A SNP marker that affects IMP or GMP content in pigs and its application
By identifying SNP markers for IMP or GMP content in pigs through GWAS and utilizing site-directed mutagenesis and CRISPR/Cas9 technology, the problem of improving pork flavor and quality in existing technologies has been solved, achieving efficient breeding and meat quality improvement.
Patent Information
- Application Number
- CN202511333409.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-18
- Publication Date
- 2026-03-06
- Estimated Expiration
- 2045-09-18
AI Technical Summary
Existing technologies are insufficient to effectively increase the content of inosinic acid (IMP) and guanylic acid (GMP) in pork, which affects the flavor quality of meat and breeding progress.
Fifteen SNP markers affecting IMP or GMP levels in pigs were identified through genome-wide association analysis (GWAS). Corresponding primer combinations and kits were designed, and site-directed mutagenesis was used to increase the frequency of dominant alleles generation by generation. Combined with CRISPR/Cas9 gene editing technology, the IMP or GMP levels in pigs were optimized.
It enables the rapid and accurate selection of pig breeds with high IMP or high GMP content, improving pork flavor and breeding efficiency, and shortening the breeding process.
Smart Images

Figure CN120796514B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of molecular markers and animal genetic breeding technology, and in particular to an SNP marker that affects the content of IMP or GMP in pigs and its application. Background Technology
[0002] In the modern pig industry, the flavor quality of pork is one of the core factors determining its market competitiveness. Inosinic acid (IMP) and guanylic acid (GMP) are the core components of meat umami flavor, and their content directly affects the flavor quality of meat. IMP is one of the strongest known flavor nucleotides, possessing a significant umami flavor. It can produce a strong synergistic effect with amino acids (such as glutamic acid), greatly enhancing the perception of umami, and is a key flavor indicator of high-quality pork. Although GMP is present in lower amounts in pork, its flavor-enhancing ability is strong, especially when it works in conjunction with IMP and glutamic acid, significantly enhancing umami flavor. Breeding breeds with high IMP or GMP content can not only improve the natural flavor of meat without the need for additional additives, but also increase consumer satisfaction and product market competitiveness. At the same time, IMP production is related to energy metabolism, and its stability reflects, to some extent, muscle maturity and meat quality retention. In summary, high levels of IMP or GMP are a guarantee of high-quality pork flavor and have significant breeding application value.
[0003] Genome-wide association study (GWAS) is a genetic analysis method that scans tens of thousands of single nucleotide polymorphism (SNP) markers across the entire genome to detect their statistical associations with target traits. Currently, GWAS technology has achieved breakthroughs in the analysis of several economic traits in pigs, including meat quality, growth, and reproductive traits.
[0004] Inosinic acid (IMP) and guanylic acid (GMP) are core indicators of pork flavor and quality, and their genetic improvement has become an important direction in pig molecular breeding. Marker sites affecting IMP or GMP content can be identified through GWAS technology and directly converted into breeding markers for the selection of high-quality pig breeds. These markers include direct selection of major genes, precise application of causal mutations, and multi-gene aggregation breeding, which are of great significance to the production and economic benefits of the pig farming industry. Summary of the Invention
[0005] In order to overcome the shortcomings and disadvantages of the prior art, the primary objective of this invention is to provide an SNP marker that affects the content of IMP or GMP in pigs.
[0006] Another object of the present invention is to provide the application of the above-mentioned SNP marker.
[0007] The objective of this invention is achieved through the following technical solution:
[0008] A SNP marker that affects IMP or GMP levels in pigs, comprising at least one of the following SNP markers:
[0009] (I) The SNP site corresponds to the G>A mutation at position 23634644 on chromosome 14 in International Pig Genome Version 11.1;
[0010] (II) The SNP site corresponds to the G>A mutation at position 61539869 on chromosome 5 in International Pig Genome Version 11.1;
[0011] (III) The SNP site corresponds to the C>T mutation at position 73318431 on chromosome 6 in International Pig Genome Version 11.1;
[0012] (IV) The SNP site corresponds to the AT>A mutation at position 9931110 on chromosome 15 in International Pig Genome Version 11.1;
[0013] (V) The SNP site corresponds to the A>G mutation at position 7924927 on chromosome 15 in International Pig Genome Version 11.1;
[0014] (VI) The SNP site corresponds to the G>A mutation at position 73963573 on chromosome 7 in International Pig Genome Version 11.1;
[0015] (VII) The SNP site corresponds to the T>C mutation at position 49,824,761 on chromosome 15 in International Pig Genome Version 11.1;
[0016] (VIII) The SNP site corresponds to the T>C mutation at position 195,476,736 on chromosome 13 in International Pig Genome Version 11.1;
[0017] (IX) The SNP site corresponds to the A>C mutation at position 122321344 on chromosome 8 in International Pig Genome Version 11.1;
[0018] (X) The SNP site corresponds to the A>G mutation at position 122335895 on chromosome 8 in the international pig genome version 11.1;
[0019] (XI) The SNP site corresponds to the C>T mutation at position 30422074 on chromosome 12 in International Pig Genome Version 11.1;
[0020] (XII) The SNP site corresponds to the A>G mutation at position 30398438 on chromosome 12 in version 11.1 of the International Pig Genome;
[0021] (XIII) The SNP site corresponds to the GTCACACACAC>G mutation at position 7723118 on chromosome 2 in International Pig Genome Version 11.1;
[0022] (XIV) The SNP site corresponds to the A>T mutation at position 34106157 on chromosome 6 of the 11.1 version of the International Pig Genome;
[0023] (XV) The SNP site corresponds to the C>T mutation at position 79119746 on chromosome 7 of the 11.1 version of the International Pig Genome.
[0024] For (I), the SNP-labeled nucleic acid sequence is preferably as shown in SEQ ID NO:1, where M in the sequence is G or A, and the SNP site is a single base mutation of G255-A255 at position 255 of the sequence labeled in SEQ ID NO:1.
[0025] For (VIII), the SNP-labeled nucleic acid sequence is preferably as shown in SEQ ID NO:2, where M in the sequence is T or C, and the SNP site is a single-base mutation of T25-C25 at position 25 of the sequence labeled in SEQ ID NO:2.
[0026] For (XI), the SNP-labeled nucleic acid sequence is preferably as shown in SEQ ID NO:3, where M in the sequence is C or T, and the SNP site is a single-base mutation of T262-C262 at position 262 of the sequence labeled in SEQ ID NO:3.
