An indel molecular marker for identifying peanut plant height, primer and application

Abstract

The application discloses an InDel molecular marker for identifying peanut plant height, a primer and application, and belongs to the technical field of biology. The InDel molecular marker for identifying peanut plant height has a nucleotide sequence as shown in SEQ ID NO:4, and a sequence as shown in SEQ ID NO:1 is deleted at 279-2094bp bases of the sequence shown in SEQ ID NO:4. The application mines a 1816bp deletion polymorphism fragment significantly associated with peanut plant height, develops a specific InDel molecular marker and a primer pair, can accurately distinguish peanut materials with higher plant height and lower plant height, realizes accurate identification of the plant height trait at a molecular level, and solves the problem that traditional phenotype identification relies on a mature period and is easily disturbed by the environment.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, and in particular to an InDel molecular marker for identifying the plant height of peanuts, primers and applications. BACKGROUND

[0002] Peanut (Arachis hypogaea L.) is one of the most important oil crops in the world, widely planted globally, and plays an important role in providing edible oil and protein for humans. In China, the annual demand for edible vegetable oil and protein is huge, and the domestic peanut production is far from meeting the demand (China Statistics Press, 2020-2024). However, due to the limited existing arable land resources, it is obviously unrealistic to meet the demand for supply by expanding the planting area. Therefore, increasing the yield per unit area of peanuts is the most feasible strategy at present.

[0003] Crop plant type includes plant height, tillering (or branching), tiller angle, etc., which greatly affects photosynthetic efficiency and lodging resistance (Falster and Westoby, 2003; Salas Fernandez et al., 2009; Sarlikioti et al., 2011), and plays a decisive role in crop population yield. For example, in the late 1960s, the "Green Revolution" was introduced in rice cultivation, using semi-dwarf traits, which was a major initiative to solve the problem of lodging under high nitrogen fertilizer conditions, thereby breaking through the yield potential bottleneck and increasing rice yield (Peng et al., 1993; Peng Y et al., 2021; Mullangie D P et al., 2024). In addition, semi-dwarf traits have also been gradually applied to other crops, such as corn (Combs E and Bernardo R, 2013; Schaefer C M et al., 2011), wheat (Liu Binghua and Yang Li, 1991; Kang et al., 2016; Lawton Lanier Nalley Andrew P et al., 2008) and sorghum (Awio B et al., 2024), significantly increasing crop population yield. Peanut is a special crop, with flowers opening on the ground and fruits maturing underground. Previous studies have shown that there is a significant statistical correlation between peanut plant type and yield-related traits (Jiang et al., 2014; Huang et al., 2015). For example, lodging caused by excessively long main stems can reduce yield and complicate mechanized harvesting. Therefore, one of the main goals of peanut breeding is to breed an ideal plant type to facilitate mechanized harvesting and increase yield potential.

[0004] Peanut plants consist of an erect main stem and several lateral branches growing from the base. According to the growth habit of the basal branches, peanut plant types can be classified into four categories: 1. prostrate: branches lie flat on the ground, with a distinct main stem; 2. vine: branches grow partially along the ground, with the top end curved upward; 3. bush: branches curve upward from the base, with the main stem slightly higher than the lateral branches; 4. erect: branches grow nearly vertically from the base, with an angle of 45° or less from the vertical axis (Galya et al., 2017). Since the peanut fruiting process occurs underground, the interaction between plant type, flowering pattern, and fruit peg penetration into the soil for podding is a key factor to consider in designing breeding. Therefore, semi-erect and erect plant types have become the main goal of modern peanut breeding. However, Chinese breeders may realize that a fully erect peanut plant type is more compact, with pods concentrated at the base of the plant, and this type is very suitable for high-density planting. Therefore, the erect plant type dominates Chinese peanut varieties.

