Trace nucleic acid methylation library building method of exosome DNA and application of trace nucleic acid methylation library building method
By combining the Tn5 transposase complex and enzymatic conversion with single-stranded ligase, the problems of low efficiency and DNA damage in constructing a trace amount of exosome DNA methylation library were solved, and efficient and accurate methylation analysis was achieved.
Patent Information
- Application Number
- CN202411361596.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-27
- Publication Date
- 2025-10-17
AI Technical Summary
Existing technologies make it difficult to effectively construct methylation libraries for trace amounts of exosomal DNA. Traditional methods lead to DNA damage and low library construction efficiency. In addition, improper linker connection during library construction using traditional transposases results in 50% of the library being unable to be amplified.
The Tn5 transposase complex was used for fragmentation, and TET2, T4-βGT, and APOBEC3A enzymes were used to convert methylated cytosine in exosomal DNA into specific forms, avoiding the conversion of common cytosine to uracil. Combined with single-stranded ligase and PCR amplification, efficient library construction was achieved.
It has achieved the construction of methylation libraries of exosome DNA at the sub-nanogram level, improved the library construction efficiency and sequencing quality, obtained more accurate methylation analysis sites, and overcome the DNA damage and low efficiency problems of traditional methods.
Smart Images

Figure CN120796436A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology, and relates to methylation sequencing, in particular to a method for constructing a trace amount of nucleic acid methylation library of exosome DNA and application thereof. BACKGROUND
[0002] Epigenetic changes refer to heritable and reversible changes in gene expression without any sequence alterations. The most common and first identified modification type is DNA methylation. In mammals, DNA methylation most commonly occurs on cytosine in CpG islands. Among DNA methylation modifications, 5-methylcytosine (5mC) is the most abundant type, accounting for about 3-5% of total DNA bases. Numerous studies have shown that normal DNA methylation plays an important regulatory role in various cellular processes, including embryonic development, cell differentiation, etc. Abnormal DNA methylation can cause dysregulation of gene expression, leading to various diseases, and even cancer. Because normal cells and tumor cells have different methylation patterns, the methylation distribution pattern of DNA in cancer can be determined to detect and diagnose tumors.
[0003] In liquid biopsy, researchers have found that methylation mutations of exosome DNA have the potential to be used as a diagnostic marker for cancer. However, due to the extremely low concentration of exosome DNA, the total amount of exosome extracted from clinical plasma is only picograms per milliliter, which is much lower than the ordinary methylation library sample amount, posing a great challenge to methylation library construction. The traditional second-generation sequencing method for detecting methylation combines double-stranded library construction and bisulfite method. After adding double-stranded adapters to the long fragment DNA, bisulfite treatment is performed. After bisulfite treatment, the methylated cytosine will not be converted, so it will be read as C during amplification and sequencing, while the ordinary cytosine will be converted to uracil, so it will be read as T during amplification and sequencing. By comparing this change with the genome, the position of the methylated cytosine can be determined. However, bisulfite can cause DNA damage and degradation during the conversion process. In addition, the broken DNA can also cause the loss of adapters, thereby reducing the coverage of the library. A more gentle method of conversion is used by using the enzyme conversion method based on 10-11 translocation methylcytosine dioxygenase (TET2) and T4-phage-beta-glucosyltransferase (T4-beta GT) and apolipoprotein B mRNA editing enzyme catalytic subunit 3A (APOBEC3A). In this method, TET2 and T4-beta GT convert 5mC and 5hmC into 5caC and 5ghmC, so they will not be deaminated by the subsequent APOBEC3A enzyme, only the unmethylated cytosine is converted to uracil. This method can be applied to lower starting amounts and will not cause damage to the DNA.