[0027] In the specific implementation plan:
[0028] For (I)-(III), the source of the pig is American Landrace pig or its synthetic line, and the corresponding trait is IMP content.
[0029] For (Ⅳ)-(Ⅴ), the pigs are of American Large White breed or its synthetic line, and the corresponding trait is IMP content.
[0030] For (VI)-(VII), the pigs are of American Duroc breed or its synthetic line, and the corresponding trait is GMP content.
[0031] For (VIII)-(X), the source of the pig is American Landrace pig or its synthetic line, and the corresponding trait is GMP content.
[0032] For (XI)-(XⅣ), the pigs are of American Large White breed or its synthetic line, and the corresponding trait is GMP content.
[0033] For (XV), the source of the pig is American Landrace, American Large White, American Duroc or their synthetic lines, and the corresponding trait is GMP content.
[0034] A primer combination for detecting the above-mentioned SNP markers, comprising at least one of primer pairs primer-F1 and primer-R1, primer pairs primer-F2 and primer-R2, and primer pairs primer-F3 and primer-R3, the nucleotide sequences of which are shown in SEQ ID NO:4-9;
[0035] A kit for detecting the above-mentioned SNP markers, comprising the above-mentioned primer combination.
[0036] The application of the SNP markers, primer combinations, or kits in identifying IMP or GMP content or meat quality-related traits in pigs or pork, screening pig breeds with high IMP or GMP content or excellent meat quality, and in genetic breeding of pig IMP, GMP content, or meat quality-related traits.
[0037] A method for genetic improvement of pigs, comprising the following steps:
[0038] Identify the aforementioned SNP markers of breeding pigs in the core breeding pig herd, and make corresponding selections based on the SNP markers:
[0039] For (I), select breeding pigs with the G / G genotype at position 23634644 on chromosome 14 of the International Swine Genome Version 11.1 from the core breeding pig population, and cull breeding pigs with the G / A genotype, in order to increase the frequency of the G allele at this locus generation by generation;
[0040] For (II), select breeding pigs with the A / A or G / A genotype at position 61539869 on chromosome 5 in International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pigs with the G / G genotype to increase the frequency of allele A at this locus generation by generation;
[0041] For (III), select breeding pig individuals with the C / C or C / T genotype at position 73318431 on chromosome 6 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the T / T genotype, so as to increase the frequency of allele C at this locus generation by generation.
[0042] For (Ⅳ), select breeding pig individuals with the AT / AT or AT / A genotype at position 9931110 on chromosome 15 in International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the A / A genotype to increase the frequency of the AT allele at this locus generation by generation.
[0043] For (V), select breeding pig individuals with the A / A or A / G genotype at position 7924927 on chromosome 15 in International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the G / G genotype, so as to increase the frequency of allele A at this locus generation by generation.
[0044] For (VI), select breeding pig individuals with the G / A or A / A genotype at position 73963573 on chromosome 7 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the G / G genotype to increase the frequency of allele A at this locus generation by generation;
[0045] For (VII), select breeding pig individuals with the T / T or T / C genotype at position 49824761 on chromosome 15 in International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the C / C genotype, so as to increase the frequency of the T allele at this locus generation by generation.
[0046] For (VIII), select breeding pig individuals with the T / T or T / C genotype at position 195476736 on chromosome 13 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the C / C genotype, so as to increase the frequency of the T allele at this locus generation by generation.
[0047] For (IX), select breeding pig individuals with the A / C or C / C genotype at position 122321344 on chromosome 8 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the A / A genotype to increase the frequency of allele C at this locus generation by generation;
[0048] For (X), select breeding pig individuals with the A / G or G / G genotype at position 122335895 on chromosome 8 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the A / A genotype to increase the frequency of the G allele at this locus generation by generation.
[0049] For (XI), select breeding pig individuals with the C / T or C / C genotype at position 30422074 on chromosome 12 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the T / T genotype, so as to increase the frequency of allele C at this locus generation by generation;
[0050] For (XII), select breeding pig individuals with the A / G or A / A genotype at position 30398438 on chromosome 12 in International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the G / G genotype, so as to increase the frequency of allele A at this locus generation by generation;
[0051] For (XⅢ), select breeding pig individuals from the core breeding pig population with the genotype GTCACACACAC / G or GTCACACACAC / GTCACACACAC at position 7723118 on chromosome 2 of the International Pig Genome Version 11.1, and cull breeding pig individuals with the G / G genotype, so as to increase the frequency of the GTCACACACAC allele at this locus generation by generation.
[0052] For (XⅣ), select breeding pig individuals with the A / T or T / T genotype at position 34106157 on chromosome 6 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the A / A genotype to increase the frequency of the T allele at this locus generation by generation;
[0053] For (XV), select breeding pig individuals from the core breeding pig population that have the C / T or T / T genotype at position 79119746 on chromosome 7 in International Pig Genome Version 11.1, and cull breeding pig individuals with the C / C genotype to increase the frequency of the T allele at that locus generation by generation.
[0054] A method for identifying IMP, GMP content, or meat quality-related traits in pigs or pork, comprising the following steps:
[0055] Identify the aforementioned SNP markers in pigs or pork, and determine the IMP, GMP content, or meat quality-related traits in pigs or pork based on the SNP sites of the SNP markers:
[0056] For (I), the IMP content of the pigs or pork, from high to low or the meat quality traits from good to bad, are sorted by the genotype at position 23634644 on chromosome 14 of the International Pig Genome Version 11.1, in the following order: G / G genotype, G / A genotype;
[0057] For (II), the IMP content of the pigs or pork, from high to low or the meat quality traits from excellent to poor, are ordered by the genotype at position 61539869 on chromosome 5 of the International Pig Genome Version 11.1, in the following order: A / A genotype, G / A genotype and G / G genotype.
[0058] For (III), the IMP content of the pigs or pork, from high to low or the meat quality traits from good to bad, are ordered by the genotype at position 73318431 on chromosome 6 of the International Pig Genome Version 11.1, in the following order: C / C genotype, C / T genotype and T / T genotype.
[0059] For (Ⅳ), the IMP content of the pigs or pork, from high to low or the meat quality traits from excellent to poor, are ordered by the genotype at position 9931110 on chromosome 15 of the International Pig Genome Version 11.1, in the following order: AT / AT genotype, AT / A genotype and A / A genotype.
