A new gene taGW1-5b for controlling wheat grain weight and its application

Abstract

The application discloses a new gene TaGW1-5B for regulating wheat kernel weight and application thereof. The application provides application of TaGW1-5B protein or TaGW1-5B gene in regulating plant traits; the plant traits are plant kernel traits and / or plant root traits; the kernel traits are kernel weight and / or kernel length; the root traits are root length and / or root surface area. The regulation is negative regulation. The application also provides application of a substance for inhibiting TaGW1-5B gene in cultivating plants with changed kernel traits and / or changed root traits; the changed kernel traits are increased kernel weight and / or increased kernel length; the changed root traits are increased root length and / or increased root surface area. The application can be used for creating new wheat germplasm with higher unit yield, and has important theoretical significance and application value for improving kernel weight.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of crop breeding and biotechnology, and particularly relates to a new wheat grain weight regulating gene TaGW1-5B and application thereof. BACKGROUND

[0002] Wheat is one of the most important staple crops, and its high yield and stable yield are important guarantees for world food security. With the emergence of global climate change, population expansion and resource shortage, the situation of ensuring food security is becoming more and more severe, so it is more important to ensure the high yield and stable yield of wheat.

[0003] Yield is a complex trait, which is determined by three elements of panicle number per unit area, grain number per panicle and thousand-grain weight, and the heritability of thousand-grain weight is the highest. Mining thousand-grain weight genes, identifying excellent allelic variations and developing functional diagnostic markers can provide gene resources and molecular tools for wheat breeding, which has theoretical and practical significance for the yield improvement of wheat. SUMMARY

[0004] The application aims to provide a new wheat grain weight regulating gene TaGW1-5B and application thereof.

[0005] The application provides application of TaGW1-5B protein or TaGW1-5B gene in regulating plant traits; the plant traits are plant grain traits and / or plant root traits; the grain traits are grain weight and / or grain length; the root traits are root length and / or root surface area.

[0006] The regulation is negative regulation.

[0007] The abundance of TaGW1-5B protein is reduced, and the grain weight and / or grain length and / or root length and / or root surface area are increased.

[0008] The abundance of TaGW1-5B protein is increased, and the grain weight and / or grain length and / or root length and / or root surface area are reduced.

[0009] The abundance of TaGW1-5B gene is reduced, and the grain weight and / or grain length and / or root length and / or root surface area are increased.

[0010] The abundance of TaGW1-5B gene is increased, and the grain weight and / or grain length and / or root length and / or root surface area are reduced.

[0011] The application also provides application of TaGW1-5B gene or TaGW1-5B gene related biological material in cultivating transgenic plants with changed grain traits and / or root traits; the changed grain traits are reduced grain weight and / or reduced grain length; the changed root traits are reduced root length and / or reduced root surface area.

[0012] The application also provides use of a substance for inhibiting TaGW1-5B gene in cultivating a plant with changed grain traits and / or changed root traits; the changed grain traits are increased grain weight and / or increased grain length; the changed root traits are increased root length and / or increased root surface area. The plant is a plant with TaGW1-5B gene in genomic DNA. The substance for inhibiting TaGW1-5B gene is a substance for inhibiting expression of TaGW1-5B gene. The substance for inhibiting TaGW1-5B gene is a substance for gene editing of TaGW1-5B gene. The gene editing is CRISPR-Cas9-based gene editing. The substance for inhibiting TaGW1-5B gene is a substance for inhibiting TaGW1-5B gene based on CRISPR-Cas9 gene editing. The target gene of the CRISPR-Cas9 gene editing is the TaGW1-5B gene. The target sequence (containing PAM) of sgRNA of the CRISPR-Cas9 gene editing is shown in SEQ ID NO: 5. The substance for inhibiting TaGW1-5B gene can be a gene editing plasmid. The gene editing plasmid has a DNA molecule shown in positions 858-953 in SEQ ID NO: 4. The gene editing plasmid can be specifically a recombinant plasmid obtained by inserting the DNA molecule shown in SEQ ID NO: 4 into the PmeI enzyme cutting site of pWMB110-cas9 plasmid, while keeping other part sequences unchanged.

[0013] The application also provides a plant breeding method for the purpose of changed grain traits and / or changed root traits, comprising the following steps: introducing TaGW1-5B gene or TaGW1-5B gene related biological material into a recipient plant to obtain a transgenic plant with changed grain traits and / or changed root traits; the changed grain traits are decreased grain weight and / or decreased grain length; the changed root traits are decreased root length and / or decreased root surface area.

[0014] The application also provides a plant breeding method for changing grain traits and / or root traits, comprising the following steps: introducing a substance for inhibiting TaGW1-5B gene into a recipient plant to obtain a plant with changed grain traits and / or root traits; the changed grain traits are increased grain weight and / or increased grain length; the changed root traits are increased root length and / or increased root surface area. The plant is a plant with TaGW1-5B gene in genomic DNA. The substance for inhibiting TaGW1-5B gene is a substance for inhibiting the expression of TaGW1-5B gene. The substance for inhibiting TaGW1-5B gene is a substance for gene editing of TaGW1-5B gene. The gene editing is CRISPR-Cas9-based gene editing. The substance for inhibiting TaGW1-5B gene is a substance for inhibiting TaGW1-5B gene based on CRISPR-Cas9 gene editing. The target gene of the CRISPR-Cas9 gene editing is the TaGW1-5B gene. The target sequence (containing PAM) of the sgRNA of the CRISPR-Cas9 gene editing is shown in SEQ ID NO: 5. The substance for inhibiting TaGW1-5B gene can be a gene editing plasmid. The gene editing plasmid has a DNA molecule shown in positions 858-953 of SEQ ID NO: 4. The gene editing plasmid can be specifically: inserting the DNA molecule shown in SEQ ID NO: 4 into the PmeI enzyme cutting site of the pWMB110-cas9 plasmid, keeping the other part of the sequence unchanged, to obtain a recombinant plasmid.