[0004] Since the traditional double-stranded library construction method needs to break long fragment DNA, and the concentration of exosome DNA is extremely low, the library construction method for long fragment DNA can use transposase library construction method. Transposase library construction method makes the steps of DNA fragmentation, adapter ligation, etc. in one step. Two different adapters are assembled in the transposase complex, and at the same time of DNA fragmentation, the two adapters will be added to the two ends of the DNA fragmentation, so that subsequent amplification and sequencing can be performed. However, during the traditional transposase library construction, there are 50% cases of adding the same adapter to both sides, which cannot be amplified by PCR, resulting in a decrease in library construction efficiency. SUMMARY
[0005] In order to overcome the deficiencies in the prior art and realize the whole gene sequencing of picogram per milliliter level of trace exosome DNA methylation, the purpose of the present application is to provide a trace nucleic acid methylation library construction method for exosome DNA, which realizes the methylation library construction of trace exosome DNA for the first time and obtains the methylation distribution information of exosome DNA. At the same time, the method can be applied to the methylation library construction of all trace DNA (length greater than 500bp).
[0006] In order to achieve the above purpose, the present application adopts the following technical solutions:
[0007] A trace nucleic acid methylation library construction method for exosome DNA, comprising the following steps:
[0008] (1) Assembling Tn5 transposase complex: assembling a single transposon adapter sequence and Tn5 transposase into a Tn5 transposase complex. The single transposon adapter sequence is obtained by annealing an adapter sequence and a 19bp transposase recognition sequence (mosaic end, ME); the cytosines in the single transposon adapter sequence are all methylated cytosines.
[0009] (2) Using the transposase complex assembled in step (1) to fragment the exosome DNA to obtain a fragmented product with a 5' transposon adapter and a gap.
[0010] (3) Using an enzyme method to transform the cytosines in the exosome DNA fragmentation product obtained in step (2) to obtain a transformed single-stranded exosome DNA. The enzyme used in the enzyme method includes TET2, T4-beta GT and APOBEC3A. The fragmentation product is first used with TET2 and T4-beta GT to transform all methylcytosine and hydroxymethylcytosine into carboxylcytosine and beta-glucosylmethylcytosine, and then APOBEC3A is used to deaminate the unmodified cytosine into uracil.
[0011] (4) The 3' adapter ligation is performed on the converted single-stranded exosome DNA using a single-stranded ligase, and the DNA after ligation of the adapter is double-stranded extended using an extension primer.
[0012] (5) The DNA obtained in step (4) is subjected to PCR amplification using a library building adapter primer with index to obtain a methylation library.
[0013] In step (1),
[0014] The adapter sequence is preferably 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3' (SEQ ID NO. 1);
[0015] The 19bp transposase recognition sequence is 5'-[phos]CTGTCTCTTATACACATCT-3' (SEQ ID NO. 2).
[0016] The exosome DNA in step (2) is preferably prepared by a method comprising the following steps:
[0017] 1) Exosome extraction: extract exosomes according to the source of exosomes; the extraction of exosomes from plasma, serum, and cultured cells is as follows:
[0018] 1.1) Plasma exosome extraction: Take 2-5 mL of whole blood in an EDTA anticoagulant tube, centrifuge at 2500-3000 rpm for 15-20 minutes, transfer the supernatant to a nuclease-free tube, and remove the bottom layer of blood cells.
[0019] 1.2) Serum exosome extraction: Take 2-5 mL of whole blood in a non-anticoagulant tube, and after 2-4 hours of blood clotting, centrifuge at 2500-3000 rpm for 15-20 minutes, and transfer the supernatant to a nuclease-free tube.
[0020] 1.3) Cell culture supernatant exosome extraction: The cells are cultured in a medium containing 10% exosome-removed fetal bovine serum for more than 60 hours, the cell supernatant is taken out, centrifuged at 1500g to remove excess cells and cell debris, and the supernatant is transferred to a nuclease-free tube.
[0021] 2) Remove large vesicles using a centrifugal speed of 10000-16500g for 30-45min, and transfer the supernatant to a new nuclease-free centrifuge tube.
[0022] 3) Filter the above solution using a 0.22μm filter membrane and transfer it to a new nuclease-free centrifuge tube.
[0023] 4) Ultracentrifuge at a speed of 100000-120000g for 70-120min, remove the supernatant, and obtain the exosome precipitate.
[0024] 5) Buffer (pH 7.5-8.0, such as PBS, etc.) is pre-filtered using a 0.22 μm filter membrane, and an appropriate amount of buffer is used to resuspend the exosome precipitate. The exosome precipitate is subjected to ultracentrifugation at a speed of 100000-120000 g for 70-120 min, and the supernatant is removed to obtain the exosome precipitate.
