A fluorescent RPA detection kit and its application method for detecting Ichthyophthirius multifiliis.

Abstract

This invention belongs to the field of agricultural and aquatic organism detection technology, specifically relating to a fluorescent RPA detection kit and its application method for detecting Ichthyophthirius multifiliis. Compared to traditional PCR technology, the detection kit and method of this invention significantly simplify the operation steps. Furthermore, after RPA amplification, the results can be directly interpreted through real-time fluorescence signals, eliminating the need for subsequent analysis operations such as opening the lid or electrophoresis. This avoids cross-contamination between different amplification products and reduces false positive results, greatly improving detection efficiency and accuracy. In aquaculture, this innovative RPA kit will significantly enhance the rapid on-site detection capability of Ichthyophthirius multifiliis, providing an efficient, simple, low-cost solution that does not require cold chain transportation, meeting the urgent need of modern aquaculture for rapid and accurate pathogen detection.

Description

Technical Field

[0001] This invention belongs to the field of agricultural and aquatic organism detection technology, specifically relating to a fluorescent RPA detection kit and its application method for detecting Ichthyophthirius multifiliis. Background Technology

[0002] Ichthyophthirius multifiliis (Ichthyophthirius multifiliis) Ichthyophthirius multifiliis Ichthyophthirius multifiliis (Ich) is a widely distributed parasite in freshwater bodies, primarily infesting the gills, fins, and skin of fish. It is highly pathogenic, causing Ichthyophthirius multifiliis disease (commonly known as "white spot disease") in freshwater fish. Infection with this parasite leads to the appearance of typical white granules on the gills and body surface of fish, and in severe cases, can result in death. According to existing research, traditional detection methods include microscopic examination and direct observation of pathological symptoms in fish; however, these methods typically suffer from drawbacks such as complex operation, poor detection sensitivity, and delayed results.

[0003] The methods described in Jinan University's patent CN 115181803 B, "Taqman probe qPCR detection primer set and application for detecting Ichthyophthirius multifiliis," and the Fuzhou Municipal Marine and Fisheries Technology Center's patent CN 118028506 A, "A fluorescent quantitative PCR detection kit for Ichthyophthirius multifiliis from goldfish using a dual TaqMan probe method," require approximately one hour to complete the detection, while the method of this invention can complete the detection within 20 minutes. Furthermore, the reagents used in this method are lyophilized and do not require cold chain transportation or low-temperature storage.

[0004] The patent CN 115807112 A of the Institute of Hydrobiology, Chinese Academy of Sciences, entitled "A primer set for identification and quantitative detection of Ichthyophthirius multifiliis and its application", is costly and has a narrow application range, with most applications being in laboratories.

[0005] The patent CN 105524996 A of the Chinese Sturgeon Research Institute of China Three Gorges Corporation, entitled "A method for rapid detection of Ichthyophthirius multifiliis in water", states that conventional PCR is complex, has low sensitivity, and is prone to aerosol contamination.

[0006] The patent CN 118755845 A of Zhejiang Freshwater Fisheries Research Institute, entitled "LAMP-LFD primer and probe set, kit and application for detecting Ichthyophthirius multifiliis", has certain advantages in field application, but there is still room for improvement in terms of specificity. Non-specific amplification may occur in some cases, affecting the accuracy of the detection results.

[0007] Existing methods for detecting Ichthyophthirius multifiliis, including TaqMan probe qPCR, dual TaqMan probe-based quantitative PCR, ddPCR, conventional PCR, and LAMP, while improving detection sensitivity to some extent, still generally have some shortcomings and challenges:

[0008] Insufficient sensitivity: Although PCR methods can improve sensitivity, impurities and inhibitors in the sample may affect the test results, leading to false negatives.

[0009] Complex operation: Traditional molecular detection methods, such as real-time fluorescence PCR, usually require expensive equipment and complex experimental procedures, making them unsuitable for rapid on-site detection.

[0010] Long time: The amplification process of PCR methods usually takes a long time, while methods such as LAMP are also difficult to operate and the amplification is incomplete, resulting in low detection efficiency.

[0011] Furthermore, these reagents require cold chain transportation and low-temperature storage. Their detection techniques still rely on strict cold chain transportation and low-temperature storage conditions.