[0015] The application also provides a plant breeding method for changing grain traits and / or root traits, comprising the following steps: mutating "GAGGACCTCCCGAGAGACTCCTGAGAGCTCCACCG" in the TaGW1-5B gene in the genome of a recipient plant into "GAGGACCTCCCTGAGAGACTCCTGAGAGCTCCACCG" or "GAGAGACTCCTGAGAGCTCCACCG". The plant is a plant with TaGW1-5B gene in genomic DNA. Specifically, the mutation is a homozygous mutation, that is, the same mutation occurs on a pair of homologous chromosomes. The changed grain traits are increased grain weight and / or increased grain length; the changed root traits are increased root length and / or increased root surface area.

[0016] The TaGW1-5B protein of any of the above is as follows (a1) or (a2) or (a3) or (a4):

[0017] (a1) the protein shown in SEQ ID NO: 1;

[0018] (a2) a fusion protein obtained by connecting a tag to the N terminus or / and C terminus of the protein of (a1);

[0019] (a3) a protein of (a1) or (a2) with substitution and / or deletion and / or addition of one or several amino acid residues and which is associated with a plant trait;

[0020] (a4) a protein derived from wheat and having more than 90% identity with (a1) or (a2) and which is associated with a plant trait.

[0021] The plant trait is a plant grain trait and / or a plant root trait; the grain trait is kernel weight and / or kernel length; the root trait is root length and / or root surface area.

[0022] Illustratively, the tag can be a tag for protein purification. Illustratively, the tag can be a Poly-Arg tag, a Poly-His tag, a FLAG tag, a Strep-tag II tag, a c-myc tag, etc.

[0023] The TaGW1-5B gene of any one of the above is a gene encoding the TaGW1-5B protein.

[0024] In particular, the TaGW1-5B gene of any one of the above is as follows (b1) or (b2) or (b3) or (b4) or (b5):

[0025] (b1) a DNA molecule whose coding region is as shown in SEQ ID NO: 2;

[0026] (b2) a DNA molecule as shown in positions 278-2554 of SEQ ID NO: 3;

[0027] (b3) a DNA molecule as shown in SEQ ID NO: 3;

[0028] (b4) a DNA molecule derived from wheat and having more than 90% identity with (b1) or (b2) or (b3) and encoding the protein;

[0029] (b5) a DNA molecule hybridizing to the nucleotide sequence defined in (b1) or (b2) or (b3) under stringent conditions and encoding the protein.

[0030] The stringent conditions can be hybridization in a solution of 0.1x SSPE (or 0.1x SSC), 0.1% SDS at 65°C and washing the membrane in a DNA or RNA hybridization experiment.

[0031] Any of the above 90% or more identity can be 91% or more identity, 92% or more identity, 93% or more identity, 94% or more identity, 95% or more identity, 96% or more identity, 97% or more identity, 98% or more identity, 99% or more identity, or 99.9% or more identity.

[0032] The TaGW1-5B gene related biological material is an expression cassette with the TaGW1-5B gene, a recombinant vector with the TaGW1-5B gene, or a recombinant cell with the TaGW1-5B gene. The recombinant vector with the TaGW1-5B gene can be specifically a recombinant plasmid obtained by inserting the TaGW1-5B gene into the multiple cloning site of the LGY-OE3 plasmid. The recombinant vector with the TaGW1-5B gene can be specifically a recombinant plasmid obtained by replacing the small fragment between the AvrII and BamHI enzyme cutting sites of the LGY-OE3 plasmid with the DNA molecule shown in SEQ ID NO: 2. The recombinant cell can be specifically a recombinant agrobacterium obtained by introducing the recombinant vector into agrobacterium (such as agrobacterium EHA105).

[0033] The application also protects a primer pair consisting of primer TaGW1-5B-F and primer TaGW1-5B-R; the TaGW1-5B-F is a single-stranded DNA molecule shown in SEQ ID NO: 6; the TaGW1-5B-R is a single-stranded DNA molecule shown in SEQ ID NO: 7.

[0034] The application also protects a primer combination (named primer combination A), consisting of primer Actin-F, primer Actin-R, the primer TaGW1-5B-F and the primer TaGW1-5B-R; the Actin-F is a single-stranded DNA molecule shown in SEQ ID NO: 8; the Actin-R is a single-stranded DNA molecule shown in SEQ ID NO: 9.

[0035] The application also protects a primer combination (named primer combination B), consisting of primer Kasp_5B_GW1A, primer Kasp_5B_GW1B and primer Kasp_5B_GW1C; the primer Kasp_5B_GW1A is a single-stranded DNA molecule shown in SEQ ID NO: 10; the primer Kasp_5B_GW1B is a single-stranded DNA molecule shown in SEQ ID NO: 11; the primer Kasp_5B_GW1C is a single-stranded DNA molecule shown in SEQ ID NO: 12.

[0036] The application also protects the use of the primer pair in identifying the grain trait of a plant; the grain trait is grain weight and / or grain length. The method for identifying the grain trait of a plant using the primer pair comprises the following steps: using the genomic DNA of the test plant as a template, performing PCR amplification using the primer pair, if the target band indicates that the test plant is TaGW1-5B-Hapl haplotype, if the target band is not shown, it indicates that the test plant is TaGW1-5B-Hap2 haplotype, and the grain weight and / or grain length of the TaGW1-5B-Hap2 haplotype plant is higher than that of the TaGW1-5B-Hapl haplotype plant. Illustratively, the target band is 1051bp.

[0037] The application also protects the use of the primer combination A in identifying the grain trait of a plant; the grain trait is grain weight and / or grain length. The method for identifying the grain trait of a plant using the primer combination A comprises the following steps: using the genomic DNA of the test plant as a template, performing PCR amplification using the primer combination A; if a 98bp band is shown, it indicates that the result is reliable; under the premise that the result is reliable, if the target band indicates that the test plant is TaGW1-5B-Hapl haplotype, if the target band is not shown, it indicates that the test plant is TaGW1-5B-Hap2 haplotype, and the grain weight and / or grain length of the TaGW1-5B-Hap2 haplotype plant is higher than that of the TaGW1-5B-Hapl haplotype plant. Illustratively, the target band is 1051bp.