[0025] 6) The exosome precipitate is resuspended using 10-100 μL of Tn5 break buffer (containing 10 mM TAPS buffer, pH 8.5, 5-10 mM MgCl2, 5%-10% PEG8000), and an appropriate amount of reagent containing nucleic acid-digesting enzyme is added. The DNA on the surface of the exosome is digested at 37°C for 20-30 min. Then, a lysis reagent containing proteinase K is added, and the exosome is lysed to obtain an exosome DNA sample. 2+
[0026] 7) The exosome DNA is quantified using a primer pair for a housekeeping gene (GAPDH), and the exosome DNA concentration is relatively quantified using a cell genomic DNA as a standard curve.
[0027] In step (2), the reaction system and reaction conditions for fragmenting the exosome DNA are preferably as follows: 5%-10% (volume fraction) polyethylene glycol 8000 solution and 0.05-0.5 μL transposase complex are added to the exosome DNA, and the reaction is performed at 50-60°C for 5-15 min.
[0028] Further, step (2) is as follows: the transposase complex assembled in step (1) is used to fragment the exosome DNA, and a termination reagent such as SDS or protease is used to terminate the fragmentation reaction. An appropriate amount of carrier nucleic acid that does not affect the downstream analysis can be added to improve the purification recovery rate, and the sample is purified using magnetic beads.
[0029] Further, step (3) includes:
[0030] 3.1) An appropriate amount of TET2, T4-βGT, buffer, reducing agent DTT, oxidizing reagent, Fe 2+ solution-containing reagent, etc. is added to the fragmented product obtained in step (2), and the reaction is performed at 30-37°C for 1-2 h, and then a protease is added to terminate the reaction;
[0031] 3.2) After the product of 3.1) is denatured into single-stranded DNA, APOBEC3A, buffer, and BSA are added, and the reaction is performed at 30-37°C for 3-4 h. After the reaction is completed, the sample is purified using magnetic beads.
[0032] In step (4), the 3' linker is preferably obtained by annealing the following 3' end linker sequence 1 and 3' end linker sequence 2:
[0033] 3' end adapter sequence 1: 5'-phos-AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-NH2-3' (SEQ ID NO. 3);
[0034] 3' end adapter sequence 2: 5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGGGGGG-NH2-3' (SEQ ID NO. 4).
[0035] The extension primer is preferably 5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3' (SEQ ID NO. 5).
[0036] In step (4), the reaction system and reaction conditions for 3' adapter ligation using single-strand ligase on the converted single-stranded exosome DNA are preferably as follows: 3' adapter, DNA ligase, TdT enzyme, T4 PNK enzyme, dCTP, reaction buffer and other reagents are added to the single-stranded exosome DNA obtained in step (3), and the reaction is carried out at 30-37°C for 10-20 minutes and 95-98°C for 2-5 minutes for enzyme inactivation. The reaction conditions for double-stranded extension are preferably as follows: 98°C for 1 minute, 62°C for 2 minutes, 65°C for 5 minutes, and 4°C. After the reaction is completed, the sample is purified using magnetic beads.
[0037] The exosome DNA micro-nucleic acid methylation library construction method described above is also applicable to the methylation library construction of all micro-long fragment DNAs. Referring to the method, the exosome DNA sample is replaced with other DNA samples.
[0038] Advantages and beneficial effects of the present application: The present application can perform sub-nanogram level exosome DNA methylation library construction, overcome the shortcomings of 50% library loss and methylation bias introduced during gap filling in traditional Tn5 library construction, improve the library construction efficiency, and realize effective methylation spectrum mapping of ultra-micro DNA. The present application uses a symmetric single-adapter transposase combined with a single-adapter ligation method, has high gene alignment rate and conversion rate, and has good development and application prospect. BRIEF DESCRIPTION OF DRAWINGS
[0039] Figure 1 It is a schematic diagram of the micro-nucleic acid methylation library construction method of the present application.
[0040] Figure 2 It is the methylation library alignment rate and conversion rate of exosome DNA in Example 1 of the present application.
[0041] Figure 3 It is the methylation rate of each region of the exosome genome in Example 1 of the present application. DETAILED DESCRIPTION
[0042] In order to facilitate the understanding of the features and advantages of the present application, the present application will be described more fully below.