[0060] For (V), the IMP content of the pigs or pork, from high to low or the meat quality traits from good to bad, are ordered by the genotype at position 7924927 on chromosome 15 of the International Pig Genome Version 11.1, in the following order: A / A genotype, A / G genotype and G / G genotype.
[0061] For (VI), the GMP content of the pigs or pork, from high to low or the meat quality traits from excellent to poor, are ordered by the genotype at position 73963573 on chromosome 7 of the International Pig Genome Version 11.1, in the following order: A / A genotype, G / A genotype, and G / G genotype.
[0062] For (VII), the GMP content of the pigs or pork, from high to low or the meat quality traits from excellent to poor, are ordered by the genotype at position 49824761 on chromosome 15 of the International Pig Genome Version 11.1, in the following order: T / T genotype, T / C genotype and C / C genotype.
[0063] For (VIII), the GMP content of the pigs or pork, from high to low or the meat quality traits from excellent to poor, are ordered by the genotype at position 195476736 on chromosome 13 of the International Pig Genome Version 11.1, in the following order: T / T genotype, T / C genotype and C / C genotype.
[0064] For (IX), the GMP content of the pigs or pork, from high to low or the meat quality traits from excellent to poor, are ordered by the genotype at position 122321344 on chromosome 8 of the International Pig Genome Version 11.1, in the following order: C / C genotype, A / C genotype and A / A genotype.
[0065] For (X), the GMP content of the pigs or pork, from high to low or the meat quality traits from excellent to poor, are ordered by the genotype at position 122335895 on chromosome 8 of the International Pig Genome Version 11.1, in the following order: G / G genotype, A / G genotype, and A / A genotype.
[0066] For (XI), the GMP content of the pigs or pork, from high to low or the meat quality traits from excellent to poor, are ordered by the genotype at position 30422074 on chromosome 12 of the International Pig Genome Version 11.1, in the following order: C / C genotype, C / T genotype and T / T genotype.
[0067] For (XII), the GMP content of the pigs or pork, from high to low or the meat quality traits from excellent to poor, are ordered by the genotype at position 30398438 on chromosome 12 of the International Pig Genome Version 11.1, in the following order: A / A genotype, A / G genotype and G / G genotype.
[0068] For (XⅢ), the GMP content of the pigs or pork, from high to low or the meat quality traits from excellent to poor, are ordered by the genotype at position 7723118 on chromosome 2 of the International Pig Genome Version 11.1, in the following order: GTCACACACAC / GTCACACACAC genotype, GTCACACACAC / G genotype, and G / G genotype.
[0069] For (XⅣ), the GMP content of the pigs or pork, from high to low or the meat quality traits from excellent to poor, are ordered by the genotype at position 34106157 on chromosome 6 of the International Pig Genome Version 11.1, in the following order: T / T genotype, A / T genotype, and A / A genotype.
[0070] For (XV), the GMP content of the pigs or pork, from high to low or the meat quality traits from excellent to poor, are ordered by the genotype at position 79119746 on chromosome 7 of the International Pig Genome Version 11.1, in the following order: T / T genotype, C / T genotype, and C / C genotype.
[0071] The application of the SNP markers, primer combinations, or kits described herein in the fields of gene editing or transgenics.
[0072] A method for establishing a new pig breed and / or a new pig strain that improves IMP and GMP content or enhances pork quality, comprising the following steps:
[0073] The above-mentioned SNP markers in pigs were identified, and the following mutations were performed based on the SNP markers:
[0074] For (I), pigs with the SNP marker having the genotype G / A are mutated to the G / G genotype through site-directed mutagenesis;
[0075] For (II), pigs with the SNP marker having the genotype G / A or G / G, the G / A or G / G genotype is mutated to the A / A genotype through site-directed mutagenesis;
[0076] For (III), pigs with the SNP marker having the genotype C / T or T / T, the C / T or T / T genotype is mutated to the C / C genotype through site-directed mutagenesis;
[0077] For (Ⅳ), pigs with the SNP marker having the genotype AT / A or A / A, the AT / A or A / A genotype is mutated to the AT / AT genotype through site-directed mutagenesis;
[0078] For (V), pigs with the SNP marker having the genotype A / G or G / G, the A / G or G / G genotype is mutated to the A / A genotype through site-directed mutagenesis;
[0079] For (VI), pigs with the SNP marker having the genotype G / A or G / G are mutated to the A / A genotype through site-directed mutagenesis.
[0080] For (VII), pigs with the SNP marker having the genotype T / C or C / C, the T / C or C / C genotype is mutated to the T / T genotype through site-directed mutagenesis;
[0081] For (VIII), pigs with the SNP marker having the genotype T / C or C / C are mutated to the T / T genotype through site-directed mutagenesis.
[0082] For (IX), pigs with the SNP marker having the genotype A / C or A / A, the A / C or A / A genotype is mutated to the C / C genotype through site-directed mutagenesis;
[0083] For (X), pigs with the SNP marker having the genotype A / G or A / A are mutated to the G / G genotype through site-directed mutagenesis.
[0084] For (XI), pigs with the SNP marker having the genotype C / T or T / T, the C / T or T / T genotype is mutated to the C / C genotype through site-directed mutagenesis;
[0085] For (XII), pigs with the SNP marker having the genotype A / G or G / G, the A / G or G / G genotype is mutated to the A / A genotype through site-directed mutagenesis;
[0086] For (XIII), the SNP marker is a pig with the genotype GTCACACACAC / G or G / G.
[0087] The GTCACACACAC / G and G / G genotypes were mutated to the GTCACACACAC / GTCACACACAC genotype by site-directed mutagenesis.
[0088] For (XⅣ), pigs with the SNP marker having the genotype A / T or A / A are mutated to the T / T genotype through site-directed mutagenesis.
[0089] For (XV), pigs with the SNP marker having the genotype C / T or C / C are mutated to the T / T genotype through site-directed mutagenesis.
[0090] The mutation is performed using transgenic methods or gene editing methods.
[0091] The preferred method for mutation is to use the CRISPR / Cas9 gene editing method.
[0092] The present invention has the following advantages and effects compared with the prior art:
[0093] (1) Based on three experimental pig groups of purebred American Landrace pigs, purebred American Large White pigs, and purebred American Duroc pigs, this invention uses whole genome resequencing and GWAS analysis to study and identify 15 SNP markers related to IMP or GMP content. At least one of the SNP markers in this invention can be used to detect relevant indicators in pigs, or at least one of these SNP markers can be used for genetic improvement.