[0038] The application also protects the use of the primer combination B in identifying the grain trait of a plant; the grain trait is grain weight and / or grain length. The method for identifying the grain trait of a plant using the primer combination B comprises the following steps: using the genomic DNA of the test plant as a template, performing competitive allele-specific polymerase chain reaction (KASP) using the primer combination B, and the grain weight and / or grain length of the plant with genotype result AA is higher than that of the plant with genotype result CC. The genotype result is the genotype result for a specific SNP. The specific SNP is located at the 21st position of the DNA molecule shown in SEQ ID NO: 13 in the genomic DNA. The polymorphic form of the specific SNP is A or C.

[0039] The application also protects the use of the primer pair in identifying root traits of plants; the root traits are root length and / or root surface area. The method for identifying root traits of plants using the primer pair comprises the following steps: using genomic DNA of a test plant as a template, performing PCR amplification using the primer pair, if a target band is shown, it means that the test plant is TaGW1-5B-Hapl haplotype, if no target band is shown, it means that the test plant is TaGW1-5B-Hap2 haplotype, and the root length and / or root surface area of a TaGW1-5B-Hap2 haplotype plant is higher than that of a TaGW1-5B-Hapl haplotype plant. Exemplarily, the target band is 1051 bp.

[0040] The application also protects the use of primer combination A in identifying root traits of plants; the root traits are root length and / or root surface area. The method for identifying root traits of plants using primer combination A comprises the following steps: using genomic DNA of a test plant as a template, performing PCR amplification using primer combination A; if a 98 bp band is shown, it means that the result is reliable; under the premise that the result is reliable, if a target band is shown, it means that the test plant is TaGW1-5B-Hapl haplotype, if no target band is shown, it means that the test plant is TaGW1-5B-Hap2 haplotype, and the root length and / or root surface area of a TaGW1-5B-Hap2 haplotype plant is higher than that of a TaGW1-5B-Hapl haplotype plant. Exemplarily, the target band is 1051 bp.

[0041] The application also protects the use of primer combination B in identifying root traits of plants; the root traits are root length and / or root surface area. The method for identifying root traits of plants using primer combination B comprises the following steps: using genomic DNA of a test plant as a template, performing competitive allele-specific polymerase chain reaction (KASP) using primer combination B, and the root length and / or root surface area of a plant with a genotype result of AA is higher than that of a plant with a genotype result of CC. The genotype result is the genotype result for a specific SNP. The specific SNP is located at position 21 of the DNA molecule shown in SEQ ID NO: 13 in the genomic DNA. The polymorphic form of the specific SNP is A or C.

[0042] The genomic DNA of a plant of TaGW1-5B-Hapl haplotype has a TaGW1-5B gene as shown in SEQ ID NO: 3. The genomic DNA of a plant of TaGW1-5B-Hap2 haplotype completely lacks the TaGW1-5B gene shown in SEQ ID NO: 3. The target sequence of the primer pair is located in the TaGW1-5B gene, so it can be used to identify the haplotype.

[0043] The SNP is in a close linkage relationship with the haplotype.

[0044] Specifically, the thousand seed weight is any one of the above.

[0045] Specifically, the plant is any one of the above monocotyledon or dicotyledon. Specifically, the plant is any one of the above Gramineae plant. Specifically, the plant is any one of the above Triticum plant. Specifically, the plant is any one of the above wheat, for example, wheat Fielder.

[0046] The application provides a new gene TaGW1-5B for regulating the thousand seed weight of wheat, and the encoded protein and application thereof. The TaGW1-5B gene negatively regulates the grain weight of wheat. Knocking out the gene can significantly improve the thousand seed weight, grain length, root length and root surface area of wheat. Overexpression of the gene can cause the thousand seed weight, grain length, root length and root surface area of wheat to be significantly reduced. The application can be used for creating new wheat germplasm with higher yield per unit, and has important theoretical significance and application value for grain weight improvement. BRIEF DESCRIPTION OF DRAWINGS

[0047] Figure 1 Sequencing results of KO1 and KO2 plants in Example 1.

[0048] Figure 2 Results of the relative expression amount of the TaGW1-5B gene in Example 2.

[0049] Figure 3 Exemplary photos of plants and statistical results of plant height, ear number and seed number in Example 3.

[0050] Figure 4 Exemplary photos of grains and statistical results of thousand seed weight, grain length and grain width in Example 3.

[0051] Figure 5 Exemplary photos of roots and statistical results of total root length and total surface area in Example 3.

[0052] Figure 6 The average thousand seed weight, average grain length and average grain width of the two haplotype populations. DETAILED DESCRIPTION

[0053] The application will be further described in detail below in conjunction with specific embodiments. The examples provided below are only for illustrating the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not in any way constitute a limitation on the application.

[0054] The experimental methods in the following examples are all conventional methods, unless otherwise specified, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained commercially. In the following examples, quantitative experiments, unless otherwise specified, are set up in triplicate, and the results are averaged. In the examples, the significance of the difference is indicated by asterisks, one asterisk (*) indicates that the P value is less than 0.05, two asterisks (**) indicates that the P value is less than 0.01, and three asterisks (***) indicates that the P value is less than 0.001. Wheat Fielder (also referred to as wild type plant, denoted as WT): a hexaploid spring wheat germplasm in the prior art. Zhongmai 871, Zhongmai 578 and Jimai 22 are all wheat germplasms in the prior art. Sequencing verification shows that the genomic DNA of wheat germplasms Fielder and Zhongmai 871 both have the DNA shown in SEQ ID NO: 3. The DNA shown in SEQ ID NO: 3 encodes the protein shown in SEQ ID NO: 1 (the coding region is 278-2554 in SEQ ID NO: 3). The open reading frame encoding the protein shown in SEQ ID NO: 1 in the wheat cDNA is shown in SEQ ID NO: 2.

