2, 1% Tween 20, pH 7.4). The nuclei were pelleted by centrifugation at 4°C, 500 g for 10 min, and the pellet was resuspended in 50 μΐ of transposition reaction mix (containing 25 μΐ of 2x TD buffer, 5 μΐ of 1x PBS, 0.5 μΐ of 10% Tween20, 0.5 μΐ of 1% Digitonin, 2 μΐ of transposase mix, and 17 μΐ of ddH2O) and incubated at 37°C for 30 min. The reaction product was immediately purified using Tagment DNA Extract Beads (Novo Protein #N245). The purified DNA was then set up in a 50-μΐ system for PCR amplification (program: 72°C for 180 s; 98°C for 30 s; 98°C for 15 s, 60°C for 15 s, 72°C for 8 s for 8 cycles; 72°C for 120 s). Then, the electrotransformation was performed according to the procedure in Step 2, and the bacterial solution was evenly spread on four 145-mm petri dishes containing 100 μg / mL carbenicillin. After incubation at 37°C for 12 h, the colonies were scraped and plasmids were extracted.

[0020] 4. Packaging virus-infected cells for silencer screening

[0021] HEK293T cells were used to package K562 iReSE library virus. The transfection system for each 10-cm dish of HEK293T cells contained 5 μg of library plasmid, 3.75 μg of psPAX2, and 1.25 μg of pMD2.G, which were mixed in 1 ml of Opti-MEM medium (Gbico #31985070) and then transfected by PEI. After 24 h of transfection, the medium was replaced with fresh medium, and the virus-containing supernatant was collected after 72 h of transfection. The virus titer was then determined. The iReSE virus library was then used to centrifugally infect K562 cells at a multiplicity of infection (MOI) of 0.3 (two biological replicates were set). The specific operation was as follows: 3 x 10 6 K562 cells were mixed with an appropriate amount of virus solution and 8 μg / mL polybrene in a single well of a 12-well plate (1 ml system), and each repeat was infected with about 1.8 x 10 8cells. After 24 hours of infection, 2 pg / ml puromycin was used to select successfully infected cells. After 7 days of puromycin selection, dead cells were removed using a dead cell removal kit (Miltenyi Biotec #130-090-101), and 3.6 x 105 8 cells were collected from each replicate as a control sample. An equal amount of cells (3.6 x 105 8 cells) were treated with 1 nM MAP200187 (Sigma #SML2838) for 23 hours to induce apoptosis, and after removing dead cells, the cells were cultured until the number of live cells recovered to 3.6 x 105 8 cells per replicate as an experimental sample. Genomic DNA of the control and experimental samples was extracted for iReSE library fragment amplification. Each 50 mI PCR reaction system contained 5 pg genomic DNA, 25 mI 2x Phanta Max buffer, 1 mI 10 mM dNTPs, 0.5 mI MgS04, 0.25 mI Nextera index 1, 0.25 mI Nextera index 2 primer, and 1 mI Phanta Max high-fidelity DNA polymerase (Vazyme #P505), and the amplification program was 95 °C for 180 s; 95 °C for 15 s, 57 °C for 15 s, 72 °C for 90 s for 22 cycles; 72 °C for 300 s. After purification of the amplification product by VAHTS DNA purification magnetic beads (Vazyme #N411) and ZYMO purification column, Illumina double-end sequencing was performed.

[0022] 5. Identification of silencers by sequencing and analysis

[0023] Genomic DNA of the control and experimental samples was extracted for iReSE library fragment amplification. Each 50 mI PCR reaction system contained 5 pg genomic DNA, 25 mI 2x Phanta Max buffer, 1 mI 10 mM dNTPs, 0.5 mI MgS04, 0.25 mI Nextera index 1, 0.25 mI Nextera index 2 primer, and 1 mI Phanta Max high-fidelity DNA polymerase (Vazyme #P505), and the amplification program was 95 °C for 180 s; 95 °C for 15 s, 57 °C for 15 s, 72 °C for 90 s for 22 cycles; 72 °C for 300 s. After purification of the amplification product by VAHTS DNA purification magnetic beads (Vazyme #N411) and ZYMO purification column, Illumina double-end sequencing was performed.