[0012] Therefore, existing technologies still have many shortcomings in the detection of Ichthyophthirius multifiliis. There is an urgent need for an efficient, rapid, and simple detection method that also has high sensitivity and high specificity to meet the actual needs of rapid detection in aquaculture sites and to overcome the limitations of existing technologies in cold chain transportation and low-temperature preservation. Summary of the Invention

[0013] The purpose of this invention is to address existing problems by providing a fluorescent RPA detection kit and application method for detecting Ichthyophthirius multifiliis.

[0014] This invention is achieved through the following technical solution:

[0015] A fluorescent RPA detection kit for detecting Ichthyophthirius multifiliis, the kit comprising RPA lyophilized microspheres Mix, positive control, and negative control;

[0016] Among them, RPA freeze-dried microspheres Mix is ​​a freeze-dried spherical solid containing an oligonucleotide upstream primer, an oligonucleotide downstream primer, and an RPA oligonucleotide fluorescent probe designed based on the conserved region of the 18S rRNA gene of Ichthyophthirius multifiliis.

[0017] The upstream primer sequence of the oligonucleotide is shown in SEQ ID NO.1, the downstream primer sequence of the oligonucleotide is shown in SEQ ID NO.2, and the RPA oligonucleotide fluorescent probe is obtained by modifying and labeling the nucleotide sequence shown in SEQ ID NO.3.

[0018] Furthermore, the positive control is a lyophilized powder prepared from a recombinant plasmid containing a conserved target sequence of the Ichthyophthirius multifiliis 18S rRNA gene, the target sequence being shown in SEQ ID NO.4.

[0019] Furthermore, the negative control is Nuclease-Free Water.

[0020] Furthermore, the modification mark specifically refers to: C3 Spacer blocking modification at the 3' end, and the 31st base is [FAM-dT], the 32nd base is [THF], and the 33rd base is [BHQ1-dT].

[0021] SEQ ID NO.1:

[0022] 5'-GTCATCAGCTTGCGTTGATTATGTCCCTGCCGTTTGTACACA-3'

[0023] SEQ ID NO.2:

[0024] 5'-GCAGGTTCACCTACAGATACCTTGTTACGACTTCTTGTTGTTCC-3'

[0025] SEQ ID NO.3:

[0026] 5'-GCTTGTAGTAACGAATGGTCTGGTGAACCTTCTGGACCGAGGTCGCAAG-3'

[0027] SEQ ID NO.4:

[0028] 5'-GTCATCAGCTTGCGTTGATTATGTCCCTGCCGTTTGTACACACCGCCCCGTCGCTTGTAGTAACGAATGGTCTGGTGAACCTTCTGGACCGAGGTCGCAAGGCTTTGGGAAGTTAAGTAAACCCTACCATTTGGAACAACAAGAAGTCGTAACAAGGTATCTGTAGGTGAACCTGC-3'

[0029] A highly sensitive detection method for Ichthyophthirius multifiliis includes the following steps:

[0030] 1) Collect fish tissue samples;

[0031] 2) Extract DNA from fish tissue samples using a commercial DNA extraction kit and follow the kit instructions. Finally, collect the DNA solution and perform the analysis directly or store it at -20°C.

[0032] 3) Fluorescent RPA amplification was performed using the fluorescent RPA detection kit described above for detecting Ichthyophthirius multifiliis;

[0033] 4) Determine whether there is Ichthyophthirius multifiliis in the fish tissue sample based on the fluorescence signal value.

[0034] Furthermore, the fish tissue is gills, fin rays, or skin.

[0035] The present invention has the following advantages over the prior art:

[0036] 1. This invention provides a method for treating Ichthyophthirius multifiliis (Ichthyophthirius multifiliis) based on fluorescent RPA technology. Ichthyophthirius multifiliis Compared to traditional PCR technology, this invention significantly simplifies the operation process of the detection kit. Results can be directly interpreted via real-time fluorescence signals after amplification, eliminating the need for opening the kit or subsequent experimental processing such as electrophoresis. This avoids cross-contamination between different amplification products and reduces false positive results. This innovative method overcomes the shortcomings of traditional kits, such as low sensitivity and poor reproducibility, resulting in more accurate and reliable detection results.