[0055] The pWMB110-cas9 plasmid (i.e. the "vector containing a double tDNA region (pWMB248) and the CRISPR-associated protein 9 (Cas9) expression cassette" in the literature) is described in the following literature: The gene TaWOX5 overcomes genotype dependency in wheat genetic transformation, Nature Plants, VOL 8, February 2022, 110-117.

[0056] The LGY-OE3 plasmid (i.e. the "wheat LGY-OE3 vector" in the literature) is described in the following literature: Identification of TaGL1-B1 gene controlling grain length through regulation of jasmonic acid in common wheat, Plant Biotechnology Journal (2023) 21, 979-989.

[0057] Example 1, preparation of gene edited plants

[0058] I. Constructing CRISPR-Cas9 knockout vector

[0059] The DNA molecule shown in SEQ ID NO: 4 is inserted into the Pmel enzyme cutting site of the pWMB110-cas9 plasmid, and the other part of the sequence remains unchanged, to obtain a recombinant plasmid, which is the CRISPR-Cas9 knockout vector. In SEQ ID NO: 4, positions 858-953 encode sgRNA. The target sequence (containing PAM) of sgRNA is shown in SEQ ID NO: 5 (located in the TaGW1-5B gene).

[0060] II. Preparing gene edited plants

[0061] 1. Introduce the CRISPR-Cas9 knockout vector into Agrobacterium EHA105 to obtain recombinant Agrobacterium. Culture the recombinant Agrobacterium in YEP liquid medium containing 50 mg / L kanamycin and 50 mg / L rifampicin to a system OD value of 0.6-1.0, i.e. an Agrobacterium bacterial suspension. 600nm

[0062] 2. Take the grains of the wheat Fielder plant 12-15 days after flowering, peel the grains to take the embryos and perform pre-culture, then immerse them in the Agrobacterium bacterial suspension obtained in step 1 for 5 minutes, take them out and perform co-culture, screening culture, differentiation culture and rooting culture in sequence to obtain rooted regenerated plants, which are T0 generation plants.

[0063] 3. Screen gene edited plants from the T0 generation plants obtained in step 2.

[0064] Method for screening gene edited plants: take plant leaves, extract genomic DNA; use the genomic DNA as a template, perform PCR amplification with a primer pair composed of primer F1 and primer R1, then recover the amplification product (about 820 bp) and sequence it. If the sequencing result of the PCR amplification product of a plant is different from the reference sequence, the plant is a gene edited plant. Reference sequence (same below): the sequencing result of the PCR amplification product obtained by performing PCR amplification with a primer pair composed of primer F1 and primer R1 using the genomic DNA of the leaves of the wheat Fielder plant as a template.

[0065] Primer F1: 5'-TGGCCGGGACAAAATTGGTA-3';

[0066] Primer R1: 5'-CCAGCTATTCAATCGGAAGTCT-3'.

[0067] 4. Self-cross the T0 generation gene edited plants, harvest seeds and cultivate them into plants, which are T1 generation plants.

[0068] ​5. Screening homozygous gene edited plants from T1 generation plants.

[0069] Method for screening homozygous gene edited plants: taking plant leaves, extracting genomic DNA; taking the genomic DNA as a template, using a primer pair composed of primer F1 and primer R1 to perform PCR amplification, then recovering the amplification product (about 820 bp) and sequencing. If the PCR amplification product of a plant shows only one sequencing result and is different from the reference sequence, the plant is a homozygous gene edited plant.

[0070] Two homozygous gene edited plants were obtained, designated as KO1 plant and KO2 plant.

[0071] The sequencing results of KO1 plant and KO2 plant are shown in Figure 1 The "GAGGACCTCCCGAGAGACTCCTGAGAGCTCCACCG" in the TaGW1-5B gene in the genomic DNA of wheat Fielder is mutated to "GAGGACCTCCCTGAGAGACTCCTGAGAGCTCCACCG" in the genomic DNA of KO1 plant, and to "GAGAGACTCCTGAGAGCTCCACCG" in the genomic DNA of KO2 plant. The above mutations all cause protein translation frameshift and premature termination.

[0072] The progeny plants obtained by selfing KO1 plant are KO1 line plants. The progeny plants obtained by selfing KO2 plant are KO2 line plants.

[0073] Example 2, preparation of overexpression plants

[0074] I. Construction of overexpression plasmid

[0075] The small fragment between the AvrII and BamHI enzyme cutting sites of LGY-OE3 plasmid is replaced with the DNA molecule shown in SEQ ID NO: 2, and the other part of the sequence remains unchanged, to obtain a recombinant plasmid, which is the overexpression plasmid.

[0076] II. Preparation of overexpression plants

[0077] 1. Introduce the overexpression plasmid prepared in step one into Agrobacterium EHA105 to obtain recombinant Agrobacterium. Culture the recombinant Agrobacterium in YEP liquid medium containing 50 mg / L kanamycin and 50 mg / L rifampicin to an OD value of 0.6-1.0, which is the Agrobacterium bacterial suspension. 600nm

[0078] ​2. Take the seeds of the Fielder plants 12-15 days after flowering, peel the seeds to take the embryos and pre-culture, then immerse in the Agrobacterium suspension obtained in step 1 for 5 minutes, take out and then perform co-culture, screening culture, differentiation culture and rooting culture in sequence to obtain the regenerated plants with roots, which are the T0 generation plants.

[0079] 3. Screen the transgenic plants from the T0 generation plants obtained in step 2.

[0080] Method for screening the transgenic plants: take the leaves of the plants, extract the genomic DNA; use the genomic DNA as a template and perform PCR amplification with the primer pair composed of primer F2 and primer R2, then perform agarose gel electrophoresis, if the electrophoresis shows a target band of about 421 bp, the plant is a transgenic plant.