[0043] The present application provides a micro nucleic acid methylation library construction method of exosome DNA, and a flowchart is shown as follows Figure 1 The specific steps include the following steps:
[0044] (1) Assemble Tn5 transposase complex, the transposase complex is assembled by a single transposon adapter sequence and Tn5 transposase, the transposon adapter contains a transposon sequence, and the cytosine of the transposon adapter sequence has a methylation modification.
[0045] (2) Use the transposase complex to fragment the exosome DNA to obtain a fragmented product with a 5' transposon adapter and a gap, and the gap is not filled.
[0046] (3) Use TET enzyme and T4-beta GT enzyme to convert 5mC and 5hmC in the fragmented exosome DNA into 5caC / 5ghmC, which will not react with the downstream deaminase APOBEC. Then add APOBEC enzyme, and the unmodified cytosine will be converted into uracil to obtain the converted single-stranded exosome DNA.
[0047] (4) Use single-stranded ligase to connect the 3' adapter of the converted single-stranded exosome DNA.
[0048] (5) Use the library construction primer with index to perform PCR amplification on the exosome DNA with completed adapter connection to obtain the final methylation library.
[0049] The present application fragments the exosome DNA by using the transposase complex with symmetric single adapter and adds 5' adapter at the same time, the 9bp gap caused by Tn5 fragmentation is not filled, and the converted DNA is in single-stranded state, and the single-stranded 3' adapter is directly connected. The library construction method avoids the 50% efficiency problem of Tn5 transposase library construction and the methylation library alignment analysis problem caused by the methylation cytosine filled with ordinary cytosine due to the 9bp gap filling, greatly improves the library construction efficiency, and can obtain more accurate methylation analysis site and improve the sequencing quality.
[0050] Exosome DNA: In the present application, the "exosome DNA" refers to the DNA encapsulated inside the 40-160nm extracellular vesicles present in the circulatory system (such as blood). Studies have found that the DNA encapsulated inside the extracellular vesicles is mainly in the form of double-stranded DNA, and the length can be up to 2kb. Tumor cells can release a large amount of exosomes carrying genomic DNA into the circulating peripheral blood. By detecting the differences in exosome DNA in different disease populations, it has important clinical significance for finding potential early detection, targeted treatment, and disease monitoring targets.
[0051] In a specific example, after the exosome is extracted, the external DNA is digested using DNAse, and then direct lysis is performed for library construction operation, which avoids the loss of exosome DNA in the purification process.
[0052] In a specific example, the transposon linker assembled with the transposase is a single sequence.
[0053] In a specific example, all cytosines in the transposon linker sequence are methylated modifications, so as to avoid the conversion of cytosine to uracil in the subsequent transformation process, thereby affecting the subsequent library construction. In addition, the transposon linker can selectively add a molecular tag sequence, so that the differentiation can be performed when multiple samples are simultaneously constructed.
[0054] In a specific example, the Tn5 transposase complex produces a 9bp gap after DNA fragmentation. Generally, Tn5 needs to be gap filled, which may result in the original strand having methylation and the filled strand not having methylation. Therefore, after DNA fragmentation, the gap is not filled, and only the 5' end adapter is added.
[0055] In a specific example, the transformation of DNA uses enzyme transformation, which includes the following steps: using TET enzyme and T4-βGT enzyme to convert methylated cytosine (including 5mC and 5hmC) to 5caC and 5ghmC, and to protect the modified cytosine. Then, the unmodified cytosine is converted to uracil by a deaminase such as APOBEC, so as to be read as thymine during amplification and sequencing.
[0056] Further, the exosome DNA micro-nucleic acid methylation library construction method comprises the following steps:
[0057] (1) Synthesize a linker sequence containing methylated cytosine, and anneal the sequence with a 19bp mosaic end sequence having a transposase recognition in an annealing buffer. A certain concentration of the sequence is used to customize the assembly of the transposase, and at this time the assembled transposase is a single linker assembly. The activity of the assembled transposase is tested.