[0037] 2. The core component of the kit of the present invention is RPA lyophilized microsphere Mix, which contains a variety of amplification-required components and optimized additives, including upstream primers (50–500 mM), downstream primers (50–500 mM), and fluorescent probes (25–250 mM) designed for the conserved region of the 18S rRNA gene of Ichthyophthirius multifiliis. The T bases in the fluorescent probes are modified by fluorescent luminescent groups (such as FAM, VIC, HEX, JOE, ROX, Texas-Red, or Cy5) and fluorescent quenching groups (such as DABCYL, DABSYL, TAMRA, BHQ-1, BHQ-2, BHQ-3), respectively, and tetrahydrofuran (THF) is introduced between them to improve probe performance.

[0038] The RPA lyophilized microsphere mix also contains recombinase (10–100 ng / μL), strand displacement DNA polymerase (1–10 U), single-stranded DNA binding protein (10–100 ng / μL), and Exonuclease III (10–30 U) to achieve efficient nucleic acid amplification under isothermal conditions. To improve reaction efficiency and specificity, Tris-HCl buffer (pH 8.0, 10–100 mM), U-containing dNTPs (10–50 mM), KCl (100 mM–1 M), Tween-20 (0.01–0.1% (V / V)), Betaine (5–50 mM), DMSO (0.01–0.1% (V / V)), and X-1000 (0.01–0.5% (V / V)) are added to the system.

[0039] In particular, the RPA freeze-dried microspheres Mix of this invention contains freeze-drying protectants, such as trehalose, sucrose and mannitol, with a total concentration ranging from 5 to 15% (W / V), which are used to stabilize the activity and structure of primers, enzymes and other active components during freeze-drying and long-term storage, and significantly extend the shelf life of the product.

[0040] All the above components are mixed to form lyophilized microspheres, which are then placed at the bottom of a 0.2 mL PCR tube. The activator (20 mM magnesium acetate solution), after lyophilization, is placed on top of the microspheres. For detection, simply add the sample DNA to the reaction tube (add enzyme-free water if the volume is insufficient) to directly initiate the amplification reaction; no complicated procedures are required. This kit features high sensitivity and specificity, completing detection within 20 minutes. It requires no cold chain transportation and can be stored at room temperature for one year, greatly facilitating rapid detection applications in aquaculture.

[0041] 3. The kit of the present invention is effective against Ichthyophthirius multifiliis (Ichthyophthirius multifiliis). Ichthyophthirius multifiliis The detection of the 18S rRNA gene of *Ichthyophthirius multifiliis* is highly sensitive, with a detection limit as low as a single copy, ensuring a high detection rate for positive samples. Primers and probes are designed based on the conserved region of the 18S rRNA gene of *Ichthyophthirius multifiliis*, employing recombinase polymerase amplification (RPA) technology. Under isothermal conditions, the recombinase mediates efficient pairing of the primers with the target DNA, followed by polymerase extension along the 3' end of the primers for amplification. When the fluorescent probe, containing both fluorophores and quenchers, binds to the target DNA and is cleaved by Exonuclease III during amplification, the fluorophore and quencher separate, releasing a fluorescent signal. Only when the upstream primer, downstream primer, and fluorescent probe simultaneously and specifically bind to the sample DNA and successfully participate in the amplification reaction will the fluorescence intensity increase and an amplification curve appear, ensuring high detection specificity. The detection results are presented as fluorescence amplification curves, providing objective, direct, and clear results for rapid interpretation.

[0042] 4. The freeze-dried reagent kit of this invention can be stored at room temperature for up to one year. This feature avoids the strict requirements of traditional reagent kits for cold chain transportation and low-temperature storage, significantly reducing logistics costs and transportation difficulties, and meeting the rapid detection needs in the aquaculture industry. In the aquaculture industry, this innovative RPA reagent kit will greatly improve the on-site rapid detection capability of Ichthyophthirius multifiliis, providing an efficient, simple, low-cost solution that does not require cold chain transportation, meeting the urgent need of modern aquaculture for rapid and accurate pathogen detection. Attached Figure Description

[0043] Figure 1 The multi-seeded Ichthyophthirius multifiliis (Ichthyophthirius multifiliis) provided in Experimental Example 1 of this invention Ichthyophthirius multifiliis Figure 1 shows the results of the sensitivity detection experiment of fluorescent RPA.

