Molecular marker related to width of tarsal node of bee and application of molecular marker in germplasm resource improvement of bee

By developing molecular markers related to the tarsal width of honey bees and using nucleotide sequences and primer pairs for PCR detection, the inaccuracy of morphological markers in the evaluation of honey bee germplasm resources was solved, and efficient evaluation of the tarsal width of honey bees and the selection of high-quality varieties were achieved.

CN120796491APending Publication Date: 2025-10-17GUIZHOU PROVINCIAL MODERN AGRI DEV RES INST (GUIZHOU PROVINCIAL MODERN RURAL DEV RES CENT GUIZHOU PROVINCIAL RES INST OF RURAL ECONOMIC & SOCIAL DEV GUIZHOU PROVINCIAL AGRI PROD PROCESSING RES INST) +2
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510937806.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-08
Publication Date
2025-10-17

AI Technical Summary

Technical Problem

In the existing technology, morphological markers are easily interfered with by environmental factors in the evaluation of bee germplasm resources, and there is a lack of unified judgment standards, which leads to inaccurate evaluation and affects the effect of bee variety breeding.

Method used

Develop a molecular marker related to the tarsal width of honey bees. Use the molecular marker with the nucleotide sequence of SEQ ID NO.1 in combination with a specific primer pair for PCR detection. By detecting the polymorphic site Chr8_3122336, the tarsal width trait is determined, and a kit is provided to assist breeding.

Benefits of technology

It has achieved efficient and accurate assessment of the width of the bee's tarsus, improved the accuracy of identifying the bee's crawling ability and pollen collection ability, and promoted the cultivation of new high-quality bee varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120796491A_ABST
    Figure CN120796491A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of animal breeding, in particular to a molecular marker related to the width of a tarsal node of a bee and application of the molecular marker in germplasm resource improvement of the bee. The molecular marker comprises a nucleotide sequence as shown in SEQ ID NO.1, the 196th site of the nucleotide sequence is a polymorphic site, and the polymorphism is C or T. On the basis of a whole genome association analysis result of bee sequencing data, an SNP site related to a bee tarsal node width character is screened, and a corresponding molecular marker is developed on the basis of the SNP site. By detecting the polymorphism of the molecular marker for bees, the tarsal width character of the bees can be reflected, so that the molecular marker can be used for breeding high-quality bee varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of animal breeding, in particular to a molecular marker related to the tarsal width of a honeybee and application of the molecular marker in improving the germplasm resources of the honeybee. Background Art

[0002] Chinese honey bee ( Apis cerana cerana The Chinese honey bee (Apis cerana var. ...

[0003] Morphological markers remain a common method for bee species identification and performance evaluation due to their low cost and ease of use. However, these markers are susceptible to interference from environmental factors such as nutritional status during bee development, which may limit their application in the precise evaluation of Chinese honey bees. Furthermore, some morphological markers may face challenges such as suboptimal operability and a lack of standardized criteria.

[0004] Tarsus width is a specific morphological characteristic of the honeybee's foot (tarsus), a key morphological indicator of bees. It is associated with the bees' ability to crawl and collect pollen. Therefore, developing molecular markers related to specific morphological traits such as tarsus width will facilitate more accurate evaluation of germplasm resources and assist in breeding, thereby promoting the development of new honeybee varieties (or strains) with superior overall traits. Summary of the Invention

[0005] In order to solve the problems existing in the prior art, the present invention provides a molecular marker related to the tarsal width of honeybees and its application in improving the germplasm resources of honeybees.

[0006] In a first aspect, the present invention provides a molecular marker associated with the tarsal width of a honeybee, wherein the molecular marker comprises a nucleotide sequence as shown in SEQ ID NO.1, wherein the 196th position of the nucleotide sequence is a polymorphic site, and the polymorphism is C or T.

[0007] The nucleotide sequence shown in SEQ ID NO.1 is: TGTCGGCATGATTGAGAGAGAGAGAGAGAGAGAGAAAGGAAAAGAGTATTACGTCGGTATTCAAGTTTTTTTGAACGTGTCTAGGAAACATTCGTCAATTAAAGTACTTCCTGCGTACGAAGAAAATACTTTTGAAGCTAATGGTGATTATTATCGTCGTCGTAGTTTTATCCTAGAGCATTATTAGATTACGCGGAATTTTTTATGTCCATTCTCATTGTTCTTTTCCTTTTTTCAATCCCTTATCTTTCCTTCCGATTGAGAAACGATTATCTAAAGATTGAAATTGTTTGTCGTTCGAATATAGCACGCACGATAA.

