One-tube multiple nucleic acid detection method based on CRISPR / Cas12j3 isothermal amplification

By utilizing CRISPR/Cas12j3 protein-binding isothermal amplification technology and taking advantage of the difference in trans-cleavage efficiency between single-stranded DNA and double-stranded DNA probes, the high cost and cumbersome operation of existing multiplex nucleic acid detection technologies have been solved, achieving efficient single-tube multiplex nucleic acid detection.

CN120796446APending Publication Date: 2025-10-17SOUTHEAST UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510791820.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-13
Publication Date
2025-10-17

AI Technical Summary

Technical Problem

Existing technologies for multiplex nucleic acid detection suffer from high costs, cumbersome operation, and the inability to achieve single-tube multiplex detection, especially when using multiple CRISPR/Cas proteins or relying on microfluidic chips.

Method used

Using CRISPR/Cas12j3 protein-binding isothermal amplification technology, the difference in trans cleavage efficiency between single-stranded DNA and double-stranded DNA probes is utilized. Free single-stranded probes are formed through strand substitution and strand hybridization reactions, which activate CRISPR/Cas12j3 protein for efficient multiplex nucleic acid detection and release fluorescent signals.

Benefits of technology

It achieves efficient multiple nucleic acid detection, avoids aerosol contamination and cumbersome operation steps, reduces detection costs, and realizes one-tube multiple nucleic acid detection mediated by a single CRISPR/Cas enzyme.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120796446A_ABST
    Figure CN120796446A_ABST
Patent Text Reader

Abstract

The invention discloses a one-tube type multiple nucleic acid detection method based on CRISPR / Cas12j3 isothermal amplification. The one-tube type multiple nucleic acid detection method comprises the following steps: adding a to-be-detected sample into detection reagents: CRISPR / Cas12j3 protein, a reagent for activating the CRISPR / Cas12j3 protein and a double-chain probe designed for different to-be-detected targets; the double-chain probe is formed by annealing a probe chain and a complementary chain, the complementary chain is used for participating in isothermal amplification of corresponding targets, the probe chain is released through chain displacement, different fluorescent groups are correspondingly modified in the sequence of the probe chain for different targets, and a fluorescent signal is released after the activated CRISPR / Cas12j3 protein is subjected to trans-cleavage; when a corresponding fluorescence signal is detected, the existence of a corresponding target is indicated; otherwise, the corresponding target does not exist. According to the invention, single CRISPR / Cas enzyme-mediated one-tube multiple nucleic acid detection is realized, and the defects of aerosol pollution, tedious operation steps, high cost and the like are avoided.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of nucleic acid detection, and specifically relates to a one-tube multiple nucleic acid detection method based on CRISPR / Cas12j3 isothermal amplification. Background Art

[0002] Nucleic acid amplification detection (NAA), a highly sensitive and specific molecular diagnostic technique, has been widely applied in biomedical testing and other fields, including pathogen detection, clinical diagnosis, and other nucleic acid detection-related fields. In recent years, the CRISPR / Cas system has played a significant role in molecular diagnostics due to its advantages in specific detection and holds broad application prospects. Recent advances in CRISPR / Cas-based multiplex molecular diagnostics have been made, encompassing several key strategies: 1. Using multiple CRISPR / Cas proteins to cleave multiple substrates; 2. Using microfluidics to physically separate the CRISPR / Cas system from the isothermal amplification process, enabling CRISPR / Cas multiplex nucleic acid detection via chip-based carriers; and 3. Leveraging the cis-cleavage activity of CRISPR / Cas12a to achieve specific cleavage within the CRISPR / Cas system.

[0003] Multiplexed nucleic acid detection technology based on the CRISPR / Cas system can improve the throughput and efficiency of nucleic acid detection, but existing technologies still have significant technical defects and barriers. For example, when multiple CRISPR / Cas proteins are used to cut multiple substrates, multiple Cas proteins are required, which greatly increases the cost of detection; achieving multiplexed detection through microfluidics requires sophisticated and complex microfluidic chips, which is not conducive to practical operation, and the reaction process occurs in multiple compartments, which does not belong to a one-tube multiplexed detection; the target-specific cleavage of CRISPR / Cas proteins in multiplexed detection has low cutting efficiency, and existing technologies cannot achieve one-tube multiplexed detection, and the operation is cumbersome. Therefore, there is an urgent need to develop a one-tube multiplexed nucleic acid detection technology based on isothermal amplification of a single CRISPR / Cas protein. Summary of the Invention