[0094] (2) Based on SNP markers that affect the IMP or GMP content of pigs, this invention establishes a set of efficient and accurate molecular marker-assisted breeding technology, including primers and kits for detecting the SNP markers, identification of IMP or GMP content or meat quality-related traits in pigs or pork, and methods for genetic improvement of pigs. When applied to the genetic improvement of IMP or GMP content and meat quality-related traits in pigs, it can quickly and accurately select and breed pigs for IMP or GMP content and meat quality-related traits, thus accelerating the breeding process.
[0095] (3) This invention uses molecular breeding to solve the problem of low IMP or GMP content. By selecting the superior alleles of the above-mentioned SNPs, the frequency of superior alleles can be increased generation by generation, the IMP or GMP content can be increased, the progress of pig genetic improvement can be accelerated, and the economic benefits of breeding pigs can be effectively improved. Attached Figure Description
[0096] Figure 1 This is a Manhattan plot of GWAS analysis of IMP content traits on different chromosomes in different experimental populations; where the X-axis represents the location of the molecular marker site on the chromosome, and the Y-axis represents the -log value corresponding to the molecular marker site. 10 (P-value).
[0097] Figure 2 This is a Manhattan plot of GWAS analysis of GMP content traits on different chromosomes in different experimental populations; where the X-axis represents the location of molecular marker sites on the chromosome, and the Y-axis represents the -log value corresponding to the molecular marker sites. 10 (P-value).
[0098] Figure 3 It is a violin plot of the genotypes of all loci and the corresponding IMP or GMP content in the corresponding population, where the X-axis represents the genotype of the SNP molecular marker locus and the Y-axis represents the IMP or GMP content of the individual. Detailed Implementation
[0099] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.
[0100] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise stated, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field.
[0101] In the examples, the standards for HPLC detection were inosine monophosphate (IMP) (131-99-7) and guanosine monophosphate (GMP) (5550-12-9), which were purchased from Shanghai Anpu Experimental Technology Co., Ltd.
[0102] Example 1
[0103] 1. Laboratory animals
[0104] The pig population used in this invention consists of: 173 purebred American Landrace pigs, 166 purebred American Large White pigs, and 158 purebred American Duroc pigs.
[0105] All pigs were sourced from Jiangxi Yudu Jiada Livestock Co., Ltd. All pigs were slaughtered and tested at Jiangxi Nanchang Guohong Food Co., Ltd. after reaching 200 days of age, in the slaughterhouse's cutting workshop. After slaughter and bleeding, the hair, internal organs, head, tail, and limbs (below the wrists and joints) were removed, and the skin was removed to obtain a carcass. Sampling was completed within 30 minutes post-slaughter to minimize the impact of post-mortem metabolism on the content of purine nucleotides and their metabolites. The longissimus dorsi muscle was precisely separated from the left side of the pig carcass between the first and second lumbar vertebrae, and visible connective tissue and fascia were removed. Approximately 2.0g of muscle tissue was collected, rapidly transferred to 2mL cryovials, cut into small pieces, and flash-frozen in liquid nitrogen (-196℃), then stored in an ultra-low temperature freezer at -80℃ until the experiment.
[0106] 2. HPLC quantitative determination of IMP and GMP content in pork
[0107] (1) Extraction of IMP and GMP: Accurately weigh 0.4g (accurate to 0.001g) of muscle sample from the shredded longissimus dorsi muscle sample and place it in a 15mL polypropylene acid-resistant centrifuge tube.
[0108] (2) Acid hydrolysis extraction: Add 6 mL of 6% (w / w) perchloric acid solution pre-cooled to 4℃, and then homogenize it for 45 s with a handheld high-speed homogenizer (run for 10 s / pause for 5 s, cycle 3 times), and use an ice bath intermittently to prevent overheating.
[0109] (3) Centrifugation purification: Transfer the homogenate to a constant temperature water bath shaker (4℃), shake at 200 rpm for 15 min to promote nucleotide release; centrifuge at 4℃ and 5,000 rpm for 10 min, collect the supernatant into a new tube, repeat the centrifugation twice, and combine the supernatants from the two centrifugations.
[0110] (4) Precise pH control for acid-base neutralization: Place the combined supernatant from step (3) in an ice bath and use a micropipette to add 3 mol / L NaOH solution dropwise to adjust the pH to 6.5 ± 0.1 (using a pH meter for real-time monitoring), which can minimize interference with ATPase activity; add ultrapure water to make up to 10 mL, vortex to mix, and let stand for 10 min to promote ion balance.
[0111] (5) The content of IMP and GMP in the extract of the longissimus dorsi muscle of each individual pig was determined by high performance liquid chromatography (HPLC) (unit: mg / 100g). The HPLC analysis was performed on an ACQUITYUPLCH-ClassPLUS System (Waters). The chromatographic column was Waters BEH C18 (1.7 μm, 2.1× 100 mm). The mobile phase was 0.05 mol / L KH2PO4 buffer (pH 6.0)-methanol (95:5, v / v). The flow rate was 0.2 mL / min (isocratic elution). The column temperature was 30℃. The detection wavelength was 254 nm. The injection volume was 2 μL. The external standard method was used for quantification. The standard curve should meet the requirement of R²≥0.999.
[0112] (6) Concentration data obtained from the HPLC system are converted from the original unit µg / mL to mg / 100g using the following formula:
[0113]
[0114] Where C represents the content of each nucleotide in 100 grams of pork (mg / 100g), and C0 represents the concentration of the nucleotide measured by HPLC (µg / mL).
[0115] This invention conducted descriptive statistics on HPLC detection data of IMP and GMP in the longissimus dorsi muscle of three commercial pig breeds (Large White, Landrace, and Duroc). The sample size (N), mean, standard deviation (SD), minimum-maximum (Min-Max), and coefficient of variation (CV) were systematically calculated. The descriptive statistical results are shown in Table 1. Table 1 shows that 5'-guanylic acid (GMP) decreased in a gradient among breeds: Large White > Landrace > Duroc. The coefficient of variation in Duroc was 83.4%, indicating a lower detection level and suggesting higher volatility in its purine metabolism pathway regulation. The maximum IMP value in Duroc (396.34 mg / 100g) was significantly higher than in other breeds, but the mean was the lowest (252.62±4.73). The coefficients of variation for Large White and Landrace were similar (13.1%–13.2%), while the coefficient of variation for Duroc was significantly higher (23.7%), indicating the existence of individuals with high-value-specific IMP within the Duroc population. Duroc's high IMP potential can be enhanced through a combination of gene editing and precise nutritional regulation to improve overall flavor balance.