[0024] Raw sequencing data was quality controlled using TrimGalore, removing adapter sequences and filtering low quality data (Q<20). The quality controlled data was then aligned to the human reference genome GRCh38 (obtained from ENCODE database) by BWA-MEM. High quality alignment results (MAPQ>30) were filtered by SAMtools. Peak calling was performed on all sample sequencing data by Genrich (parameters: -j-r-d 150-q 0.05), and the obtained peak regions were divided into 50bp windows (step 10bp) by BEDTools, and converted to SAF format by AWK tool. The number of reads in each sample window was counted using featureCounts. Median normalization was performed using MAGeCK to calculate the enrichment degree of the experimental group relative to the control group. Finally, adjacent windows that met the criteria of log2 fold change > 1 and FDR < 0.01 were merged to obtain the silencer region.

[0025] 6. Luciferase reporter gene experiment to verify silencer activity

[0026] The candidate silencer region was amplified by PCR from K562 cell genomic DNA and cloned upstream of the SV40 promoter in the luciferase reporter plasmid pGL4.13. K562 cells were transfected with M5 suspension cell-specific transfection reagent (Mei5Bio #MF388), 1800ng of pGL4.13 recombinant plasmid containing iReSE silencer or previously verified silencer, or empty plasmid, and 200ng of Renilla luciferase plasmid pRL-CMV per 1x10 6 cells. 48 hours after transfection, luciferase activity was determined using a dual luciferase reporter gene detection kit (Yeasen #11405ES60). All candidate silencers were subjected to three independent transfections and luciferase activity detection.

[0027] 7. CRISPR / Cas9 knockout of silencer regions in chromatin to verify their inhibitory activity

[0028] Firstly, the sgRNA targeting the upstream and downstream flanking regions of the silencer was designed based on CRISPROR and GuideScan2 webpage tools. The paired sgRNA was cloned into the lentiCRISPR-v2 vector which was optimized in backbone. Then the lentivirus was packaged in HEK293T cells and infected K562 cells. After 24 hours of infection, the successfully infected cells were screened using 2ug / ml puromycin. The monoclonal cell lines were isolated by limiting dilution method, and the genotype was verified by PCR amplification and Sanger sequencing. The monoclonal with successful knockout of the silencer was selected, RNA was extracted using TRIeasy total RNA extraction reagent (Yeasen, 19202ES60), and cDNA was synthesized using All-In-One 5xRT MasterMix (abm#G490). Quantitative PCR detection was performed using Taq Pro Universal SYBR qPCR premix (Vazyme#Q712), and the expression of the internal reference gene GAPDH was standardized.

[0029] In the scheme, the screening vector sequence is improved, the library construction and electroporation process are optimized, and the library construction efficiency is significantly improved.

[0030] Compared with the prior art, the beneficial effects of the scheme are:

[0031] Compared with the original ReSE screening vector, the optimized iReSE screening vector of the application removes the redundant DNA sequence interfering Gibson assembly, introduces two new enzyme cutting sites NheI and ClaI for linearization of the vector, and optimizes the homologous arm sequence of Gibson assembly; at the same time, the Gibson assembly reaction and electroporation process are optimized; compared with the original ReSE system, the electric conversion efficiency of the technology is increased by more than 100 times, and the number of identified silencers is also increased by more than 80 times. BRIEF DESCRIPTION OF DRAWINGS

[0032] Figure 1 is a flow chart of the high-throughput silencer screening method in the embodiment of the application;

[0033] Figure 2 is a schematic diagram of the structure comparison between the original silencer element inhibition ability (ReSE) screening vector and the improved ReSE (iReSE) screening vector in the embodiment of the application;

[0034] Figure 3 is a schematic diagram of the library construction efficiency comparison between the original ReSE screening vector and the iReSE screening vector in the embodiment of the application;

[0035] Figure 4is a schematic diagram of the iReSE screening experiment process combined with transposase accessible chromatin high throughput sequencing (ATAC-seq) in an embodiment of the present application;

[0036] Figure 5 is a schematic diagram of the coverage of K562 cell line iReSE plasmid library on ATAC-seq peaks and input fragment peaks in an embodiment of the present application;

[0037] Figure 6 is a schematic diagram of the correlation of sequencing reads between repeated samples or before and after adding an inducer in the same sample in the K562 cell line iReSE experiment in an embodiment of the present application;

[0038] Figure 7 is a flowchart of iReSE silencer analysis in an embodiment of the present application;

[0039] Figure 8 is a schematic diagram of the genomic position distribution and characteristic annotation of K562 cell line iReSE silencers in an embodiment of the present application;

[0040] Figure 9 is a schematic diagram of the length distribution of K562 cell line iReSE silencers in an embodiment of the present application;

[0041] Figure 10 is a schematic diagram of the comparison between the number of silencers identified by K562 cell line iReSE and the number of silencers identified by previous large-scale parallel reporter gene experiments in an embodiment of the present application;

[0042] Figure 11 is a schematic diagram of luciferase reporter gene experiment verifying K562 iReSE silencer activity in an embodiment of the present application;

[0043] Figure 12 is a schematic diagram of CRISPR knockout experiment verifying the endogenous inhibition function of K562 iReSE silencers in an embodiment of the present application. DETAILED DESCRIPTION

[0044] In order to enable persons skilled in the art to better understand the present application scheme, the technical solutions of the present application will be further described in detail below in combination with the embodiments of the present application and the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present application, not all. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative labor should belong to the scope of protection of the present application.