[0081] Primer F2: 5'-TATGCAGCAGCTATATGTGG-3';

[0082] Primer R2: 5'-GGGCCTGTACGTAGTGGAAC-3'.

[0083] 4. Self-cross the transgenic plants of the T0 generation plants, harvest the seeds and cultivate them into plants, which are the T1 generation plants.

[0084] 5. Screen the transgenic plants from the T1 generation plants obtained in step 4 (the method is the same as step 3).

[0085] 6. Self-cross the transgenic plants of the T1 generation plants, harvest the seeds and cultivate them into plants, which are the T2 generation plants.

[0086] 7. Screen the transgenic plants from the T2 generation plants obtained in step 6 (the method is the same as step 3).

[0087] For a certain T1 generation plant, if all the T2 generation plants obtained by self-crossing thereof are transgenic plants, the T1 generation plant is a homozygous transgenic plant. Obtain three homozygous transgenic plants and name them as OE1 plant, OE2 plant and OE3 plant respectively. The progeny plants obtained by self-crossing of the OE1 plant are the OE1 line plants. The progeny plants obtained by self-crossing of the OE2 plant are the OE2 line plants. The progeny plants obtained by self-crossing of the OE3 plant are the OE3 line plants.

[0088] III. Detecting the expression amount of the target gene

[0089] The test plants were: wheat Fielder plants, OE1 line plants (T2 generation), OE2 line plants (T2 generation), or OE3 line plants (T2 generation) cultured under parallel conditions. The leaves of the test plants were taken, total RNA was extracted, and cDNA was obtained by reverse transcription. The relative expression amount of the TaGW1-5B gene was detected by fluorescence quantitative PCR (2-△△CT method) with cDNA as the template and TraesCS5B02G124100 gene as the internal reference gene.

[0090] The primers for detecting the TaGW1-5B gene are as follows:

[0091] F3: 5'-TGTTCCAAGGCTAGTGGTTGTG-3';

[0092] R3: 5'-CTCAGCACGCTTTAGCTTCATATG-3'.

[0093] The primers for detecting the internal reference gene are as follows:

[0094] Actin-F: 5'-ATGGAAGCTGCTGGAATCCAT-3'

[0095] Actin-R: 5'-CCTTGCTCATACGGTCAGCAATAC-3'.

[0096] The results of the relative expression amount of the TaGW1-5B gene are shown in Figure 2 .

[0097] Example 3, trait identification

[0098] Test plants: wheat Fielder plants, KO1 line plants (T2 generation), KO2 line plants (T2 generation), OE1 line plants (T2 generation), OE2 line plants (T2 generation), or OE3 line plants (T2 generation).

[0099] Location: Transgenic base of Hebei Province Agricultural and Forestry Academy of Grain and Oil Crop Research in Shijiazhuang City, Hebei Province.

[0100] The test plants were cultured under parallel conditions (the sowing time was December 3, 2022).

[0101] An exemplary photograph of the plants three weeks after flowering (in the grain filling period) is shown in Figure 3 . The plant height of the plants in the grain filling period was counted (the number of plants N = 55), the number of spikes per plant was counted in the flowering period (the number of plants N = 20), and the number of grains per spike was counted in the mature period (the number of plants N = 50), and the results are shown in Figure 3 . There were no significant differences in the above indicators.

[0102] At maturity, collect the grains, and count the thousand-grain weight, grain length, and grain width per plant. Exemplary photos of the grains are shown in FIG. 2A, and the counting results of the thousand-grain weight, grain length, and grain width (plant number N = 52) are shown in FIG. 2B. Figure 4 Figure 4 Compared with the WT plants, the thousand-grain weight of the KO plants was significantly increased, and the thousand-grain weight of the OE plants was significantly decreased. Compared with the WT plants, the grain length of the KO plants was significantly increased, and the grain length of the OE plants was significantly decreased. There was no significant difference in the grain width between the KO plants and the WT plants, and there was no significant difference in the grain width between the OE plants and the WT plants.

[0103] Three weeks after germination, the plants were observed, and the total root length and total root surface area were measured. Exemplary photos of the plant roots are shown in FIG. 3A, and the counting results of the total root length and total surface area (sample number N = 18) are shown in FIG. 3B. Figure 5 Figure 5 Compared with the WT plants, the total root length of the KO plants was significantly increased, and the total root length of the OE plants was significantly decreased. Compared with the WT plants, the total root surface area of the KO plants was significantly increased, and the total root surface area of the OE plants was significantly decreased.

[0104] The results show that knocking out the gene can significantly increase the thousand-grain weight, grain length, total root length, and total root surface area of wheat, and overexpressing the gene can significantly decrease the thousand-grain weight, grain length, total root length, and total root surface area of wheat.

[0105] Example 4, Design, Preparation, and Application of a PCR Primer Set

[0106] A large number of sequence analyses show that the existing wheat germplasm can be divided into two haplotypes based on the TaGW1-5B gene, i.e., a TaGW1-5B-Hap1 haplotype (the TaGW1-5B gene as shown in SEQ ID NO: 3 is present in the genomic DNA) and a TaGW1-5B-Hap2 haplotype (the TaGW1-5B gene as shown in SEQ ID NO: 3 is completely absent in the genomic DNA). For wheat breeding lines, there is basically no heterozygote.

[0107] I. Design and Preparation of the Primer Set

[0108] The primer set consists of two primer pairs. The primer pair consisting of TaGW1-5B-F and TaGW1-5B-R is used to identify the two haplotypes of the TaGW1-5B gene. The primer pair consisting of Actin-F and Actin-R is used to identify the internal reference gene.

[0109] TaGW1-5B-F (SEQ ID NO: 6): 5'-CCCGAGAGACTCCTGAGAGC-3';

[0110] ​​TaGW1-5B-R (SEQ ID NO: 7): 5'-CCATGGATGCGACTTTGTTGG-3'.