[0116] Table 1. Descriptive statistics of IMP and GMP content in three varieties (unit: mg / 100g)
[0117]
[0118] Example 2
[0119] 1. Acquisition, quality control, and genotyping of whole-genome resequencing data in pigs.
[0120] (1) DNA extraction: Ear tissue samples were collected from each individual in the three experimental pig groups in Example 1, and genomic DNA was extracted from each individual using the standard phenol-chloroform method. The extracted genomic DNA was dissolved in TE buffer. The quality of the extracted genomic DNA was detected using a Nanodrop-ND1000 spectrophotometer. The quality standard was met when the A260 / 280 ratio was around 1.8-2.0 and the A260 / 230 ratio was around 1.7-1.9.
[0121] (2) DNA sequencing: The concentration of DNA samples that meet the standards is diluted to 50 ng / μL. The whole genome resequencing (paired-end 150 bp sequencing mode) is completed by the BGI T7 sequencing platform. The average sequencing depth of the sample reaches 30×, and the raw sequencing data in fastq format is obtained. Clean reads are obtained through fastp (v0.23.0) quality control for subsequent analysis.
[0122] (3) Sequence alignment: The data obtained in step (2) were aligned with the Sscrofa 11.1 (NCBI Suscrofa version 11.1) reference genome using BWA (v0.7.17) to obtain a sam format file.
[0123] (4) Mutation detection: Use samtools (v1.10) to sort and convert the sam format file in step (3) into a bam format file, then use Sambamba (v0.8.2) to remove the PCR repeat sequences in the bam format file, and finally use Graphtyper (v2.7.7) to perform genetic variation detection on all individual bam files to obtain population-level genotype data (vcf file).
[0124] (5) Variation Quality Control: The population-level genotype data obtained in step (4) was quality controlled using samtools. High-quality genotype sites were retained if they met the condition "FILTER="PASS"" and the variation detection quality value (GQ) > 20. Plink (v1.9) was further used to perform quality control on the population-level genotype data, excluding variant sites with a minor allele frequency (MAF) below 5% and samples with an individual genotype call rate below 80%. Finally, beagle (r1399) was used to autofill the genotypes to obtain high-quality genotype data.
[0125] After processing using the methods described above, 1,928,103, 1,964,653, and 1,513,322 mutation sites (including SNPs and Indels) were obtained in Dabai, Changbai, and Duroc, respectively.
[0126] 2. Genome-wide association study (GWAS) analysis and meta-analysis
[0127] (1) Genome-wide association analysis was performed on the phenotypic data after confounding correction using the Genome-wide Efficient Mixed Model Association algorithm (GEMMA v0.98.1). Specifically:
[0128] ① Phenotypic processing: This invention uses the lm() function in R language to perform simple linear regression on gender and batch number, and the corrected residuals are used as the phenotypes for the final association analysis.
[0129] ② The analysis uses a univariate linear mixed model (ULMM) for statistical inference, and its mathematical expression is constructed as follows:
[0130]
[0131] Where y represents the n-dimensional vector of the phenotype to be analyzed (quantitative trait or binary vector), which in this study is the content of IMP or GMP; W represents a matrix consisting of a column of "1"s (n×c dimensions); α is the vector of the effect and intercept of the corresponding covariate (c dimensions); x represents the vector of the genotype of the detection locus (n dimensions); β represents the vector of the magnitude of the effect of the detection locus; u indicates that the genotype follows a mean of 0 and a covariance-variance matrix of λτ. -1 The random effects vector (n-dimensional) of a K-multivariate normal distribution; ε indicates that it follows a mean of 0 and a covariance-variance matrix of τ. -1 The residual vector of In (n-dimensional). In two n-variable normal distributions, n represents the number of phenotypes, τ -1 Let represent the variance of the residuals, and λ represent the ratio of the variance of the random effects to the variance of the residuals; K represents the n×n kinship matrix, and In represents the n×n identity matrix; MVNn represents the n-dimensional multivariate normal distribution. To correct for multiple hypothesis testing, a genome-wide significance threshold of 0.05 / N (Bonferroni correction) is set, where N is the number of valid SNPs / Indels.
[0132] (2) Using the results of the above GWAS analysis, meta-analysis of IMP and GMP content in the three groups was performed in METAL software. The meta-analysis was based on the standard error weighting method (SCHEME STDERR).
[0133] This invention is based on GWAS analysis ( Figure 1 and Figure 2 A total of 15 representative SNP loci were obtained (including those obtained from meta-analysis), and their basic genetic parameters are shown in Table 2. The names of the representative SNP loci were obtained from the sus_scrofa.vcf.gz file downloaded from the NCBI database using bcftools software. If the website did not have the SNP name information for that locus, the SNP name was represented in the form of "chromosome_location". Other important genetic parameters for each representative locus were provided by GWAS analysis using GEMMA software, including the chromosome and location of the locus, alleles, effect size, and p-value (Wald test).
[0134] Table 2. Basic genetic parameters of 15 representative SNP markers
[0135]
[0136] Note: The meta-analysis integrates genome-wide association study data from three pig breeds: Duroc, Landrace, and Large White.
[0137] 3. Analysis of differences in IMP and GMP content phenotypes among different genotypes
[0138] Genotypes at displayed molecular marker sites in each of the 497 pigs from three populations were extracted from sequencing files using Plink (v1.9). After counting the number of individuals with each genotype, the genotypes of these individuals were correlated with their corresponding IMP or GMP contents. Then, the `summarise` function in the `dplyr` package of R was used to statistically analyze the differences in phenotypic distribution among different genotypes. The results are shown in Table 3 and... Figure 3 As shown in the figure. The p-value is obtained from the variance test.
[0139] Table 3. Effects of each molecular marker site on IMP or GMP (unit: mg / 100g)
[0140]
[0141] 4. Heritability analysis
[0142] Heritability is one of the most important fundamental genetic parameters in quantitative genetics, and it can be divided into broad-sense heritability, narrow-sense heritability, and realized heritability. In the breeding process, heritability generally refers to narrow-sense heritability (h0). 2 ), which refers to the proportion of the variance in quantitative trait breeding values to the variance in phenotypic values, is the additive effect portion after eliminating dominant and epistatic effects, and is stably inherited during generational transmission. This invention estimates single-marker heritability based on the effect value (β) and its standard error (SE) of each locus in the GWAS results file from step 3 above, and takes their mean as the approximate narrow-sense heritability at the whole-genome level. The specific calculation formula is as follows:
[0143]
[0144] Where β is the regression coefficient of a single SNP site, and SE is its corresponding standard error.