[0008] In a second aspect, the present application provides a primer pair for amplifying the molecular marker, comprising the following nucleotide sequences: F1: TTTTATCCTAGAGCATTATTAGATTACGC, F2: TTTTATCCTAGAGCATTATTAGATTACGT, R: AGGAAAAGAACAATGAGAATGGACA.

[0009] Further, the F1 and F2 respectively carry different fluorescent markers (also referred to as fluorescent labels), which include one or more of FAM, TET, HEX, ROX, Cy3, Cy5, Alexa Fluor, SYBR Green, DAPI, FITC or Texas Red.

[0010] For example, the F1 is connected with GAAGGTGACCAAGTTCATGCT (FAM) at 5', and the F2 is connected with GAAGGTCGGAGTCAACGGATT (HEX) at 5'.

[0011] In a third aspect, the present application provides a kit comprising the molecular marker or the primer pair.

[0012] In a fourth aspect, the present application provides an application of the molecular marker or the primer pair or the kit in identifying the tarsal width trait of honeybees.

[0013] The present application further provides an application of the molecular marker or the primer pair or the kit in breeding honeybees with high pollen collection capacity, improving the germplasm resources of honeybees or molecular marker assisted breeding of honeybees.

[0014] Further, the application comprises: For a to-be-tested honeybee, detecting polymorphism of the aforementioned molecular marker, and judging the tarsus width trait of the to-be-tested honeybee according to the detection result.

[0015] Further, the detection comprises one or more of gene sequencing, PCR or probe detection.

[0016] Further, the PCR uses the aforementioned primer pair.

[0017] Further, the judging the tarsus width trait of the to-be-tested honeybee according to the detection result comprises: The honeybee with the detection result of C / C has shorter tarsus width compared with the honeybee with the detection result of C / T in terms of polymorphism of the aforementioned molecular marker.

[0018] The present application has the following beneficial effects: The present application precisely locates a key SNP site (Chr8_3122336) closely related to the tarsus width trait of honeybee through whole genome association analysis (GWAS) on Apis cerana. Based on this site, we successfully developed a new type of molecular marker. The marker can efficiently and accurately identify the tarsus width of honeybee. More importantly, the molecular marker shows great potential in evaluating the climbing ability and pollen collection ability of honeybee, opening up a new way for breeding high-yield, high-efficiency and high-quality new varieties of honeybee. BRIEF DESCRIPTION OF DRAWINGS

[0019] In order to more clearly illustrate the technical solutions in the present application or prior art, the following will briefly introduce the drawings needed to be used in the embodiments or prior art description. Obviously, the drawings in the following description are some embodiments of the present application, and for those skilled in the art, other drawings can also be obtained without creative labor based on these drawings.

[0020] Figure 1 is the tarsus width trait comparison result of honeybees with different genotypes of SNP site Chr8_3122336 provided in Embodiment 2 of the present application.

[0021] Figure 2 is the amplification result of the primer pair provided in Embodiment 2 of the present application; the left band is Marker, and the right three bands are amplification products. DETAILED DESCRIPTION

[0022] In order to make the objects, technical solutions and advantages of the present application clearer, the technical solutions in the present application will be described clearly and completely below in combination with the drawings in the present application. Obviously, the described embodiments are some of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the protection scope of the present application.

[0023] The experimental methods involved in the following embodiments can be realized by using conventional experimental methods in the art, for example, by referring to experimental manuals in the art or by referring to manufacturer's instructions, if not particularly limited.

[0024] The experimental materials and reagents involved in the following embodiments can be commercially available, if not particularly limited.