[0111] Actin-F (SEQ ID NO: 8): 5'-ATGGAAGCTGCTGGAATCCAT-3';

[0112] Actin-R (SEQ ID NO: 9): 5'-CCTTGCTCATACGGTCAGCAATAC-3'.

[0113] The above four primers were prepared respectively.

[0114] II. Establishment of method

[0115] The test germplasm seedling leaves were taken, and the genomic DNA was extracted. The genomic DNA was used as a template for PCR amplification, followed by agarose gel electrophoresis.

[0116] The reaction system (30 μL) of PCR amplification: 2x PCR mix 15 μL, Actin-F 0.2 μL, Actin-R 0.2 μL, TaGW1-5B-F 2 μL, TaGW1-5B-R 2 μL, template DNA 2 μL, ddH2O 8.6 μL. In the reaction system, the concentration of Actin-F was 10 pmol / μL, the concentration of Actin-R was 10 pmol / μL, the concentration of TaGW1-5B-F was 10 pmol / μL, the concentration of TaGW1-5B-R was 10 pmol / μL, and the concentration of template DNA was 50-150 ng / μl. 2x PCR mix (full name: 2x Phanta Max Master Mix): Novozyme Company, item number P525. The reaction program of PCR amplification: 95°C for 5 min; 95°C for 30 s, 62°C for 30 s, 72°C for 1 min, 10 cycles; 95°C for 30 s, 58°C for 30 s, 72°C for 1 min, 26 cycles.

[0117] If a band of about 98 bp (amplification product of Actin gene) is shown, it is proved that the result is reliable.

[0118] Under the premise that the result is reliable, the target band (about 1051 bp) represents that the test wheat is TaGW1-5B-Hap1 haplotype, and the non-target band (about 1051 bp) represents that the test wheat is TaGW1-5B-Hap2 haplotype.

[0119] III. Application of method

[0120] The test germplasm was 166 wheat germplasms in Huanghuai wheat region (see Table 1).

[0121] According to step two, the haplotype results of the test germplasm are shown in Table 1, and an exemplary electropherogram is shown in Figure 6 .

[0122] The test germplasm was sown in farmland in Shijiazhuang City, Hebei Province, and the seeds on the plants were collected at the mature stage, and the thousand seed weight, seed length and seed width were counted, and the results are shown in Table 1.

[0123] According to the haplotype results, the test germplasm was divided into two groups, and the average values of the thousand seed weight, seed length and seed width of each group were counted, and the results are shown in Figure 6 Compared with the TaGW1-5B-Hap1 haplotype germplasm, the TaGW1-5B-Hap2 haplotype germplasm showed obvious advantages in the agronomic traits of thousand seed weight and seed length.

[0124] Table 1

[0125]

[0126]

[0127]

[0128]

[0129] Example 5, design, preparation and application of KASP primer set

[0130] I. Design and preparation of primer set

[0131] Based on the SNP upstream of the gene TaGW1-5B, a linkage KASP (Kompetitive Allele-Specific PCR) marker was developed for the purpose of assisting the identification of wheat grain weight traits. The SNP is located at position 50226385 on chromosome 5B in the Chinese Spring wheat reference genome sequence RefSeqv1.0, with nucleotide C or A (C is closely linked to TaGW1-5B-Hap1 haplotype, and A is closely linked to TaGW1-5B-Hap2 haplotype). The KASP primer set consists of primer Kasp_5B_GW1A (SEQ ID NO: 10), primer Kasp_5B_GW1B (SEQ ID NO: 11) and primer Kasp_5B_GW1C (SEQ ID NO: 12), and the target sequence is shown in SEQ ID NO: 13 (M represents C or A).

[0132] Kasp_5B_GW1A: 5’- GAAGGTGACCAAGTTCATGC TAAGTCGCCTCCGTAACCGTC-3’;

[0133] Kasp_5B_GW1B:5'- GAAGGTCGGAGTCAACGGAT TAAGTCGCCTCCGTAACCGTA-3';

[0134] Kasp_5B_GW1C: 5'-TTGTTGCGTTGCAGCTTGAG-3'.

[0135] Prepare the above three primers separately.

[0136] II. Method Establishment

[0137] 1. Take leaves from seedlings of the tested germplasm and extract genomic DNA (DNA content is 25-80 ng / μl).

[0138] 2. Take a 384-well PCR plate, add 1.5 μL of genomic DNA to each well, and then dry at 50°C.

[0139] 3. After completing step 2, take the 384-well PCR plate, add 3 μL of KASP reaction premix to each well, then perform the reaction, and then output the genotype results.

[0140] KASP reaction premix: KASP 2×Master Mix 600 μL, Kasp_5B_GW1A 1.6 μL, Kasp_5B_GW1B 1.6 μL, Kasp_5B_GW1C 4.1 μL, ddH2O 600 μL. The concentrations of Kasp_5B_GW1A, Kasp_5B_GW1B, and Kasp_5B_GW1C in the KASP reaction premix are all 100 pmol / μL. KASP 2×Master Mix: LGC Corporation, catalog number KBS-1016-002.

[0141] KASP reaction program: 94℃ for 15 min; 94℃ for 20 s, annealing for 1 min, for a total of 10 cycles (the annealing temperature in the first cycle is 65℃, and the annealing temperature decreases by 1℃ in each cycle); 94℃ for 20 s, 57℃ for 1 min, for 32 cycles.

[0142] III. Preparation of RIL populations

[0143] Zhongmai 578 (containing the TaGW1-5B gene shown in SEQ ID NO: 3 in its genomic DNA and being homozygous) and Jimai 22 (lacking the TaGW1-5B gene shown in SEQ ID NO: 3 in its genomic DNA and being homozygous) were used as parents to cross and obtain F1 generation grains. The plants obtained from F1 generation grain culture were self-pollinated to obtain F2 generation grains. The F2 generation grains were then subjected to single-seed self-pollination for 8 generations to obtain the RIL population.