[0044] Figure 2 The multi-seeded Ichthyophthirius multifiliis provided in Experimental Example 2 of this invention ( Ichthyophthirius multifiliis Figure 1 shows the experimental results of the accuracy detection of fluorescent RPA.

[0045] Figure 3 The multi-seeded Ichthyophthirius multifiliis provided in Experimental Example 3 of this invention ( Ichthyophthirius multifiliis Figure 1 shows the experimental results of specific detection of fluorescent RPA.

[0046] Figure 4 This is a schematic diagram of the present invention;

[0047] Figure 5 The RPA freeze-dried microspheres of this invention are shown. Detailed Implementation

[0048] To further explain the present invention, the following specific embodiments are described.

[0049] Recombinase polymerase amplification (RPA) technology utilizes different enzymes to achieve rapid, isothermal amplification mediated by enzymes, reducing equipment requirements. In vitro nucleic acid amplification does not require heating; double-stranded DNA can be unwound under isothermal conditions, allowing for cyclic amplification. Under isothermal conditions, target genes can be amplified efficiently, rapidly, specifically, and sensitively. Gel electrophoresis is also unnecessary for observing results, reducing the risk of environmental contamination. Amplification can typically be completed within 20 minutes. Currently, this technology is widely used in animal disease diagnosis, pathogen detection and identification, food safety testing, biosafety testing, genetically modified crops, and environmental monitoring, and plays an important role in human medicine. In aquaculture pathogen detection, it has been used for rapid detection of shrimp white spot syndrome virus, carp spring virus, koi herpesvirus, Schistosoma japonicum, Vibrio mimicus, luminescent bacteria of mermaids, and sulfonamide resistance genes, but there are no reports of using RPA for the detection of Ichthyophthirius multifiliis.

[0050] Addressing the limitations of existing methods for detecting Ichthyophthirius multifiliis (white spot disease), such as insufficient sensitivity, complex operation, long detection time, and the need for cold chain transportation and cryopreservation, this invention develops an innovative lyophilized recombinase polymerase amplification (RPA) kit for the rapid detection of Ichthyophthirius multifiliis. Ichthyophthirius multifiliisThis kit utilizes RPA technology, which achieves rapid nucleic acid amplification at isothermal conditions through the different actions of enzymes. Compared with traditional PCR technology, RPA has significant advantages. It completes the denaturation and amplification of double-stranded DNA under isothermal conditions without heating, avoiding the equipment requirements of high-temperature cycling processes, reducing equipment dependence on operation, and making the detection process simpler and more efficient.

[0051] Example 1: A multi-seed Ichthyophthirius multifiliis based on fluorescent RPA (Ichthyophthirius multifiliis) Ichthyophthirius multifiliis The test kit consists of three components: RPA lyophilized microspheres Mix, positive control, and negative control.

[0052] The RPA lyophilized microsphere mix is ​​the core component of the reaction system for the detection method involved in this invention, containing primers and probes, recombinase (10–100 ng / μL), strand displacement DNA polymerase (1–10 U), and single-stranded DNA binding protein (10–100 ng / μL). Other substrate mixtures required for RPA amplification are lyophilized. The activator (20 mM magnesium acetate solution) is also lyophilized separately. These lyophilized microspheres are packaged in 0.2 mL PCR tubes as a complete RPA lyophilized microsphere mix. For detection, simply add sample DNA to the reaction tube (if the sample DNA volume is insufficient, add nuclease-free water) for amplification. This design simplifies the operation process, eliminating the need for other complex processing steps and improving experimental efficiency and ease of use.

[0053] The components of RPA lyophilized microspheres Mix include:

[0054] Upstream primers (50–500 mM), downstream primers (50–500 mM), and fluorescent probes (25–250 mM) were designed targeting the conserved region of the 18S rRNA gene of Ichthyophthirius multifiliis. The T bases in the fluorescent probes were modified with fluorescent luminescent groups (such as FAM, VIC, HEX, JOE, ROX, Texas-Red, or Cy5) and fluorescent quenching groups (such as DABCYL, DABSYL, TAMRA, BHQ-1, BHQ-2, and BHQ-3), respectively. Tetrahydrofuran (THF) was introduced between the two to improve the probe performance.