[0045] It should be noted that the embodiments in the present application and the features in the embodiments can be combined with each other without conflict. The present application will be described in detail below in combination with the embodiments.

[0046] Examples:

[0047] 1. Comparison of library construction efficiency of optimized iReSE screening vector

[0048] The original ReSE screening system is inefficient, mainly due to its low library construction efficiency. By analyzing the original ReSE screening vector, it was found that there was extra DNA sequence between the linearization end and the homologous arm of Gibson assembly, which would interfere with Gibson assembly, resulting in low library construction efficiency and thus reducing the efficiency of silencer screening. To solve this problem, the optimized iReSE screening vector was reconstructed, which removed the extra DNA sequence, introduced two new enzyme cutting sites of NheI and ClaI, and optimized the homologous arm sequence of Gibson assembly( Figure 2 ). At the same time, the Gibson assembly reaction product was purified before electroporation, which improved the efficiency of electroporation. The library construction efficiency of iReSE system was more than 131 times higher than that of the original ReSE system( Figure 3 ).

[0049] 2. Library coverage and sample correlation of K562 cell line iReSE silencer screening experiment

[0050] To further test whether the iReSE system can improve the efficiency of silencer screening, K562 cell line was used as a model, and ATAC-seq was used to obtain open chromatin fragments to construct iReSE silencer screening library and perform silencer screening( Figure 4 ). The experimental results showed that the iReSE plasmid library of K562 cell line had more than 90% coverage of ATAC-seq peaks of the corresponding cell line in the ENCODE database( Figure 5 ). The sequencing reads of K562 cell line iReSE experimental repeat samples or the same sample before and after adding inducer were highly correlated (correlation coefficient from 0.77 to 0.97), which indicated that the quality of iReSE screening was very high( Figure 6 ).

[0051] 3. Identification and basic characterization of K562 cell line iReSE silencers

[0052] Using MAGeCK software to identify silencers from ATAC-iReSE silencer screening sequencing data, more than 230,000 silencers were identified in K562 cell line with the identification criteria of log2(fold change)>1 and FDR<0.01( Figure 7 ). These silencers were mainly distributed in promoters, introns and intergenic regions, with a length range of 50-1840bp and an average length of 203.6bp( Figure 8 ,Figure 9 ).

[0053] 4. Comparison of the number of silencers identified by K562 cell line iReSE and other silencer screening studies

[0054] The number of silencers identified by K562 cell line iReSE is significantly increased compared to the number of silencers identified by previous large-scale parallel reporter gene experiments Figure 10 ).

[0055] 5. Verification of the silencing activity of K562 cell line iReSE silencers

[0056] To verify the silencing activity of iReSE silencers, 11 randomly selected silencers from the screening were subjected to dual luciferase reporter gene detection, and silencers identified in the original ReSE system were selected as positive controls. They all showed the ability to inhibit the expression of the reporter gene compared to empty pGL4.13 Figure 11 ), which further indicates the reliability of the iReSE system. The endogenous silencing function of iReSE silencers was also verified by CRISPR knockout experiments. Using paired gRNA CRISPR to knock out the silencers identified by K562 cell line iReSE, compared with wild-type K562 cells, the knockout clones showed a significant up-regulation of gene expression level Figure 12 . This result shows that the silencers identified by iReSE can inhibit the expression of genes in the chromatin environment.

[0057] The above specific embodiments are only an explanation of the present application, and are not a limitation of the present application. Those skilled in the art can make modifications to the embodiments without creative contribution after reading the specification, as long as the modifications are within the scope of the claims of the present application.