[0058] (2) The active transposase is used for DNA fragmentation and adding adapter sequences to the 5' end of the sequence. An appropriate amount of the above exosome DNA sample is taken, 5%-10% polyethylene glycol 8000 solution is added, 0.05-0.5 μL of transposase is added, 55°C reaction is carried out for 5-15 minutes, and 0.01-0.05% SDS or 0.5-1 μL protease is added as a termination reagent to terminate the fragmentation reaction. An appropriate amount of carrier nucleic acid that does not affect the downstream analysis is added, and 1.2x-2.0x magnetic beads are used to purify the sample.
[0059] (3) The methylated cytosine is converted using an enzyme method. In the first step, an appropriate amount of TET2 and T4-βGT, buffer, reducing agent DTT, oxidizing reagent, Fe 2+ solution is added to convert all methylcytosine and hydroxymethylcytosine in the sequence into carboxylcytosine and β-glucosylmethylcytosine, 30-37°C reaction is carried out for 1-2 hours, and then protease is added as a termination reagent, 37°C reaction is carried out for 20-30 minutes. After the reaction, sodium hydroxide is used to denature the product of the previous step into single-stranded DNA, an appropriate amount of APOBEC3A, buffer and BSA are added, and 37°C reaction is carried out for 3-4 hours. This step deaminates ordinary cytosine to convert it into uracil, while the methylcytosine and hydroxymethylcytosine after the first step reaction do not undergo deamination in this step. After the reaction is completed, 1.2x-2.0x magnetic beads are used to purify the sample.
[0060] (4) 5' phosphorylated modified 3' end adapter, DNA ligase, TdT enzyme, T4 PNK enzyme and dCTP are added to the above purified DNA sample, 37°C reaction is carried out for 10-20 minutes, and 95°C enzyme inactivation is carried out for 2-5 minutes. An extension primer is added to extend the double-stranded DNA after the adapter ligation, 98°C for 1 minute, 62°C for 2 minutes, 65°C for 5 minutes, and 4°C is maintained. After the reaction is completed, 1.2x-2.0x magnetic beads are used to purify the sample.
[0061] (5) In the purified DNA sample, an index library adapter primer is added, 2x polymerase chain reaction premix is used for sequence amplification, and 5-20 cycles of amplification are carried out. In the polymerase chain reaction, all uracils in the reaction are converted into thymine, and methylated cytosine is converted into ordinary cytosine, so that the methylation site can be obtained by sequencing.
[0062] The application will be further described in detail below in conjunction with the embodiments and the accompanying drawings, but the embodiments of the application are not limited thereto.
[0063] Example 1
[0064] (1) Sample preparation: The mixed plasma sample used to verify the method of the present application was divided into 4 tubes, each 1 mL, 2 mL of PBS solution filtered in advance using a 0.22 μm filter was added, and 16500 g of rotation speed was used to centrifuge for 45 min to remove large vesicles, and the supernatant was transferred to a new nuclease-free centrifuge tube. The supernatant was filtered using a 0.22 μm filter and transferred to a new nuclease-free centrifuge tube. The speed of 100000 g was used for ultracentrifugation for 120 min, and the supernatant was removed to obtain the exosome precipitate. 3 mL of PBS was used to resuspend the exosome precipitate, and the speed of 100000 g was used for ultracentrifugation for 120 min, and the supernatant was removed to obtain the exosome precipitate. 10 μL of Mg 2+ The exosome precipitate was resuspended in Tn5 break buffer solution (pH 8.5), 1 μL of heat-sensitive dsDNase (Bi Yun Tian D7078S) was added, and the DNA on the surface of the exosome was digested at 37°C for 20 min, and the heat-sensitive nuclease was inactivated at 55°C for 10 min. Then 2 μL of proteinase K was added to lyse the exosome to obtain a mixed sample containing exosome DNA for subsequent library construction. The exosome DNA was quantified by qPCR using primers for the housekeeping gene (GAPDH), and the cell genomic DNA was used as a standard curve for relative quantification of the exosome DNA concentration.
[0065] The sequence of qPCR quantification using GAPDH primers is as follows:
[0066] FP: 5'-TGCACCACCAACTGCTTAGC-3',
[0067] RP: 5'-GGCATGGACTGTGGTCATGAG-3'.