[0055] The RPA lyophilized microsphere mix also contains recombinase (10–100 ng / μL), strand displacement DNA polymerase (1–10 U), single-stranded DNA binding protein (10–100 ng / μL), and Exonuclease III (10–30 U) to achieve efficient nucleic acid amplification under isothermal conditions. To improve reaction efficiency and specificity, Tris-HCl buffer (pH 8.0, 10–100 mM), dNTPs containing U (10–50 mM), KCl (100 mM–1 M), Tween-20 (0.01–0.1% (V / V)), Betaine (5–50 mM), DMSO (0.01–0.1% (V / V)), and X-1000 (0.01–0.5% (V / V)) are added to the system.

[0056] Notably, the RPA lyophilized microspheres Mix contains lyophilization protectants such as trehalose, sucrose, and mannitol, with a total concentration ranging from 5% to 15% (W / V).

[0057] All the above components were mixed to prepare lyophilized microspheres and placed at the bottom of a 0.2 mL PCR tube. The activator (20 mM magnesium acetate solution) was lyophilized and placed on top of the microspheres.

[0058] Positive control samples:

[0059] The positive control in the kit is a lyophilized powder of a plasmid synthesized from the target gene sequence of Ichthyophthirius multifiliis.

[0060] Negative control samples:

[0061] Nuclease-Free Water.

[0062] The reaction system of the kit is as follows:

[0063]

[0064] Example 2: A highly sensitive detection method for Ichthyophthirius multifiliis, comprising the following steps:

[0065] 1) Sample type:

[0066] Collect fish gill tissue samples;

[0067] 2) Nucleic acid extraction:

[0068] Commercial DNA extraction kits, such as nucleic acid extraction reagents based on silica membrane centrifugation column method or nucleic acid extraction reagents based on magnetic bead method, were used. The kits were operated according to the instructions. Finally, 100 μL of nucleic acid solution was collected and directly tested, or stored at -20℃.

[0069] 3) Sample addition:

[0070] Add 5-25 μL of sample DNA solution to a 0.2 mL PCR tube containing RPA lyophilized microspheres (if the sample volume is insufficient, it can be supplemented with Nuclease-Free Water), tighten the cap, wait 1-2 s for the lyophilized microspheres to dissolve, vortex to mix, centrifuge to collect the solution and place it at the bottom of the tube.

[0071] 4) On-machine amplification and detection:

[0072] The settings for the RPA amplification program analysis procedure are shown in Table 1:

[0073] Table 1

[0074]

[0075] 5) Results Analysis

[0076] The pathogen was detected, and the results are shown in Table 2.

[0077] Table 2

[0078]

[0079] Experimental Example 1: Detection sensitivity of the kit of the present invention:

[0080] Using Nanodrop and Qubit to target known polyspermae (Ichthyophthirius multifiliis) Ichthyophthirius multifiliis The positive control sample was assigned a value, and the result was 1×10⁻⁶. 12 Copies / μL, with 8 concentration gradients set at 1×10⁻⁶. 6 copies / μL, 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 The results were measured at 5 copies / μL and 2.5 copies / μL to verify the sensitivity of the detection methods described in Examples 1 and 2 of this invention. Figure 1 As shown, the multi-seeded Ichthyophthirius multifiliis (Ichthyophthirius multifilii Ichthyophthirius multifiliis The fact that it can be accurately detected in simulated samples of 5 copies / μL indicates that the detection method of the present invention has high sensitivity.

[0081] Test Example 2: Detection accuracy of the kit of the present invention:

[0082] Using the known multi-seeded Ichthyophthirius multifiliis (Ichthyophthirius multifiliis Ichthyophthirius multifiliisPositive and negative nucleic acid samples were tested using the kit described in Example 1 and the method described in Example 2. The experimental results are as follows: Figure 2 As shown, the results indicate that this RPA system can detect the corresponding target. After RPA amplification, the accuracy of the detection results can be judged by reporting the fluorescence signal value. Figure 2 As can be seen, the positive detection rate is 100%, the negative concordance rate is 100%, there are no false positives or missed detections, and the test has high accuracy.