[0145] Table 4 shows the heritability analysis results of IMP and GMP content in the three populations. The heritability distribution of IMP content in the three populations ranged from 0.327 to 0.356, and the heritability distribution of GMP content ranged from 0.351 to 0.362.
[0146] Table 4. Heritability estimates of IMP and GMP content in the three populations (h 2 )
[0147]
[0148] Example 3
[0149] This embodiment provides a specific method and process for detecting SNP markers in Embodiment 2. Specifically, taking SNP markers rs324388776, rs694510214, and 12_30398438 as examples, their corresponding pig breeds are Landrace, Landrace, and Large White, respectively, and their corresponding traits are IMP, GMP, and GMP, respectively. The specific method is as follows:
[0150] 1. Primer design
[0151] (1) The target fragment containing SNP sites that are significantly associated with IMP content in American Landrace pigs is a 510 bp nucleotide sequence from chromosome 14 (SEQ ID NO:1). The upstream and downstream primers for sequence amplification are primer-F1 and primer-R1, and their nucleic acid sequences are as follows:
[0152] Upstream primer-F1: 5'-TCCTCCTCTCCCTGCAAGAG-3' (SEQ ID NO:4);
[0153] Downstream primer primer-R1: 5'-CGTGGGTCAGCTGCTTATCT-3' (SEQ ID NO:5).
[0154] (2) The target fragment containing SNP sites significantly associated with GMP content in American Landrace pigs is a 153 bp nucleotide sequence from chromosome 13 (SEQ ID NO:2). The upstream and downstream primers for sequence amplification are primer-F2 and primer-R2, and their nucleic acid sequences are as follows:
[0155] Upstream primer-F2: 5'-AGTTATCACACTGGAAAGGGGG-3' (SEQ ID NO:6);
[0156] Downstream primer primer-R2: 5'-CCTCTCTCTAATCTCCAGCCC-3' (SEQ ID NO:7).
[0157] (3) The target fragment containing SNP sites significantly associated with GMP content in American Large White pigs is a 515 bp nucleotide sequence from chromosome 12 (SEQ ID NO:3). The upstream and downstream primers for sequence amplification are primer-F3 and primer-R3, and their nucleic acid sequences are as follows:
[0158] Upstream primer-F3: 5'-TGATGGGGTTGTTTGCTTTTT-3' (SEQ ID NO:8);
[0159] Downstream primer primer-R3: 5'-AGTGGAACAGGATAGAAAACCCA-3' (SEQ ID NO:9).
[0160] 2. PCR amplification
[0161] Add 1 μL of the DNA template to be tested, 3.4 μL of double-distilled water, 5 μL of 2×Taq PCR StarMixwith Loading Dye, and 0.3 μL each of forward and reverse primers to a 10 μL reaction system. The PCR reaction conditions are as follows: 94℃ pre-denaturation for 5 min, followed by 94℃ denaturation for 30 s, 55-65℃ annealing for 30 s, and 72℃ extension for 45 s, for 35 cycles, and a final extension at 72℃ for 5 min.
[0162] 3. DNA sequencing
[0163] DNA sequence sequencing and identification: Performed at BGI Genomics Co., Ltd. in Shenzhen, the gene fragments were sequenced using both forward and reverse reactions. The obtained sequences were compared with the NCBI genome sequence to identify mutations at corresponding SNP sites.
[0164] SEQ ID No. 1 (chr14:23634389-23634899):
[0165] TCCTCCTCTCCCTGCAAGAGGCGGCATCCTCACCACCATCCTCACCACTGTCGTCGCCACCACCATCGCCGTCAGTATTGTCATCACCACCGTCACGTCCTCACCCCTGTCGTCACCCTCATCCCCAGCAGCAGCAGCAGCACCGTCATACTTATCACCAGATGATCATTATCGCCACCACCGTCACCACCACCGTCATCACTGTCATCACCACCATCATCGAGGGCTGTGGTGGCCCGTGGGCAAGATGC M (G > A)CTCACACCAGGGACCAGGAACCTCGTCCCCTCGGCCTTCAGCCCGCGTCCCTCCACTCATCCTGAGGTCAAAGGTCACCACCATCACCATGCTCAGCAGCAGCATCACCAGCATCATCCCTATTTCACAGCTGAGGAAGCCCAGCCACAGGGAACTATGTGATTGCCCCACGGTAAAGACACTACATTTCTCCGAAGCTCACAATTCCCCCTTTCCCCTGAGTCCTTCTGGGCCCAGATAAGCAGCTGACCCACG
[0166] SEQ ID No. 2(chr13:195476711-1954776864):
[0167] AGTTATCACACTGGAAAGGGGGCA M (C > T) GTGGTTCCCCAGGAGGCCTGCCAAGGAGGTCCTGGAACCCAGGTTTGAGGCCTCCAACTGGTCACCTAGATGCAGCCTATACAAAACATCAGAGAGGCTGAGAAGAGGGGCTGGAGATTAGAGAGAGG
[0168] SEQ ID No. 3(chr12:30421812-30422327):
[0169] TGATGGGGTTGTTTGCTTTTTTGGTATTGAGCTGCAGAAGGCATTTATAGATTTTTGGAGATTAATCTCTTGTCAGTTGCTTCATTTGCAAATGTTTTCTCCAATTCTGTGGGTTGTCTCTTTGTTTTGTTTAGGGTTTCCTTTGCTGTGCAGAAACTTTTGAGTTTAATTAAGTCCCACTTGTCTATTTTTGTTTTTACTGTCATTACTGTAGGAGGTGGATCTTAGAAGATGTTGCTGTCATTTATGTTGGAGAGTGTT M (C > T)GGCTTATGATTTCCTCTAAGAGTTTTAGAGTGTATGGTATTATATCTAGGTCTTTAATCCATTCTGAGTTTATTTTTGTGTATGGTGTTAGGAAGTGTTCTAATTTCATTCTTTTACATGTGGCTA TCCAGTTTTCCCACCACCACTTATTGAAGGGGCTGTCTTCTTCATTGTATCTTCTTGCCTCCATTTTCATAGATTAGTTAACTGTAGGAGCATGGTTTTAATTCTGGGTTTTCTATCCTGTTCCACT
[0170] Note: M marked in the sequence is the mutation site, indicated by an underline (the mutated base in parentheses represents the allele mutation). The primer binding position is indicated by bolding at the beginning and end of the sequence.