[0068] The quantification results of the extracted 4 tubes of exosomes were 313.6, 475.9, 329.7, and 562.3 pg / μL, respectively.
[0069] (2) Asymmetric single linker Tn5 transposase complex assembly and DNA fragmentation
[0070] A single linker sequence of 19 bp transposase recognition fragment was synthesized, and all cytosines in linker sequence B were methylated.
[0071] The linker sequence is:
[0072] Linker sequence A: 5'-[phos]CTGTCTCTTATACACATCT-3',
[0073] Linker sequence B: 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3'.
[0074] The linker sequences A and B were diluted to 5 mM, respectively, and mixed in a molar ratio of 1 to 1. The single sequence transposon linker was obtained by annealing in a PCR machine according to the following program (Table 1) for the preparation of the transposase complex.
[0075] Table 1
[0076]
[0077] Then 14 pL of the annealed transposon linker was mixed with 8 pL of Tn5 transposase (500 ng / pL) and 78 pL of coupling buffer, mixed uniformly by blowing 20 times, and incubated at 30 °C for 1 hour to assemble the transposase complex, which was stored at -20 °C for standby.
[0078] The assembled transposase complex was used for DNA fragmentation and the addition of linker sequences at the 5' end of the sequence. 14 pL of the above exosome DNA sample was added with 8% polyethylene glycol 8000 solution, 1 pL of 10-fold diluted Tn5 transposase complex was added, and the reaction was carried out at 55 °C for 10 minutes. 1 pL of proteinase K was added to terminate the fragmentation reaction for 10 minutes. After this step, no gap filling was performed. To improve the recovery rate of purification, 100 ng of carrier nucleic acid (Carrier DNA, a sequence of thousands of bp of E. coli plasmid or Carrier RNA, QIAGEN, Cat. No. 1068337) was added, and then 1.8x magnetic beads were added to purify the sample.
[0079] Magnetic bead purification: The final volume of the above reaction system was 22 pL, 39.6 pL of VAHTS DNA Clean Beads was added, which was recovered to room temperature in advance. The sample and the magnetic beads were mixed by vortexing and shaking, incubated at room temperature for 10 minutes, then the sample tube was placed on the magnetic stand for 5 minutes, and the supernatant was removed after the solution was clarified. Keep the sample tube on the magnetic stand, add 200 pL of 80% ethanol, incubate for 30 seconds, rinse the magnetic beads twice, and aspirate the supernatant. Dry the magnetic beads at room temperature for 5 minutes. Take out the sample tube, add 29 pL of enzyme-free water, and place it on the magnetic stand for 5 minutes after standing at room temperature for 2 minutes. Take 27 pL to a new tube.
[0080] (3) Enzymatic conversion of fragmented exosome DNA using the EpiArt DNA Enzymatic Methylation Kit (EM301) from QIAGEN. In the above 27 pL system, 10 pL of 10-11 transposase (TET2) and T4-phage-beta-glucosyltransferase (T4-beta GT) 1 pL, oxidation buffer 5 pL, reducing agent DTT 1 pL, oxidation reagent 1 pL, were mixed, and then Fe 2+5 μL of solution, incubated at 37°C for 1 hour, all methylcytosine and hydroxymethylcytosine in the sequence were converted to carboxylcytosine and β-glucosyloxymethylcytosine. Then 1 μL of proteinase K was added as a termination reagent, and incubated at 37°C for 30 minutes. The sample was purified using 1.8x magnetic beads, and the elution volume was 16 μL.
[0081] The 16 μL purified product was denatured into single-stranded DNA using 0.1 M sodium hydroxide, reacted at 50°C for 10 minutes, and then placed on ice for 2 minutes. Then 1 μL of apolipoprotein B mRNA editing enzyme catalytic subunit 3A (APOBEC3A), 10 μL of buffer, and 1 μL of BSA solution were added, and reacted at 37°C for 3 hours. This step deaminates ordinary cytosine to uracil, while the methylcytosine and hydroxymethylcytosine after the first step do not undergo deamination in this step. After the reaction was completed, the sample was purified using 1.8x magnetic beads, and the elution volume was 10 μL.