[0004] Technical problems solved: In order to solve the above technical problems, the application provides a one-tube multiplex nucleic acid detection method based on CRISPR / Cas12j3 isothermal amplification, which utilizes the efficiency difference of CRISPR / Cas protein trans-cleavage of single-stranded DNA probes and double-stranded DNA probes to realize efficient multiplex nucleic acid detection. When the target to be detected appears, the isothermal amplification process will start, and after the strand displacement and strand hybridization reaction, the double-stranded probe forms a free single-stranded probe, which is trans-cleaved by the activated CRISPR / Cas12j3 protein to release a fluorescence signal. When multiple targets appear at the same time, the corresponding probes labeled with different fluorescent groups become free single-stranded probes, and multiple fluorescent probes can be trans-cleaved by the activated CRISPR / Cas12j3 protein without difference, thereby realizing multiplex nucleic acid detection.

[0005] Technical scheme: The one-tube multiplex nucleic acid detection method based on CRISPR / Cas12j3 isothermal amplification adds the sample to be detected into a detection reagent, the detection reagent includes CRISPR / Cas12j3 protein, reagent for activating CRISPR / Cas12j3 protein, and different double-stranded probes designed for different nucleic acid targets to be detected; the double-stranded probe is annealed by a probe strand and a complementary strand, the complementary strand is used to participate in the isothermal amplification of the corresponding nucleic acid target, and is synthesized into an amplification product by strand displacement, thereby releasing the probe strand, the sequence of the probe strand is modified with different fluorescent groups corresponding to different nucleic acid targets, and the activated CRISPR / Cas12j3 protein releases a fluorescence signal after trans-cleavage; when the fluorescence signal of the corresponding nucleic acid target is detected, it indicates that the corresponding nucleic acid target exists in the sample to be detected; otherwise, the corresponding nucleic acid target does not exist.

[0006] Preferably, the reagent for activating CRISPR / Cas12j3 protein includes crRNA of Cas12j3 and single-stranded activation target of Cas12j3.

[0007] Preferably, the 5' end of the complementary strand is base complementary pairing with the probe strand, and presents a double-stranded DNA structure; the 3' end of the complementary strand is a free single-stranded DNA structure, and is used to participate in isothermal amplification.

[0008] Preferably, the sequence of the probe strand is modified with a fluorescent group and a quenching group at the 3' end.

[0009] Preferably, the maximum number of nucleic acid targets to be detected in the one-tube multiplex nucleic acid detection is not less than 3.

[0010] Preferably, the isothermal amplification uses Bst DNA polymerase and / or Phi29 DNA polymerase.

[0011] Further, when the isothermal amplification is mediated by Bst DNA polymerase, the isothermal amplification includes but is not limited to loop-mediated isothermal amplification, recombinase polymerase amplification, rolling circle amplification and strand displacement amplification.

[0012] Further, when the isothermal amplification is mediated by Phi29 DNA polymerase, the complementary strand is a padlock probe, and the probe strand is complementary to the 5' end of the padlock probe.

[0013] Still further, the padlock probe is provided with three functional regions: a microRNA binding region, a probe strand binding region and a Cas12j3 single-stranded target activation functional region.

[0014] The microRNA binding region is used for complementary pairing with the target microRNA, and under the action of the ligase, the linear padlock probe becomes a circular padlock probe and starts RCA; the probe strand binding region is used for complementary pairing with the probe strand to form a double-stranded probe, and when RCA is started, the probe strand on the circular padlock probe is displaced by Phi29 DNA polymerase to form a free single-stranded probe; and the Cas12j3 single-stranded target activation functional region is used for synthesizing a single-stranded target sequence of Cas12j3 in the RCA product, activating the trans-cleavage and cis-cleavage activities of Cas12j3, and trans-cleaving the single-stranded probe formed by strand displacement to release a fluorescent signal.

[0015] Beneficial effects: the present application realizes efficient multiplex nucleic acid detection by using the difference in the trans-cleavage efficiency of CRISPR / Cas12j3 protein on single-stranded DNA and double-stranded DNA. When the target to be detected appears, the isothermal amplification process is started, the double-stranded probe forms a free single-stranded probe after strand displacement and strand hybridization reaction, and the free single-stranded probe is trans-cleaved by the activated CRISPR / Cas12j3 protein to release a fluorescent signal. The present application realizes single CRISPR / Cas enzyme-mediated one-pot multiplex nucleic acid detection, avoids the disadvantages of aerosol pollution, complicated operation steps and high cost in the prior art, and the like. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 is a Bst DNA polymerase-CRISPR / Cas12j3 isothermal amplification one-pot multiplex nucleic acid detection process schematic diagram;