[0025] Embodiment 1 The present application provides a SNP site (Chr8_3122336) screened, and the screening process of the SNP site is as follows: 1. The present application is based on 110 Chinese honeybee samples, and the tarsus width is detected. The worker bee thorax tissue genomic DNA is extracted after the worker bee is dissected, and then the Truseq Nano DNA HT kit (Illumina, USA) is used to construct a library. The DNA is randomly broken into 350 bp fragments, and the DNA library is obtained after end repair, poly A tail addition, sequencing adapter addition, amplification, purification and other steps. The insert size of the library is detected by Agilent 2100, and the effective concentration of the library is accurately quantified by qPCR method. After the quality is qualified, the DNA library construction is completed.

[0026] 2. Genomic sequencing, alignment and SNP identification: after the sample library construction is successful, the sample library is sequenced based on the Illumina HiseqPE150 platform (Illumina, USA). In the sequencing process, low-quality reads are deleted to ensure the quality of the results [quality control standard: delete reads containing more than 10% unknown nucleotides, delete reads containing adapter sequences, delete reads containing more than 50% low-quality (phred quality<5) base content in sequencing], and finally a single honeybee sample generates more than 4.5G high-quality paired-end clean reads, Q20, Q30 are more than 90%, 85% respectively.

[0027] 3、The obtained high-quality paired-end reads are aligned to the reference genome Apis cerana (Genbank accession number: PRJNA738447) by BWA 0.7.8 software. The alignment results are removed by SAMTOOLS 1.15 software, and the average alignment rate of the population sample is ensured to be more than 95%, and the average sequencing depth of the genome is more than 20X.

[0028] 4, The Bayes model in SAMTOOLS 1.15 software is used for population SNP detection, and high-quality SNPs are screened out according to the quality control standard [deleting SNPs with a sequencing error rate of more than 1% (Q20 quality control), deleting SNPs with a base number of less than 5 between adjacent SNP sites, and deleting SNPs with a coverage depth of more than 1 / 3-5 times of the average depth]. The detected SNPs are annotated by using ANNOVAR 20130520 software to identify exon regions, intron regions, variable splicing sites, upstream and downstream regions of genes, intergenic regions, and distinguish synonymous SNPs and non-synonymous SNPs.

[0029] 5, Genome-wide association analysis: based on mrMLM 1.3 software, genome-wide association analysis (genome-wide association studies, GWAS) is carried out to determine the association between tarsus width traits and SNP sites, and the SNP quality control standard is referred to MAF>5%, and the model is selected as a multi-site random mixed linear model.

[0030] 6, The analysis results are as follows: Table 1 Association between honeybee tarsus width phenotype and SNP

[0031] The present application screens a plurality of SNP sites associated with tarsus width traits, wherein the site Chr8_3122336 (located at position 3122336 of chromosome 8 of the honeybee, with polymorphism C / T) is more significant. Based on the site, a molecular marker is developed, which is located at position 196 of the nucleotide sequence shown in SEQ ID NO. 1, with polymorphism C / T.

[0032] Example 2 1, The present application selects 107 Apis cerana samples to carry out verification work, verifies the association between the SNP site and the tarsus width trait involved in example 1, and specifically sequences the 107 Apis cerana, and measures the tarsus width of the 107 Apis cerana by using a microscopic measurement system to obtain the tarsus width data and the SNP data of the 107 Apis cerana.

[0033] The present application groups according to the genotype type at the SNP site, and uses SPSS 16.0 software to analyze the difference significance of the tarsus width data of different groups, so as to compare whether there is a difference in tarsus width between different genotypes.

[0034] Finally, 23 bees show C / C genotype, 47 bees show C / T genotype, and 37 bees show T / T genotype, and through LSD, Duncan data analysis (Table 1 and Table 2), C / T genotype and C / C genotype show significant difference (P P <0.05), and the tarsus width of the C / C genotype bees is significantly smaller than that of the C / T genotype bees (as shown in the table Figure 1 ).

[0035] Table 2 Comparison of tarsus width of bees with different genotypes at Chr8_3122336 site

[0036] * indicates P <0.05, significant difference.

[0037] Table 3 Comparison of tarsus width of bees with different genotypes at Chr8_3122336 site

[0038] 2, primer amplification The present application further amplifies the SNP site and the fragment near the SNP site in example 1 for 3 samples, specifically including: 2.1, the primer pair is as follows: Upstream primer: 5'-TGTCGGCATGATTGAGAGAG-3', Downstream primer: 5'-TTATCGTGCGTGCTATATTCG-3'.