[0083] Experimental Example 3: Detection specificity of the kit of the present invention:

[0084] DNA from other non-target fish parasites (tryptophanths, pygmyzotis, iodophora, boudophora, tetrahymena) was used as specific detection samples. The kit described in Example 1 and the detection method described in Example 2 of this invention were used for detection. The detection results are as follows: Figure 3 As shown in the results, no non-specific amplification was observed, and no RPA amplification was observed, indicating that the kit has high specificity.

[0085] Experimental Example 4: Detection repeatability of the kit of the present invention:

[0086] Twenty DNA samples of Ichthyophthirius multifiliis with the same concentration were used as test samples. The kit described in Example 1 and the detection method described in Example 2 of this invention were used for detection. The detection results are shown in Table 3. The results showed high repeatability with CV < 5%.

[0087] Table 3

[0088]

[0089] Experimental Example 5: Detection stability of the kit of the present invention:

[0090] The positive plasmid of Ichthyophthirius multifiliis was used as the test sample, and the kit described in Example 1 and the detection method described in Example 2 of this invention were used for detection. The difference between the reagent that had been stored at room temperature for one year and the newly produced reagent was tested. The test results are shown in Table 4. The two were almost indistinguishable.

[0091] Table 4

[0092]

[0093] The above description is merely an exemplary description of the present invention and does not represent the entirety of the present invention. Without departing from the spirit and scope of the present invention, those skilled in the art can make various equivalent changes or substitutions to the above embodiments, and all such equivalent changes or substitutions should be included within the scope defined by the claims of the present invention.

Claims

1. A fluorescent RPA detection kit for detecting Ichthyophthirius multifiliis, characterized in that, The kit includes RPA lyophilized microspheres Mix, positive control, and negative control. Among them, RPA freeze-dried microspheres Mix is ​​a freeze-dried spherical solid containing an oligonucleotide upstream primer, an oligonucleotide downstream primer, and an RPA oligonucleotide fluorescent probe designed based on the conserved region of the 18S rRNA gene of Ichthyophthirius multifiliis. The upstream primer sequence of the oligonucleotide is shown in SEQ ID NO.1, the downstream primer sequence of the oligonucleotide is shown in SEQ ID NO.2, and the RPA oligonucleotide fluorescent probe is obtained by modifying and labeling the nucleotide sequence shown in SEQ ID NO.

3.

2. The fluorescent RPA detection kit for detecting Ichthyophthirius multifiliis according to claim 1, characterized in that, The positive control is a lyophilized powder prepared from a recombinant plasmid containing a conserved target sequence of the Ichthyophthirius multifiliis 18S rRNA gene, as shown in SEQ ID NO.

4.

3. The fluorescent RPA detection kit for detecting Ichthyophthirius multifiliis according to claim 1, characterized in that, The negative control was Nuclease-Free Water.

4. The fluorescent RPA detection kit for detecting Ichthyophthirius multifiliis according to claim 1, characterized in that, The modification markers are specifically: the 3' end of the probe is modified with C3 Spacer blocking, and the 31st base is [FAM-dT], the 32nd base is [THF], and the 33rd base is [BHQ1-dT].

5. A method for detecting Ichthyophthirius multifiliis for non-disease diagnostic purposes, characterized in that, Includes the following steps: 1) Collect fish tissue samples; 2) Extract DNA from fish tissue samples using a commercial DNA extraction kit and follow the kit instructions. Finally, collect the DNA solution and perform the analysis directly or store it at -20°C. 3) Fluorescent RPA amplification was performed using the fluorescent RPA detection kit for detecting Ichthyophthirius multifiliis as described in any one of claims 1 to 4; 4) Determine whether there is Ichthyophthirius multifiliis in the fish tissue sample based on the fluorescence signal value.

6. The detection method for Ichthyophthirius multifiliis for non-disease diagnostic purposes according to claim 5, characterized in that, The fish tissues are gills, fins, or skin.

Images