Claims

1. An efficient high-throughput screening method for silencers, characterized by: The method comprises the following steps: S1. Obtain DNA library fragments using ATAC-seq, DNase-seq, CUT&Tag, or MNase-seq technology for construction of iReSE screening libraries. S2, iReSE screening vector is linearized by double enzyme digestion, and the ends of the linearized vector are adjacent to the homology arms required for Gibson assembly. Then, the screening library is constructed by optimized library construction and electroporation methods; S3, package the virus and infect cells for silencer screening; S4, identification of silencers by sequencing and analysis; S5. Verify the silencer activity through luciferase reporter gene assay and the endogenous inhibitory function of the silencer through CRISPR / Cas9 knockout assay.

2. The efficient high-throughput screening method for silencers according to claim 1, characterized in that: The S2 optimized library construction and electroporation method is as follows: the iReSE screening vector is double digested with NheI and ClaI to obtain a linearized vector; DNA library fragments were PCR amplified using AmpliMix and primers to introduce optimized homology arms. The amplified DNA library fragments with homology arms were purified and recovered. The purified DNA library fragments were directionally assembled into the upstream position of the EF-1α promoter of the linearized vector using NEBuilder HiFi DNA assembly premix. After incubation at 50°C for 60 minutes, the fragments were purified by isopropanol precipitation. The product was recovered with 5μl elution buffer and introduced into competent cells by electroporation. The competent cells were cultured on agarose plates at 37°C. After 12 hours, the cells were harvested and the screening library was obtained by plasmid extraction.

3. The efficient high-throughput screening method for silencers according to claim 2, characterized in that: The primers include a forward primer and a reverse primer; The forward primer: GAGATCCAGTTTGGTTAATTAAGAATGATACGGCGACCACCGAGA TCTACAC; The reverse primer: ACTCCTTTCAAGACCTAGCTATCAAGCAGAAGACGGCATACGAG AT.

4. The efficient high-throughput screening method for silencers according to claim 2, characterized in that: The 20 μl Gibson assembly system contained 330 ng of the enzyme-digested vector, and the molar ratio of the DNA fragment to be inserted to the enzyme-digested vector was 5:

1.

5. The efficient high-throughput screening method for silencers according to claim 1, characterized in that: The specific steps of S3 are as follows: HEK293T cells are used to package K562 iReSE library viruses; the transfection system of HEK293T cells in a 10 cm culture dish comprises 5 μg of library plasmid, 3.75 μg of psPAX2, and 1.25 μg of pMD2.G, which are mixed in 1 ml of Opti-MEM medium and then transfected by PEI. Fresh medium is replaced 24 hours after transfection. The virus-containing supernatant is collected 72 hours after transfection to determine the virus titer; the iReSE virus library is then centrifuged to infect K562 cells at a multiplicity of infection of 0.3, and 3×10 6 K562 cells were mixed with appropriate amount of virus solution and 8 μg / ml polybrene in a single well of a 12-well plate, and each replicate infected about 1.8×10 8 cells; 24 hours after infection, 2 μg / ml puromycin was used to select the successfully infected cells; After 7 days of puromycin selection, dead cells were removed using a dead cell removal kit, and 3.6 × 10 8 Cells were used as control group samples, and an equal number of cells were treated with 1 nM AP20187 for 23 hours to induce apoptosis. After removing dead cells, the cells were cultured until the number of viable cells recovered to 3.6 × 10 8 Each replicate was used as the experimental group sample.

6. The efficient high-throughput screening method for silencers according to claim 5, characterized in that: The specific steps of the S4 method for identifying silencers through sequencing and analysis are as follows: genomic DNA from the control group and the experimental group was extracted for iReSE library fragment amplification. Each 50 μl PCR reaction system contained 5 μg genomic DNA, 25 μl 2×Phanta Max buffer, 1 μl 10 mM dNTPs, 0.5 μl MgSO4, 0.25 μl Nextera index 1 and 0.25 μl Nextera index 2 primers, and 1 μl Phanta Max high-fidelity DNA polymerase. The amplified products were purified using VAHTS DNA purification beads and ZYMO purification columns, and then subjected to Illumina paired-end sequencing. The sliding window method was used to analyze the differences in sequencing reads within each window between the experimental group and the control group, and fragments significantly enriched in the experimental group samples were identified as silencers.

7. The efficient high-throughput screening method for silencers according to claim 1, characterized in that: The luciferase reporter gene experiment in S5 used a promoter different from the EF-1α promoter in the iReSE screening vector, such as the SV40 promoter, CMV promoter, hPGK promoter, and SCP promoter; in the CRISPR / Cas9 knockout experiment in S5, two paired sgRNAs targeting the upstream and downstream flanking regions of the silencer were located in the same expression vector and driven by the hU6 promoter and the mU6 promoter, respectively.

Images