[0017] Figure 2 is a primer setting schematic diagram of Bst DNA polymerase-CRISPR / Cas12j3 isothermal amplification and a probe strand separation schematic diagram in the isothermal amplification process;

[0018] Figure 3is the experimental results and specificity evaluation of one-tube multiplex nucleic acid detection of Phi29 DNA polymerase-mediated strand displacement process isothermal amplification;

[0019] Figure 4 is the Phi29 DNA polymerase-CRISPR / Cas12j3 isothermal amplification one-tube multiplex nucleic acid detection process schematic diagram;

[0020] Figure 5 is the RCA probe setting schematic diagram and amplification process schematic diagram;

[0021] Figure 6 is the experimental results and specificity evaluation of one-tube multiplex nucleic acid detection of Phi29 DNA polymerase-mediated strand displacement process isothermal amplification. DETAILED DESCRIPTION

[0022] The present application will be further described below in conjunction with the drawings and specific examples. Those skilled in the art should understand that these examples are only used to illustrate the present application and not to limit the scope of the present application.

[0023] The detection signal source of the present application is mainly released by the high-efficiency trans-cleavage of Cas12j3 protein on the single-stranded fluorescent labeled probe displaced by strand displacement. In the target nucleic acid triggered multiplex isothermal amplification, the double-stranded probe is changed from double-stranded probe to single-stranded probe by strand displacement process, so as to be cleaved. When there is no target, isothermal amplification cannot be triggered, the double-stranded probe remains original state, Cas12j3 protein cannot be cleaved, and there is no release of fluorescent signal.

[0024] Isothermal amplification can be divided into two categories, one is Bst DNA polymerase-mediated isothermal amplification, and the other is Phi29 DNA polymerase-mediated isothermal amplification. The following will introduce the two types of isothermal amplification and the cleavage process of Cas12j3.

[0025] In Bst DNA polymerase-mediated isothermal amplification, double-stranded probe can be used as a probe to participate in work, and can also be used as a primer. At 60℃ reaction temperature, the presence of target nucleic acid triggers isothermal amplification, and eight primers can be synthesized into amplification products under the action of Bst DNA polymerase, while the double-stranded probe is displaced from its complementary strand to form a free single-stranded state. The activated Cas12j3 activated by single-stranded target can efficiently cleave the free single-stranded probe in trans, releasing the fluorescent signal.

[0026] In the Phi29 DNA polymerase mediated isothermal amplification, the double-stranded probe is formed by annealing of the probe strand and one Padlock probe. When the target microRNA exists, the linear Padlock probe can be ligated by the ligase to form a circular padlock probe, and under the action of Phi29 DNA polymerase, it starts rolling circle amplification to form a large amount of amplification product. The probe strand becomes a free single-stranded probe by the strand displacement of Phi29 DNA polymerase in this process. In the large amount of single-stranded DNA product synthesized, there is a single-stranded DNA sequence that can activate Cas12j3. The activated Cas12j3 can cut the free single-stranded probe in trans to release the fluorescence signal.

[0027] Example 1: Bst DNA polymerase + CRISPR / Cas12j3 detection of HPV pathogens

[0028] In this example, three pathogens of HPV16, HPV18 and HPV33 are taken as the detection object. Bst2.0 Warmstart DNA polymerase is used for efficient amplification of the target and completion of the probe strand displacement. Combined with the trans cleavage of Cas12j3, a one-pot multiplex nucleic acid detection based on CRISPR / Cas12j3 protein for three nucleic acid targets is completed.

[0029] The detection process is as follows Figure 1As shown, in the same reaction tube, Iso-Reaction mix is an isothermal amplification system located at the bottom of the tube, containing various three types of targets (HPV16, 18 and 33), three double-stranded probes corresponding to the targets (FAM-dsProbe corresponding to HPV16, ROX-dsProbe corresponding to HPV18 and Cy5-dsProbe corresponding to HPV33) and RPA isothermal amplification reagents; Mineral oil is paraffin oil, covering Iso-Reaction Mix; The tube cover is Cas12j3 reaction system (i.e. Cas12j3 mix), containing CRISPR-Cas12j3-crRNA complex and trans-cleavage single-stranded activator (ssActivator). When the corresponding target appears, RPA isothermal amplification is activated, which causes the double-stranded probe to separate and produce a large amount of single-stranded probe (ssProbe); then centrifuge the reaction tube, mix the Cas12j3 reaction system on the cover with the Iso-Reaction mix, and the activated CRISPR-Cas12j3 trans-cleavage activity will cut the single-stranded probe (ssProbe), so that the corresponding type of fluorescence signal is generated and the fluorescence intensity is significantly enhanced, finally indicating the presence of the corresponding target. However, when the system does not contain the target, RPA isothermal amplification cannot be carried out, the single-stranded probe cannot be separated, and then cannot be cut by the trans-cleavage activity of the activated CRISPR-Cas12j3, no corresponding type of fluorescence signal is generated.