[0144] A total of 262 RIL populations were obtained.

[0145] Four, application of the method

[0146] The test germplasm was the 262 RIL populations prepared in step three.

[0147] According to step two, the CC genotype was determined as the TaGW1-5B-Hap1 haplotype, and the AA genotype was determined as the TaGW1-5B-Hap2 haplotype. The haplotype results of the test germplasm are shown in Table 2. 131 RIL populations showed the TaGW1-5B-Hap1 haplotype, and another 131 lines showed the TaGW1-5B-Hap2 haplotype.

[0148] The test germplasm was sown in the field in autumn, and the grain was harvested at the mature stage, and the thousand-grain weight was calculated. Different years, different locations, and different irrigation modes were set, specifically: ① In 2023, sown in Gaoyi County, Hebei Province, and irrigated normally; ② In 2023, sown in Dezhou, Shandong Province, and irrigated normally; ③ In 2024, sown in Xinxiang, Henan Province, and irrigated normally; ④ In 2024, sown in Xinxiang, Henan Province, and irrigated with water-saving irrigation. Normal irrigation: before winter, during the tillering period, the green period, the heading period, and the early grain filling period, respectively, large water flooding irrigation was carried out. Water-saving irrigation: irrigation was carried out during the tillering period before winter, and thereafter no artificial water was added, and in the later period, natural precipitation was relied on to meet the growth needs of wheat. The results of the thousand-grain weight statistics are shown in Table 2.

[0149] Table 2

[0150]

[0151]

[0152]

[0153]

[0154]

[0155]

[0156] According to the haplotype results, the test germplasm was divided into two groups, and the average thousand-grain weight of each group was calculated, and the results are shown in Table 3. The phenotypic data of the four environments showed that compared with the TaGW1-5B-Hap1 haplotype germplasm, the thousand-grain weight of the TaGW1-5B-Hap2 haplotype germplasm increased by 5.3%. The results showed that the KASP primer set can be used for molecular marker-assisted selection, and can quickly screen wheat germplasm with high and low differences in grain weight, thereby accelerating the pace of breeding new wheat varieties, and has important theoretical significance and economic value.

[0157] Table 3

[0158]

[0159] The application has been described in detail. Those skilled in the art will understand that they can make modifications and alterations to this application without departing from the spirit and scope of the application. Although this application is given with specific embodiments, it is understood that further modifications can be made by those skilled in the art. In general, the application is intended to cover any adaptations or variations of the present application including modifications based on the generic principles of the application as well as variations thereof that would be readily apparent to those skilled in the art. Some embodiments of the application are shown in the drawings and described above. It will be apparent to those skilled in the art that various modifications can be made to the application without departing from the scope of the application. Thus, other embodiments will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. Various embodiments and aspects of the application are described herein. It is to be understood that certain features shown and / or discussed in connection with any disclosed forms of the application can be implemented in any and all combinations with one another, and in the application as a whole. It is further to be understood that certain features can be applied to some embodiments but not others, and that certain features can be applied both individually and in various combinations to produce varying results.

Claims

1. A TaGW1-5B protein or TaGW1-5B application in modulating plant traits; The TaGW1-5B protein is as follows (a1) or (a2): (a1) the protein shown in SEQ ID NO: 1; (a2) a fusion protein obtained by connecting a tag to the N terminus or / and C terminus of the protein in (a1); The TaGW1-5B The gene is (bl) or (b2) or (b3) as follows: (b1) a DNA molecule whose coding region is shown in SEQ ID NO: 2; (b2) a DNA molecule shown in SEQ ID NO: 3 from 278 to 2554; (b3) a DNA molecule shown in SEQ ID NO: 3; The plant is wheat. The regulation is negative regulation. The plant trait is plant grain trait and / or plant root trait; the grain trait is kernel weight and / or kernel length; the root trait is root length and / or root surface area.

2. TaGW1-5B a gene or TaGW1-5B application of a gene or TaGW1-5B application of a gene or TaGW1-5B application of a gene or The TaGW1-5B The gene of claim 1 TaGW1-5B The gene of claim 1 The TaGW1-5B Gene-related biomaterials are those possessing the aforementioned TaGW1- 5B Gene expression cassettes, recombinant vectors, or recombinant cells; the plant is wheat; the grain trait change is a decrease in grain weight and / or a decrease in grain length; the root trait change is a decrease in root length and / or a decrease in root surface area.

3. Use of a substance for inhibiting a gene in a plant grown for altered grain traits and / or altered root traits; said substance for inhibiting a gene TaGW1-5B TaGW1-5B is a substance for inhibiting a gene based on CRISPR-Cas9 gene editing TaGW1-5B ; the target gene of the CRISPR-Cas9 gene editing is the TaGW1-5B gene; the TaGW1-5B gene is the TaGW1-5B gene as described in claim 1 ; the plant is wheat; the altered grain traits are increased grain weight and / or increased grain length; the altered root traits are increased root length and / or increased root surface area.​ 4. A plant breeding method for the purpose of altering grain traits and / or root traits, comprising the following steps: introducing [the following steps] into a recipient plant. TaGW1-5B Gene or TaGW1-5B Gene-related biological materials were used to obtain transgenic plants with altered grain traits and / or root traits; the plant was wheat; TaGW1-5B The gene is as described in claim 1 TaGW1-5B Genes; the stated TaGW1-5B Gene-related biomaterials are those possessing the aforementioned TaGW1-5B Gene expression cassettes, recombinant vectors, or recombinant cells; the grain trait change is a decrease in grain weight and / or a decrease in grain length; the root trait change is a decrease in root length and / or a decrease in root surface area.