[0082] (4) 2.5 μL of 10 μM 3' end adapter sequence, 5 μL of E. coli DNA ligase, TdT enzyme, T4 PNK enzyme, and dCTP mixture, and 2.5 μL of reaction buffer (10x E. coli ligase buffer plus 10x T4 PNK buffer) were added to the above purified 10 μL DNA sample, and reacted at 37°C for 15 minutes and inactivated at 95°C for 2 minutes. Then 2.5 μL of extension primer and 17.5 μL of polymerase mixture were added to extend the double-stranded DNA after the adapter ligation, and the reaction conditions were 98°C for 1 minute, 62°C for 2 minutes, 65°C for 5 minutes, and 4°C. After the reaction was completed, the sample was purified using 1.2x magnetic beads, and the elution volume was 22 μL.
[0083] 3' end adapter sequence 1: 5'-phos-AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-NH2-3'; 3' end adapter sequence 2: 5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGGGGGG-NH2-3'. The two sequences were annealed in advance to form double-stranded and diluted to a concentration of 10 μM (annealing conditions are the same as above).
[0084] Extension primer: 5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3'.
[0085] In the purified DNA sample, 2.5 μL of 10 μM index-labeled library adapter primer, 25 μL of 2x VAHTS HiFi Amplification Mix V3 reaction premix were added, and the total volume was 50 μL, and polymerase chain reaction was performed for 16 rounds. In the polymerase chain reaction, all uracils in the reaction were converted to thymine, and methylated cytosine was converted to ordinary cytosine, so that the methylation site can be obtained by sequencing.
[0086] The index-labeled library adapter primer sequence is as follows:
[0087] 5'-AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC-3',
[0088] 5'-CAAGCAGAAGACGGCATACGAGAT[i7]GTGACTGGAGTTCAGACGTGTGCTCTTC CGATC-s-T-3'.
[0089] The polymerase chain reaction program is shown in Table 2.
[0090] Table 2
[0091]
[0092] Finally, 0.8x magnetic bead purification was performed twice, nucleic acid quantification was performed by Qubit, and then sequencing was performed by a sequencing company.
[0093] As shown in Figure 2 The sequencing results of the four exosome samples show that the exosome micro-DNA methylation library is successfully constructed by the method, and has a high alignment rate of more than 63.5% and a high conversion rate of more than 99%. As shown in Figure 3 The methylation level results of different positions of the four exosome samples show that the exosome sample is successfully analyzed for the methylation level of different gene positions such as promotor, 5'UTR, etc. by using the library constructed by the method.
[0094] The above examples are only used to help illustrate the present application, and the embodiments of the present application are not limited by the above examples, and any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present application are equivalent replacement methods, and are all included in the protection scope of the present application.
Claims
1. A method for constructing a micro-nucleic acid methylation library of exosome DNA, characterized in that: The steps include: (1) Assembling a single transposase adaptor sequence and Tn5 transposase into a Tn5 transposase complex; The single transposition adapter sequence is obtained by annealing the adapter sequence with the 19bp transposase recognition sequence; the cytosines in the single transposition adapter sequence are all methylated cytosines; (2) fragmenting the exosomal DNA using the transposase complex assembled in step (1) to obtain fragmented products having a 5' transposition junction and a gap; (3) using an enzymatic method to convert the cytosine in the exosome DNA fragmentation product obtained in step (2) to obtain converted single-stranded exosome DNA; The enzymes used in the enzymatic method include TET2, T4-βGT, and APOBEC3A. The fragmented products are first converted into carboxycytosine and β-glucosylmethylcytosine using TET2 and T4-βGT, and then unmodified cytosine is deaminated and converted into uracil using APOBEC3A. (4) 3′ linker ligation is performed on the converted single-stranded exosome DNA using a single-strand ligase, and then the double-stranded DNA after linker ligation is extended using an extension primer; (5) The DNA obtained in step (4) is amplified by PCR using the library construction adapter primers with index to obtain the methylation library.
2. The method for constructing a micro-molecular nucleic acid methylation library of exosomal DNA according to claim 1, characterized in that: In step (1), the linker sequence is: 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3'; the 19 bp transposase recognition sequence is 5'-[phos]CTGTCTCTTATACACATCT-3'.