[0030] Primer design and probe separation as shown in Figure 2 As shown, the left upper part of the figure shows that the double-stranded probe is formed by annealing two single-stranded probes; the right upper part shows the primer design diagram of isothermal amplification (NIA); A shows that the upstream double-stranded probe (F-dsProbe) can generate single-stranded probe through Bst polymerase-mediated strand displacement; B shows that the downstream double-stranded probe (R-dsProbe) can generate single-stranded probe through Bst polymerase-mediated strand displacement; C shows that the upstream double-stranded probe (F-dsProbe) can generate single-stranded probe by hybridizing with NIA amplification products; B shows that the downstream double-stranded probe (R-dsProbe) can generate single-stranded probe by hybridizing with NIA amplification products.

[0031] Detection results and target specificity analysis as shown in Figure 3 As shown, the left upper part of the figure is a multiple detection result determination diagram, the generation of FAM signal is HPV16, the generation of ROX signal is HPV18, and the generation of Cy5 signal is HPV33; the right upper part shows that eight different reaction systems produce different types of fluorescence signals due to the difference of HPV types contained, and the fluorescence intensity is significantly enhanced; the right lower part shows the comparison of end-point fluorescence intensity of the eight different reaction systems in the right upper part after repeated testing and the statistical analysis column chart.

[0032] (1) Composition of the reaction system NIAmix + Cas12j3mix

[0033] FAM-inner-Probe and HPV16-FSACP annealing to form HPV16 F-dsProbe-FAM, FAM-inner-Probe and HPV16-RSACP annealing to form HPV16 R-dsProbe-FAM, ROX-inner-Probe and HPV18-FSACP annealing to form HPV18 F-dsProbe-ROX, ROX-inner-Probe and HPV18-RSACP annealing to form HPV18 R-dsProbe-ROX, Cy5-inner-Probe and HPV33-FSACP annealing to form HPV33 F-dsProbe-Cy5, Cy5-inner-Probe and HPV33-RSACP annealing to form HPV33 R-dsProbe-Cy5.

[0034] In the 10 μL isothermal amplification reaction system, it contains 1 × Isothermal Amplification Buffer, 1.4 mM dNTPs, 4 mM MgSO4, 0.2 M betaine, 0.4 μM HPV16 F-dsProbe-FAM, 0.4 μM HPV16R-dsProbe-FAM, 0.8 μM HPV16-FL, 0.8 μM HPV16-RL, 0.1 μM HPV16-FSA, 0.1 μM HPV16-RSA, 0.15 μM HPV16-FD, 0.15 μM HPV16-RD, 0.1 μM HPV16-FO, 0.1 μM HPV16-RO, 0.4 μM HPV18 F-dsProbe-ROX, 0.4 μM HPV18 R-dsProbe-ROX, 0.8 μM HPV18-FL, 0.8 μM HPV18-RL, 0.1 μM HPV18-FSA, 0.1 μM HPV18-RSA, 0.15 μM HPV18-FD, 0.15 μM HPV18-RD, 0.1 μM HPV18-FO, 0.1 μM HPV18-RO, 0.4 μM HPV33 F-dsProbe-Cy5, 0.4 μM HPV33 R-dsProbe-Cy5, 0.8 μM HPV33-FL, 0.8 μM HPV33-RL, 0.1 μM HPV33-FSA, 0.1 μM HPV33-RSA, 0.15 μM HPV33-FD, 0.15 μM HPV33-RD, 0.1 μM HPV33-FO, 0.1 μM HPV33-RO, 1.28 U / μL Bst 2.0 Warmstart DNA polymerase, 1 μL nucleic acid target to be tested.

[0035] In the 10 μL CRISPR / Cas12j3 system, it contains 1 × NEBr2.1 buffer, 1 μM crRNA, 1 μM Cas12j3, 1 μM single-stranded activated target of Cas12j3.