[0039] 2.2, the PCR system is as follows: Table 4 PCR system

[0040] The PCR program is as follows: Table 5 PCR program

[0041] 2.3, detection results The results are shown in the table Figure 2 Apis cerana cerana Figure 1 Figure 2 Figure As can be seen from the results, the electrophoretic bands of the amplified DNA fragments are clear and bright, and there is no impurity band, which shows that the primers, amplification system and program have strong specificity, and can achieve the purpose of amplifying the SNP site and the fragment near the SNP site.

[0042] For the amplified product, gene sequencing can be used to detect the genotype of the 196th nucleotide sequence, thereby determining whether the bee's genotype at this site is C / C, C / T, or T / T. Based on the identification results, it can be determined whether the bee has a long or short tarsal width. Based on this characteristic, when selecting bee breeds, bees with a specific tarsal width can be selected to cultivate bees with high pollen collection ability.

[0043] 3. The present invention further provides a KASP primer pair comprising: F1:TTTTATCCTAGAGCATTATTAGATTACGC, F2:TTTTATCCTAGAGCATTATTAGATTACGT, R: AGGAAAAGAACAATGAGAATGGACA.

[0044] F1 is linked to GAAGGTGACCAAGTTCATGCT (FAM) at the 5' end, and F2 is linked to GAAGGTCGGAGTCAACGGATT (HEX) at the 5' end.

[0045] Before the actual detection, the primer pair is labeled with a fluorescent dye, followed by PCR amplification and fluorescence detection. The polymorphism of the SNP site can be determined based on the fluorescence level detection results of the FAM and HEX fluorescence channels.

[0046] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A molecular marker associated with honey bee tarsal width, characterized in that: The molecular marker includes a nucleotide sequence as shown in SEQ ID NO. 1, wherein the 196th position of the nucleotide sequence is a polymorphic site, and the polymorphism is C or T; The nucleotide sequence shown in SEQ ID NO.1 is: TGTCGGCATGATTGAGAGAGAGAGAGAGAGAGAGAAAGGAAAAGAGTATTACGTCGGTATTCAAGTTTTTTTGAACGTGTCTAGGAAACATTCGTCAATTAAAGTACTTCCTGCGTACGAAGAAAATACTTTTGAAGCTAATGGTGATTATTATCGTCG TCGTAGTTTTATCCTAGAGCATTATTAGATTACGCGGAATTTTTTATGTCCATTCTCATTGTTCTTTTCCTTTTTTCAATCCCTTTATCTTTCCTTCCGATTGAGAAACGATTATCTAAAGATTGAAATTGTTTGTCGTTCGAATATAGCACGCACGATAA.

2. A primer pair for amplifying the molecular marker according to claim 1, characterized in that: Includes the following nucleotide sequences: F1:TTTTATCCTAGAGCATTATTAGATTACGC, F2:TTTTATCCTAGAGCATTATTAGATTACGT, R: AGGAAAAGAACAATGAGAATGGACA.

3. A kit, characterized in that It comprises the molecular marker according to claim 1 or the primer pair according to claim 2.

4. Use of the molecular marker according to claim 1, or the primer pair according to claim 2, or the kit according to claim 3 in identifying the tarsal width trait of honey bees.

5. Use of the molecular marker according to claim 1, or the primer pair according to claim 2, or the kit according to claim 3 in breeding bees with high pollen-collecting ability, improving bee germplasm resources, or molecular marker-assisted breeding of bees.

6. The use according to claim 4, characterized in that The applications include: For the bees to be tested, the polymorphism of the molecular marker according to claim 1 is detected, and the tarsal width trait of the bees to be tested is determined according to the detection results.

7. The use according to claim 6, characterized in that The detection includes: one or more of gene sequencing, PCR or probe detection.

8. The use according to claim 7, characterized in that The primer pair used in the PCR is the primer pair described in claim 2.

9. The use according to any one of claims 6 to 8, characterized in that: The method of determining the tarsal width trait of the bee to be tested according to the test results includes: The molecular marker polymorphism of claim 1, wherein the bees with a test result of C / C have a shorter tarsal width than the bees with a test result of C / T.