5. A plant breeding method for the purpose of altering grain traits and / or root traits, comprising the following steps: introducing inhibitory agents into a recipient plant. TaGW1-5B Genetic material, resulting in plants with altered grain traits and / or root traits; the material used to inhibit... TaGW1-5B The gene material is based on CRISPR-Cas9 gene editing repression. TaGW1-5B The genetic material, wherein the target gene of the CRISPR-Cas9 gene editing is the... TaGW1-5B Genes; the stated TaGW1-5B The gene is as described in claim 1 TaGW1-5B Genes; the plant is wheat; the grain trait change is an increase in grain weight and / or an increase in grain length; the root trait change is an increase in root length and / or an increase in root surface area.

6. A plant breeding method for the purpose of altering grain traits and / or root traits, comprising the following steps: [The text abruptly ends here, so the translation stops.] TaGW1-5B The gene "GAGGACCTCCCGAGAGACTCCTGAGAGCTCCACCG" mutates to "GAGGACCTCCCTGAGAGACTCCTGAGAGCTCCACCG" or "GAGAGACTCCTGAGAGCTCCACCG"; TaGW1- 5B The gene is as described in claim 1 TaGW1-5B Genes; the plant is wheat; the grain trait change is an increase in grain weight and / or an increase in grain length; the root trait change is an increase in root length and / or an increase in root surface area.

7. Use of a primer pair in identifying grain trait of a plant; The grain trait is kernel weight and / or kernel length. The primer pair consists of primer TaGW1-5B-F and primer TaGW1-5B-R; the TaGW1-5B-F is a single-stranded DNA molecule shown in SEQ ID NO: 6; the TaGW1-5B-R is a single-stranded DNA molecule shown in SEQ ID NO: 7; The method for identifying the grain traits of plants by using the primer pair comprises the following steps: taking the genomic DNA of a test plant as a template, performing PCR amplification by using the primer pair, and if a 1051 bp target band is shown, it represents that the test plant is TaGW1- 5B-Hap1 haplotype, if a 1051 bp target band is not shown, it represents that the test plant is TaGW1-5B-Hap2 haplotype, TaGW1-5B-Hap2 a haplotype plant with higher grain weight and / or grain length than TaGW1-5B-Hap1 a haplotype plant; The plant is wheat.

8. Use of a primer combination in identifying grain trait of a plant; The grain trait is kernel weight and / or kernel length. The primer combination consists of primer Actin-F, primer Actin-R, primer TaGW1-5B-F and primer TaGW1-5B-R; the Actin-F is a single-stranded DNA molecule shown in SEQ ID NO: 8; the Actin-R is a single-stranded DNA molecule shown in SEQ ID NO: 9; the TaGW1-5B-F is a single-stranded DNA molecule shown in SEQ ID NO: 6; the TaGW1-5B-R is a single-stranded DNA molecule shown in SEQ ID NO: 7; The method for identifying the grain traits of plants by using the primer combination comprises the following steps: using the genomic DNA of the test plant as a template, and performing PCR amplification by using the primer combination; if a 98 bp band is shown, it is proved that the result is reliable; under the premise that the result is reliable, if a 1051 bp target band is shown, it means that the test plant is TaGW1-5B-Hap1 haplotype, TaGW1-5B-Hap2 haplotype, TaGW1-5B-Hap2 haplotype plant, the grain weight and / or grain length of the haplotype plant is higher than TaGW1-5B-Hap1 haplotype plant; The plant is wheat.

9. Use of a primer combination in identifying grain trait of a plant; The grain trait is kernel weight and / or kernel length. The primer combination consists of primer Kasp_5B_GW1A, primer Kasp_5B_GW1B and primer Kasp_5B_GW1C; the primer Kasp_5B_GW1A is a single-stranded DNA molecule as shown in SEQ ID NO: 10; the primer Kasp_5B_GW1B is a single-stranded DNA molecule as shown in SEQ ID NO: 11; the primer Kasp_5B_GW1C is a single-stranded DNA molecule as shown in SEQ ID NO: 12; The method for identifying the kernel traits of plants by using the primer combination comprises the following steps: using the genomic DNA of the test plants as a template, and performing competitive allele-specific polymerase chain reaction by using the primer combination; the kernel weight and / or kernel length of the plants with the genotype AA are higher than those of the plants with the genotype CC; The plant is wheat.

10. Use of a primer pair in identifying root traits of plants; The root traits are root length and / or root surface area; The primer pair is the primer pair as defined in claim 7; The method for identifying root traits of a plant using the primer pair comprises the following steps: taking genomic DNA of a test plant as a template, performing PCR amplification using the primer pair, and if a 1051 bp target band is shown, the test plant is TaGW1-5B- Hap1 haplotype, if a 1051 bp target band is not shown, the test plant is TaGW1-5B-Hap2 hapolotype, TaGW1- 5B-Hap2 a haplotype plant with higher root length and / or root surface area than TaGW1-5B-Hap1 a haplotype plant; The plant is wheat.

11. Use of a primer combination in identifying root traits of plants; The root traits are root length and / or root surface area; The primer combination is the primer combination as defined in claim 8; The method for identifying root traits of plants using the primer combination comprises the following steps: using genomic DNA of the test plant as a template, and performing PCR amplification using the primer combination; if a 98 bp band is shown, the result is considered reliable; under the premise that the result is considered reliable, if a 1051 bp target band is shown, it means that the test plant is TaGW1-5B-Hap1 haplotype, if a 1051 bp target band is not shown, it means that the test plant is TaGW1-5B-Hap2 haplotype, TaGW1-5B-Hap2 haplotype plant, TaGW1-5B-Hap1 haplotype plant; The plant is wheat.

12. Use of a primer combination in identifying root traits of plants; The root traits are root length and / or root surface area; The primer combination is the primer combination as defined in claim 9; The method for identifying the root traits of plants by using the primer combination comprises the following steps: using the genomic DNA of the test plants as a template, and performing competitive allele-specific polymerase chain reaction by using the primer combination; the root length and / or root surface area of the plants with the genotype AA are higher than those of the plants with the genotype CC; The plant is wheat.

Images