3. The method for constructing a trace amount of nucleic acid methylation library of exosomal DNA according to claim 1, characterized in that: In step (2), the exosome DNA is prepared by a method comprising the following steps: 1) Exosome extraction: Select an appropriate method to extract exosomes based on the source of the exosomes; the extraction of exosomes from plasma, serum, and cultured cells is as follows: 1.1) Plasma exosome extraction: Collect whole blood into EDTA anticoagulant tubes, centrifuge at 2500-3000 rpm for 15-20 minutes, transfer the supernatant to a nuclease-free tube, and remove the bottom blood cells; 1.2) Serum exosome extraction: Collect whole blood into a non-anticoagulant tube. After the blood coagulates, centrifuge at 2500-3000 rpm for 15-20 minutes. Transfer the supernatant to a nuclease-free tube. 1.3) Exosome extraction from cell culture supernatant: Cells were cultured in culture medium containing exosome-depleted fetal bovine serum for at least 60 hours. The supernatant was removed and centrifuged to remove excess cells and cell debris. The supernatant was then transferred to a nuclease-free tube. 2) Centrifuge at 10,000-16,500 g for 30-45 min to remove large vesicles and transfer the supernatant to a fresh nuclease-free centrifuge tube. 3) Filter the solution through a 0.22 μm filter membrane and transfer to a new nuclease-free centrifuge tube; 4) Ultracentrifuge at 100,000-120,000 g for 70-120 min, remove the supernatant, and obtain the exosome pellet; 5) Resuspend the exosome pellet in an appropriate amount of buffer and ultracentrifuge at 100,000-120,000 g for 70-120 minutes. Remove the supernatant to obtain the exosome pellet. 6) Resuspend the exosome pellet in shearing buffer, add a reagent containing a nuclease to digest the DNA on the surface of the exosomes, and then add a lysis reagent containing proteinase K to lyse the exosomes to obtain an exosomal DNA sample.
4. The method for constructing a trace nucleic acid methylation library of exosomal DNA according to claim 1, characterized in that: In step (2), the reaction system for fragmenting exosome DNA is as follows: 5%-10% polyethylene glycol 8000 solution and 0.05-0.5 μL of transposase complex are added to the exosome DNA.
5. The method for constructing a trace amount of nucleic acid methylation library of exosomal DNA according to claim 1, characterized in that: Step (2) is: using the transposase complex assembled in step (1) to fragment the exosomal DNA, using a termination reagent to terminate the fragmentation reaction, and using magnetic beads to purify the sample.
6. The method for constructing a trace amount of nucleic acid methylation library of exosomal DNA according to claim 5, characterized in that: Terminate the fragmentation reaction and add carrier nucleic acid that does not affect downstream analysis, then purify the sample using magnetic beads.
7. The method for constructing a trace amount of nucleic acid methylation library of exosomal DNA according to claim 1, characterized in that: Step (3) includes: 3.1) Add TET2, T4-βGT, buffer, reducing agent DTT, oxidizing agent, Fe-containing 2+ The solution undergoes conversion reaction, and then the protease is added to terminate the reaction; 3.2) Denature the product of 3.1) into single-stranded DNA, then add APOBEC3A, buffer, and BSA to perform a conversion reaction. After the reaction is complete, purify the sample using magnetic beads.
8. The method for constructing a trace amount of nucleic acid methylation library of exosomal DNA according to claim 1, characterized in that: In step (4), The 3' linker is obtained by annealing the following 3' end linker sequence 1 and 3' end linker sequence 2: 3' end linker sequence 1: 5'-phos-AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-NH2-3'; 3' end linker sequence 2: 5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGGGGG-NH2-3'; The extension primer is: 5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3'.
9. The method for constructing a trace nucleic acid methylation library of exosomal DNA according to claim 1, characterized in that: In step (4), the reaction system for 3' linker ligation of the converted single-stranded exosome DNA using single-stranded ligase is as follows: 3' linker, DNA ligase, TdT enzyme, T4 PNK enzyme, dCTP, and reaction buffer are added to the single-stranded exosome DNA obtained in step (3).
10. Application of the method for constructing a trace amount of exosomal DNA methylation library according to any one of claims 1 to 9 in constructing a trace amount of long-fragment DNA methylation library, characterized in that: Replace exosomal DNA with other DNA.