[0036] (2) Reaction time and temperature

[0037] Place the prepared isothermal amplification reaction system at the bottom of the tube, and the CRISPR / Cas12j3 system at the tube cover. First, heat the tube bottom at 60°C for 40 min, then centrifuge the Cas12j3 reaction liquid on the tube cover to the tube bottom, mix well, then incubate at room temperature for 5 min, then detect the fluorescence signal.

[0038] (3) Detection of fluorescence signal

[0039] The signal of the FAM fluorescent probe corresponds to the detection of the HPV16 target, the signal of the ROX fluorescent probe corresponds to the detection of the HPV18 target, and the signal of the Cy5 fluorescent probe corresponds to the detection of the HPV33 target.

[0040] The specific experimental results are shown in Table 1, and the types of the fluorescent signals generated after the reaction are consistent with the types of the detected targets, and the fluorescence brightness is significantly higher than that of the reaction of non-targets, that is, the detection specificity of the method is good. Figure 3

[0041] (4) The target nucleic acid sequence, the primer sequence for isothermal amplification, and the double-stranded probe sequence involved in this embodiment are as follows:

[0042] The HPV16 target sequence is as follows:

[0043] AGGAGGATGAAATAGATGGTCCAGCTGGACAAGCAGAACCGGACAGAGCCCATTACAATATTGTAACCTTTTGTTGCAAGTGTGACTCTACGCTTCGGTTGTGCGTACAAAGCACACACGTAGACATTCGTACTTTGGAAGACCTGTTAATGGGCACACTAGGAATTGTGTGCCCCATCTGTTCTCAGAAACCATAATCTACCATGGCTGATCCTGCAGGTACCAATGGGGAAGAGGGTACGGGATGTAATGGATGGTTTTATGTAGAGGCTGTAGTGGAAAAAAAAACAGGGGATGCTATATCAGATGACGAGAACGAAAATGACAGTGATACAGGTGAAGATTTGGTAGATTTTATAGTAAATGATAATGATTATTTAACACAGGCAGAAACAGAGACAGCACATGCGTTGTTTACTGCACAGGAAGCAAAACAACATAGAGATGCAGTACAGGTTCTAAAACGAAAGTATTTGGGTAGTCCACTTAG

[0044] The HPV16-FL primer sequence is as follows:

[0045] TGTGCCCCATCTGTTCTCA The HPV16-RL primer sequence is as follows:

[0046] CTACGTGTGTGCTTTGTACGC The HPV16-FSA primer sequence is as follows:

[0047] ​ACTCTACGCTTCGGTTGT HPV16-RSACP primer sequence:

[0048] GCCATGGTAGATTATGGTTTC HPV16-FD primer sequence:

[0049] TAACAGGTCTTCCAAAGTACGAATGACTCTACGCTTCGGTTGT HPV16-RD primer sequence:

[0050] ACATTCGTACTTTGGAAGACCTGTTGCCATGGTAGATTATGGTTTC HPV16-FO primer sequence:

[0051] TGTAACCTTTTGTTGCAAGTG HPV16-RO primer sequence:

[0052] CTTCCCCATTGGTACCTG FAM-inner-Probe sequence:

[0053] AGCAAAGTCAGAGCGCT(FAM)GCAA-BHQ1

[0054] HPV16-FSACP primer sequence:

[0055] TTGCAGCGCTCTGACTTTGCTACTCTACGCTTCGGTTGT HPV16-RSACP primer sequence:

[0056] TTGCAGCGCTCTGACTTTGCTGCCATGGTAGATTATGGTTTC HPV18 target sequence:

[0057] CATATTTTAGGGTTCCTGCAGGTGGTGGCAATAAGCAGGATATTCCTAAGGTTTCTGCATACCAATATAGAGTATTTAGGGTGCAGTTACCTGACCCAAATAAATTTGGTTTACCTGATACTAGTATTTATAATCCTGAAACACAACGTTTAGTGTGGGCCTGTGCTGGAGTGGAAATTGGCCGTGGTCAGCCTTTAGGTGTTGGCCTTAGTGGGCATCCATTTTATAATAAATTAGATGACACTGAAAGTTCCCATGCCGCCACGTCTAATGTTTCTGAGGACGTTAGGGACAATGTGTCTGTAGATTATAAGCAGACACAGTTATGTATTTTGGGCTGTGCCCCTGCTATTGGGGAACACTGGGCTAAAGGCACTGCTTGTAAATCGCGTCCTTTATCACAGGGCGATTGCCCCCCTTTAGAACTTAAAAACACAGTTTTGGAAGATGGTGA

[0058] HPV18-FL primer sequence:

[0059] TTAGATGACACTGAAAGTTCCCATG HPV18-RL primer sequence:

[0060] CCTAAAGGCTGACCACGGC HPV18-FSA primer sequence:

[0061] CTGTGCTGGAGTGGAAAT HPV18-RSA primer sequence:

[0062] TCCTCAGAAACATTAGACGT HPV18-FD primer sequence:

[0063] AATGGATGCCCACTAAGGCCCTGTGCTGGAGTGGAAAT HPV18-RD primer sequence:

[0064] GGCCTTAGTGGGCATCCATTTCCTCAGAAACATTAGACGT HPV18-FO primer sequence:

[0065] TTATAATCCTGAAACACAACGT HPV18-RO primer sequence:

[0066] AGACACATTGTCCCTAACG ROX-inner-Probe sequence:

[0067] AGGGAACACGGGAGT (ROX) CTGT-BHQ2

[0068] HPV18-FSACP primer sequence:

[0069] ACAGACTCCCGTGTTCCCTCTGTGCTGGAGTGGAAAT HPV18-RSACP primer sequence:

[0070] ACAGACTCCCGTGTTCCCTTCCTCAGAAACATTAGACGT HPV33 target sequence:

[0071] TAGTGAGGCCACAGTGTACCTGCCTCCTGTACCTGTATCTAAAGTTGTCAGCACTGATGAATATGTGTCTCGCACAAGCATTTATTATTATGCTGGTAGTTCCAGACTTCTTGCTGATTAAGAATCCTAATAACGCTAAAAAATTATTGGTACCCAAAGTATCAGGCTTGCAATATAGGGTTTTTAGGGTCCGTTTACCAGATCCTAATAAATTTGGATTTCCTGACACCTCCTTTTATAACCCTGATACACAACGATTAGTATGGGCATGTGTAGGCCTTGAAATAGGTAGAGGGCAGCCATTAGGCGTTGGCATAAGTGGTCATCCTTTATTAAACAAATTTGATGACACTGAAACCAGTAACAAGTATCCTGGACAACCGGGTGCTGATAATAGGGAATGTTTATCCATGGATTATAAACAAACACAGTTATGTTTACTTGGATGTAAGCCTCCAACAGGGGAACATTGGGGTAAAGGTGTT

[0072] HPV33-FL primer sequence:

[0073] GGCATGTGTAGGCCTTGAAA HPV33-RL primer sequence:

[0074] GGAGGTGTCAGGAAATCCAAATTTA HPV33-FSA primer sequence:

[0075] TAGGGTCCGTTTACCAGATC HPV33-RSA primer sequence:

[0076] GACCACTTATGCCAACGC HPV33-FD primer sequence:

[0077] CATACTAATCGTTGTGTATCAGGGTTAGGGTCCGTTTACCAGATC HPV33-RD primer sequence:

[0078] ACCCTGATACACAACGATTAGTATGGACCACTTATGCCAACGC HPV33-FO primer sequence:

[0079] AGGCTTGCAATATAGGGTT HPV33-RO primer sequence:

[0080] ACTGGTTTCAGTGTCATCAA Cy5-inner-Probe sequence:

[0081] CGCCGCTTCCTTCAACT(Cy5)TCAC-BHQ3

[0082] HPV33-FSACP primer sequence:

[0083] GTGAAGTTGAAGGAAGCGGCGTAGGGTCCGTTTACCAGATC HPV33-RSACP primer sequence:

[0084] GTGAAGTTGAAGGAAGCGGCGGACCACTTATGCCAACGC Cas12j3 single-stranded activation target sequence:

[0085] CGCCTGGTAGTCGGATTTGCG-CAACTTCTGGGTGCGGTT

[0086] crRNA sequence for Cas12j3:

[0087] UAUUGAUUGCCCAGUACGCUGGGACGCAAAUCCGACUACCAGGCG

[0088] Example 2: MicroRNA detection

[0089] In this example, three microRNA targets, miR21, miR196a, and miR10b, were used as detection targets. Phi29 DNA polymerase was used for efficient target amplification and probe strand displacement, combined with trans-cleavage by Cas12j3, thereby completing a one-tube multiplex detection of three nucleic acid targets based on CRISPR / Cas12j3 protein.