[0171] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. The use of a SNP site affecting the IMP or GMP content of a pig in the identification of the IMP, GMP content of a pig or pork, or the genetic breeding of the IMP, GMP content of a pig, characterized in that The SNP site comprises at least one of the following: (I) the SNP site corresponds to a G>A mutation at position 23634644 on chromosome 14 in the international pig genome version 11.1; (II) the SNP site corresponds to a G>A mutation at position 61539869 on chromosome 5 in the international pig genome version 11.1; (III) the SNP site corresponds to a C>T mutation at position 73318431 on chromosome 6 in the international pig genome version 11.1; (IV) the SNP site corresponds to an AT>A mutation at position 9931110 on chromosome 15 in the international pig genome version 11.1; (V) the SNP site corresponds to an A>G mutation at position 7924927 on chromosome 15 in the international pig genome version 11.1; (VI) the SNP site corresponds to a G>A mutation at position 73963573 on chromosome 7 in the international pig genome version 11.1; (VII) the SNP site corresponds to a T>C mutation at position 49824761 on chromosome 15 in the international pig genome version 11.1; (VIII) the SNP site corresponds to a T>C mutation at position 195476736 on chromosome 13 in the international pig genome version 11.1; (IX) the SNP site corresponds to an A>C mutation at position 122321344 on chromosome 8 in the international pig genome version 11.1; (X) the SNP site corresponds to an A>G mutation at position 122335895 on chromosome 8 in the international pig genome version 11.1; (XI) the SNP site corresponds to a C>T mutation at position 30422074 on chromosome 12 in the international pig genome version 11.1; (XII) the SNP site corresponds to an A>G mutation at position 30398438 on chromosome 12 in the international pig genome version 11.1; (XIII) the SNP site corresponds to a GTCACACACAC>G mutation at position 7723118 on chromosome 2 in the international pig genome version 11.1; (XIV) the SNP site corresponds to an A>T mutation at position 34106157 on chromosome 6 in the international pig genome version 11.1; For (I)-(III), the pig is a US long white pig, and the corresponding trait is IMP content; For (IV)-(V), the pig is a US large white pig, and the corresponding trait is IMP content; For (VI)-(VII), the pig is a US Duroc pig, and the corresponding trait is GMP content; For (VIII)-(X), the pig is a US long white pig, and the corresponding trait is GMP content; For (XI)-(XIV), the pig is a US large white pig, and the corresponding trait is GMP content.
2. The use according to claim 1, characterized in that: For (I), the SNP site is M in the nucleotide sequence shown as SEQ ID NO: 1, and the base is G or A; For (VIII), the SNP site is M in the nucleotide sequence shown as SEQ ID NO: 2, and the base is T or C; For (XI), the SNP site is M in the nucleotide sequence as shown in SEQ ID NO: 3, and the base is C or T.
3. The use of a primer combination for detecting a SNP site affecting the IMP or GMP content of a pig in identifying the IMP, GMP content of a pig or pork, or the genetic breeding of the IMP, GMP content of a pig, characterized in that The primer combination comprises at least one of primer pair primer-F1 and primer-R1, primer pair primer-F2 and primer-R2, and primer pair primer-F3 and primer-R3, and the nucleotide sequences thereof are as shown in SEQ ID NO: 4-9; The SNP site is the SNP site (I), (VIII) or (XI) as defined in claim 1; For (I), the pig is a US long white pig, and the corresponding trait is IMP content; For (VIII), the pig is a US long white pig, and the corresponding trait is GMP content; For (XI), the pig is a US large white pig, and the corresponding trait is GMP content.
4. Use of a kit for detecting SNP sites affecting IMP or GMP content in pigs in identifying IMP, GMP content in pigs or pork, or in the genetic breeding of IMP, GMP content in pigs, characterized in that The kit comprises the primer combination as defined in claim 3; The SNP site is the SNP site (I), (VIII) or (XI) as defined in claim 1; For (I), the pig is a US long white pig, and the corresponding trait is IMP content; For (VIII), the pig is a US long white pig, and the corresponding trait is GMP content; For (XI), the pig is a US large white pig, and the corresponding trait is GMP content.
5. A method of genetic improvement of swine, characterized in that Comprising the following steps: determining the genotype of the SNP site as defined in claim 1 or 2 for the breeding pigs in the breeding pig core group, and making a corresponding selection according to the genotype of the SNP site: For (I), selecting a breeding pig individual with G / G genotype at position 23634644 on chromosome 14 in the international pig genome version 11.1 for the breeding pig core group, and eliminating a breeding pig individual with G / A genotype, so as to increase the frequency of allele G at this site generation by generation; For (II), selecting a breeding pig individual with A / A or G / A genotype at position 61539869 on chromosome 5 in the international pig genome version 11.1 for the breeding pig core group, and eliminating a breeding pig individual with G / G genotype, so as to increase the frequency of allele A at this site generation by generation; For (III), selecting a breeding pig individual with C / C genotype at position 73318431 on chromosome 6 in the international pig genome version 11.1 for the breeding pig core group, and eliminating a breeding pig individual with C / T or T / T genotype, so as to increase the frequency of allele C at this site generation by generation; For (IV), selecting a breeding pig individual with AT / AT or AT / A genotype at position 9931110 on chromosome 15 in the international pig genome version 11.1 for the breeding pig core group, and eliminating a breeding pig individual with A / A genotype, so as to increase the frequency of allele AT at this site generation by generation; For (V), selecting a breeding pig individual with A / A genotype at position 7924927 on chromosome 15 in the international pig genome version 11.1 for the breeding pig core group, and eliminating a breeding pig individual with A / G or G / G genotype, so as to increase the frequency of allele A at this site generation by generation; For (VI), selecting from the core group of breeding pigs, breeding pigs having A / A genotype at position 73963573 on chromosome 7 of the International Pig Genome 11.1 version, and eliminating breeding pigs having G / A or G / G genotype, so as to increase the frequency of allele A at the locus generation by generation; For (VII), selecting from the core group of breeding pigs, breeding pigs having T / T or T / C genotype at position 49824761 on chromosome 15 of the International Pig Genome 11.1 version, and eliminating breeding pigs having C / C genotype, so as to increase the frequency of allele T at the locus generation by generation; For (VIII), selecting