[0090] The flow chart of the test is as follows Figure 4 As shown, in the same reaction tube, the reaction system contains three types of targets (miR21, miR196a and miR10b), three double-stranded probes corresponding to the targets (FAM-fPadlock corresponding to miR21, ROX-fPadlock corresponding to miR196a and Cy5-fPadlock corresponding to miR10b) and DHRCA isothermal amplification reagent. When a corresponding target appears, the corresponding fPadlock will be connected into a circular shape by DNA ligase, and the Phi29 polymerase will act on the target to extend and trigger rolling circle amplification (DHRCA), so that a large number of single-stranded probes are displaced by the chain. At the same time, the rolling circle amplification product can stimulate the CRISPR-Cas12j3 trans-cutting activity and cut the single-stranded probe (ssProbe), thereby generating the corresponding type of fluorescent signal and significantly enhancing the fluorescence intensity, ultimately indicating the presence of the corresponding target. However, when the system does not contain a target, fPadlock cannot be ligated by the ligase, rolling circle amplification (DHRCA) cannot be performed, the single-stranded probe cannot be separated, and the trans-cleavage activity of CRISPR-Cas12j3 cannot be activated, so no corresponding type of fluorescent signal is generated.

[0091] Schematic diagram of primer design and probe working Figure 5 As shown in this figure, Figure 4 The supplementary explanation mainly presents the specific reaction principle.

[0092] Detection results and target specificity analysis such as Figure 6 As shown, the upper left part of the figure is a schematic diagram of the determination of multiple detection results. The FAM signal is generated by miR21, the ROX signal is generated by miR196a, and the Cy5 signal is generated by miR10b. The upper right part shows that eight different reaction systems generate different types of fluorescence signals due to the different types of microRNA contained, and the fluorescence intensity is significantly enhanced.

[0093] (1) Reaction system

[0094] FAM-inner-Probe and miR21-Padlock probe annealing to form miR21-Padlock dsProbe, ROX-inner-Probe and miR196a-Padlock probe annealing to form miR196a-Padlock dsProbe, Cy5-inner-Probe and miR10b-Padlock probe annealing to form miR10b-Padlock dsProbe.

[0095] The target to be detected is first mixed with miR21-Padlock dsProbe, miR196a-Padlock dsProbe and miR10b-Padlock dsProbe, and incubated at 80°C for 5 min, and then slowly reduced to room temperature. The microRNA target is annealed and combined with the corresponding Padlock dsProbe, and the incubation product is stored for use.

[0096] In the 10 μL isothermal amplification detection reaction system, 4 μL of the above incubation product, 1×Ligation Buffer, 1.25 U / μL PBCV DNA Ligase, 1×Phi29 Reaction Buffer, 0.4 mM dNTPs, 0.1 mg / mL Recombinant Albumin, 0.2 U / μL Phi29 DNA polymerase, 1 μM Cas12j3, 1 μM crRNA are contained.

[0097] (2) Reaction time and temperature

[0098] The prepared isothermal amplification detection reaction system is placed in a centrifuge tube, heated at 37°C for 120 min, and the fluorescence signal value is detected once every 1 min.

[0099] (3) Detection of fluorescence signal

[0100] The signal of the FAM fluorescent probe corresponds to the detection of the miR21 target, the signal of the ROX fluorescent probe corresponds to the detection of the miR196a target, and the signal of the Cy5 fluorescent probe corresponds to the detection of the miR10b target.

[0101] The specific experimental results are shown in Figure 6 The type of fluorescence signal generated after the reaction is consistent with the type of detection target, and the fluorescence brightness is significantly higher than that of the non-target reaction, that is, the detection specificity of the method is good.

[0102] (4) The target nucleic acid sequence, isothermal amplification Padlock Probe sequence and double-stranded probe sequence involved in this embodiment are as follows:

[0103] miR21 sequence:

[0104] UAGCUUAUCAGACUGAUGUUGA miR21-Padlock probe sequence:

[0105] 5’P-CTGATAAGCTATTGCAGCGCTCTGACTTTGCTCGCAAATCCGACTACCAGGCGCGTCGCCGTCCAGCTCGACCTCAACATCAGT FAM-inner-Probe sequence:

[0106] AGCAAAGTCAGAGCGCT(FAM)GCAA-BHQ1

[0107] miR196a sequence:

[0108] UAGGUAGUUUCAUGUUGUUGGG miR196a-Padlock probe sequence:

[0109] 5’P-GAAACTACCTAACAGACTCCCGTGTTCCCTCGCAAATCCGACTACCAGGCGAGGCGAACGAGTAGTTGATTCCCAACAACAT ROX-inner-Probe sequence:

[0110] AGGGAACACGGGAGT(ROX)CTGT-BHQ2

[0111] miR10b sequence:

[0112] UACCCUGUAGAACCGAAUUUGUG miR10b-Padlock probe sequence:

[0113] 5’P-TCTACAGGGTAGTGAAGTTGAAGGAAGCGGCGCGCAAATCCGACTACCAGGCG GTCCCACCCTCCAACCACCACACAAATTCGGT Cy5-inner-Probe sequence:

[0114] CGCCGCTTCCTTCAACT(Cy5)TCAC-BHQ3Cas12j3’s crRNA sequence:

[0115] UAUUGAUUGCCCAGUACGCUGGGACGCAAAUCCGACUACCAGGCG.