from the core group of breeding pigs, breeding pigs having T / T or T / C genotype at position 195476736 on chromosome 13 of the International Pig Genome 11.1 version, and eliminating breeding pigs having C / C genotype, so as to increase the frequency of allele T at the locus generation by generation; For (IX), selecting from the core group of breeding pigs, breeding pigs having A / C or C / C genotype at position 122321344 on chromosome 8 of the International Pig Genome 11.1 version, and eliminating breeding pigs having A / A genotype, so as to increase the frequency of allele C at the locus generation by generation; For (X), selecting from the core group of breeding pigs, breeding pigs having A / G or G / G genotype at position 122335895 on chromosome 8 of the International Pig Genome 11.1 version, and eliminating breeding pigs having A / A genotype, so as to increase the frequency of allele G at the locus generation by generation; For (XI), selecting from the core group of breeding pigs, breeding pigs having C / T or C / C genotype at position 30422074 on chromosome 12 of the International Pig Genome 11.1 version, and eliminating breeding pigs having T / T genotype, so as to increase the frequency of allele C at the locus generation by generation; For (XII), selecting from the core group of breeding pigs, breeding pigs having A / G or A / A genotype at position 30398438 on chromosome 12 of the International Pig Genome 11.1 version, and eliminating breeding pigs having G / G genotype, so as to increase the frequency of allele A at the locus generation by generation; For (XIII), selecting from the core group of breeding pigs, breeding pigs having GTCACACACAC / GTCACACACAC genotype at position 7723118 on chromosome 2 of the International Pig Genome 11.1 version, and eliminating breeding pigs having GTCACACACAC / G or G / G genotype, so as to increase the frequency of allele GTCACACACAC at the locus generation by generation; For (XIV), selecting from the core group of breeding pigs, breeding pigs having A / T or T / T genotype at position 34106157 on chromosome 6 of the International Pig Genome 11.1 version, and eliminating breeding pigs having A / A genotype, so as to increase the frequency of allele T at the locus generation by generation; For (I)-(III), the pigs are American Landrace pigs, and the corresponding traits are IMP content; For (IV)-(V), the pigs are American Large White pigs, and the corresponding traits are IMP content; For (VI)-(VII), the pig is a Duroc pig, and the corresponding trait is GMP content; For (VIII)-(X), the pig is a Landrace pig, and the corresponding trait is GMP content; For (XI)-(XIV), the pig is a Yorkshire pig, and the corresponding trait is GMP content.
6. A method for identifying the IMP, GMP content of a pig or pork, characterized in that comprising the following steps: determining the genotype of the pig or pork at the SNP site as recited in claim 1 or 2, and judging the IMP, GMP content of the pig or pork according to the genotype of the SNP site: For (I), the IMP content of the pig or pork from high to low is ordered by the genotype at position 23634644 on chromosome 14 of the international pig genome version 11.1, in turn: G / G genotype, G / A genotype; For (II), the IMP content of the pig or pork from high to low is ordered by the genotype at position 61539869 on chromosome 5 of the international pig genome version 11.1, in turn: A / A genotype, G / A genotype and G / G genotype; For (III), the IMP content of the pig or pork from high to low is ordered by the genotype at position 73318431 on chromosome 6 of the international pig genome version 11.1, in turn: C / C genotype, C / T genotype and T / T genotype; For (IV), the IMP content of the pig or pork from high to low is ordered by the genotype at position 9931110 on chromosome 15 of the international pig genome version 11.1, in turn: AT / AT genotype, AT / A genotype and A / A genotype; For (V), the IMP content of the pig or pork from high to low is ordered by the genotype at position 7924927 on chromosome 15 of the international pig genome version 11.1, in turn: A / A genotype, A / G genotype and G / G genotype; For (VI), the GMP content of the pig or pork from high to low is ordered by the genotype at position 73963573 on chromosome 7 of the international pig genome version 11.1, in turn: A / A genotype, G / A genotype and G / G genotype; For (VII), the GMP content of the pig or pork from high to low is ordered by the genotype at position 49824761 on chromosome 15 of the international pig genome version 11.1, in turn: T / T genotype, T / C genotype and C / C genotype; For (VIII), the GMP content of the pig or pork from high to low is ordered by the genotype at position 195476736 on chromosome 13 of the international pig genome version 11.1, in turn: T / T genotype, T / C genotype and C / C genotype; For (IX), the GMP content of the pig or pork from high to low is ordered by the genotype at position 122321344 on chromosome 8 of the international pig genome version 11.1, in turn: C / C genotype, A / C genotype and A / A genotype; For (X), the pig or pork GMP content from high to low is sorted by the genotype at position 122335895 on chromosome 8 of the international pig genome version 11.1, in turn: G / G genotype, A / G genotype and A / A genotype; For (XI), the pig or pork GMP content from high to low is sorted by the genotype at position 30422074 on chromosome 12 of the international pig genome version 11.1, in turn: C / C genotype, C / T genotype and T / T genotype; For (XII), the pig or pork GMP content from high to low is sorted by the genotype at position 30398438 on chromosome 12 of the international pig genome version 11.1, in turn: A / A genotype, A / G genotype and G / G genotype; For (XIII), the pig or pork GMP content from high to low is sorted by the genotype at position 7723118 on chromosome 2 of the international pig genome version 11.1, in turn: GTCACACACAC / GTCACACACAC genotype, GTCACACACAC / G genotype and G / G genotype; For (XIV), the pig or pork GMP content from high to low is sorted by the genotype at position 34106157 on chromosome 6 of the international pig genome version 11.1, in turn: T / T genotype, A / T genotype and A / A genotype; For (I)-(III), the pig is American Landrace, and the corresponding trait is IMP content; For (IV)-(V), the pig is American Large White, and the corresponding trait is IMP content; For (VI)-(VII), the pig is American Duroc, and the corresponding trait is GMP content; For (VIII)-(X), the pig is American Landrace, and the corresponding trait is GMP content; For (XI)-(XIV), the pig is American Large White, and the corresponding trait is GMP content.
Citation Information
Patent Citations
Molecular marker related to pork color, detection method, detection kit and application
CN113186305A
SNP (Single Nucleotide Polymorphism) molecular marker for influencing porcine skeletal muscle fiber type composition percentage and application of SNP molecular marker
CN115369175A