Claims

1. A one-tube multiplex nucleic acid detection method based on CRISPR / Cas12j3 isothermal amplification, characterized in that: Adding the sample to be tested to a detection reagent, wherein the detection reagent includes CRISPR / Cas12j3 protein, a reagent for activating CRISPR / Cas12j3 protein, and different double-stranded probes designed for different nucleic acid targets to be tested; The double-stranded probe is formed by annealing a probe chain and a complementary chain. The complementary chain is used to participate in the isothermal amplification of the corresponding nucleic acid target and is synthesized into the amplification product through chain displacement, thereby releasing the probe chain. Different fluorescent groups are modified in the sequence of the probe chain for different nucleic acid targets. The activated CRISPR / Cas12j3 protein releases a fluorescent signal after trans-cleavage. When the fluorescent signal of the corresponding nucleic acid target is detected, it indicates that the corresponding nucleic acid target is present in the sample to be tested; otherwise, the corresponding nucleic acid target is not present.

2. The one-tube multiple nucleic acid detection method based on CRISPR / Cas12j3 isothermal amplification according to claim 1, characterized in that: The reagent for activating CRISPR / Cas12j3 protein includes crRNA of Cas12j3 and a single-stranded activation target of Cas12j3.

3. The one-tube multiple nucleic acid detection method based on CRISPR / Cas12j3 isothermal amplification according to claim 1, characterized in that The 5' end of the complementary chain is complementary to the probe chain base pairing, presenting a double-stranded DNA structure; the 3' end of the complementary chain is a free single-stranded DNA structure for participating in isothermal amplification.

4. The one-tube multiple nucleic acid detection method based on CRISPR / Cas12j3 isothermal amplification according to claim 1, characterized in that The 3' end of the sequence of the probe chain is modified with a fluorescent group and a quenching group.

5. The one-tube multiple nucleic acid detection method based on CRISPR / Cas12j3 isothermal amplification according to claim 1, characterized in that The maximum number of nucleic acid targets to be tested in the one-tube multiple nucleic acid test is not less than 3.

6. The one-tube multiple nucleic acid detection method based on CRISPR / Cas12j3 isothermal amplification according to claim 1, characterized in that: The isothermal amplification uses Bst DNA polymerase and / or Phi29 DNA polymerase.

7. The one-tube multiple nucleic acid detection method based on CRISPR / Cas12j3 isothermal amplification according to claim 6, characterized in that: The isothermal amplification using Bst DNA polymerase includes, but is not limited to, loop-mediated isothermal amplification, recombinase polymerase amplification, rolling circle amplification, and strand displacement amplification.

8. The one-tube multiple nucleic acid detection method based on CRISPR / Cas12j3 isothermal amplification according to claim 6, characterized in that: When isothermal amplification is mediated by Phi29 DNA polymerase, the complementary chain is a locked circle probe, and the probe chain is complementary to the 5' end of the locked circle probe.

9. The one-tube multiple nucleic acid detection method based on CRISPR / Cas12j3 isothermal amplification according to claim 8, characterized in that: The lock ring probe is provided with three functional regions: a microRNA binding region, a probe chain binding region, and a Cas12j3 single-stranded target activation functional region.

10. The one-tube multiple nucleic acid detection method based on CRISPR / Cas12j3 isothermal amplification according to claim 9, characterized in that: The microRNA binding region is used to complementarily pair with the target microRNA, and under the action of the ligase, it is converted from a linear padlock probe into a circular padlock probe and initiates RCA; the probe chain binding region is used to complementarily pair with the probe chain to form a double-stranded probe. When RCA is initiated, the probe chain on the circular padlock probe is displaced by the Phi29 DNA polymerase chain to form a free single-stranded probe; the Cas12j3 single-stranded target activation functional region is used to synthesize the single-stranded target sequence of Cas12j3 in the RCA product, activate the trans-cutting and cis-cutting activities of Cas12j3, and trans-cut the single-stranded probe formed by the chain displacement to release a fluorescent signal.