[0005] Although plant type has important breeding value, the genetic mechanism and regulatory mechanism of peanut plant type are still poorly understood. As a major determinant of plant type, growth habit was initially considered to conform to a two-gene inheritance model, with prostrate being dominant over erect (Hull, 1933; Patel et al., 1936; Coffelt, 1974). However, studies on the offspring of erect and prostrate crosses found that F2 plants could not be strictly classified as prostrate or erect, and intermediate types also existed. Therefore, Higgins (1938) confirmed that peanut growth habit is a complex trait involving multiple genes (Higgins, 1938). In addition, reciprocal cross experiments revealed that nuclear-cytoplasmic interaction regulates peanut growth habit (Ashri, 1964, 1968). Subsequent studies found that more nuclear genes and cytoplasmic genes have a significant impact on branching habit (Ashri, 1975; Ashri and Levi, 1975). Understanding the genetic mechanism of plant type is crucial for improving the ideal plant type. To clarify this point, many researchers have attempted to use quantitative trait locus (QTL) analysis to resolve complex quantitative traits to identify relevant genetic loci. For example, using chromosome segment substitution lines (CSSLs) derived from a wild synthetic allo-tetraploid hybridized with the cultivated species “Fleur 11”, 14 QTLs for growth habit were detected (Fonceka et al., 2012). Using F2:3 populations derived from crosses between Virginia-type peanut varieties, a QTL on chromosome B05 was identified that controlled variation in climbing or bushy growth habit (Kayam et al., 2017). However, in early QTL mapping studies, due to the limited genetic diversity of peanuts and low resolution of genetic maps, the physical intervals identified were relatively large. To address this limitation, researchers used high-resolution mapping strategies and whole-genome resequencing technology to improve the resolution of genetic maps. This approach successfully mapped candidate genes to smaller genomic intervals. For example, a genetic map was constructed based on a recombinant inbred line (RIL) population, containing 2808 SNP markers distributed across 20 linkage groups. The map spanned 1308.20 cM with an average distance of 0.47 cM between markers (Li et al., 2019). Using this map, 12 QTLs were co-located on chromosome B05, with the smallest physical interval being approximately 0.17 Mb.

[0006] Although plant height is also a key element of plant type, relatively less research has been conducted on QTLs associated with peanut plant height. Shirasawa et al. (2012) first reported three QTLs for plant height, which explained 4.8-19.2% of the phenotypic variation using 94 F2 lines (Shirasawa et al., 2012). Similarly, Huang et al. (2015) identified three additional QTLs with a confidence interval of 8.1-16.8 cM using an F2:3 mapping population (Huang et al., 2015). However, all of the QTLs in these studies were identified in a single environment and only used provisional genetic populations, and their reliability and universality need to be further verified. To identify plant height QTLs that are stable in multiple environments and evaluate their potential in marker-assisted selection (MAS), Huang et al. (2016) reported 18 QTLs in a recombinant inbred line population and identified two stable consensus QTLs on linkage group A04 in multiple environments (Huang et al., 2016). Subsequently, Li et al. (2017) identified three additional QTLs that were consistently expressed in multiple environments (confidence interval of 5.97-6.71 cM) in the same recombinant inbred line population (Li et al., 2017). In addition, Lv et al. (2018) constructed two peanut recombinant inbred line populations and identified 13 major QTLs in multiple environments, including a stable QTL on chromosome 9 that was detected in both populations (Lv et al., 2018). Although multiple major QTLs controlling peanut plant type have been reported, they only explain limited phenotypic variation, indicating that undiscovered genetic factors still exist. Therefore, the present invention aims to: (i) identify new QTLs associated with plant type through multi-environment trials; (ii) evaluate their value in peanut design breeding and develop corresponding molecular markers. SUMMARY

[0007] The technical problem to be solved by the present invention is to provide an InDel molecular marker, primer and application for identifying peanut plant height.

[0008] To solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0009] An InDel molecular marker for identifying peanut plant height, the nucleotide sequence of the InDel molecular marker is shown as SEQ ID NO: 4, and there is a deletion of the sequence shown as SEQ ID NO: 1 at the 279-2094 bp base of the sequence shown in SEQ ID NO: 4.

[0010] A primer pair for amplifying the above-mentioned InDel molecular marker, the nucleotide sequences of the primer pair are shown as SEQ ID NO: 2 and SEQ ID NO: 3.

[0011] A kit comprising the above-mentioned primer pair.

[0012] The InDel molecular marker, primer pair or kit is applied to identifying the plant height of peanuts.

[0013] The InDel molecular marker, primer pair or kit is applied to cultivating peanut varieties with higher or lower plant height.

[0014] The method for identifying peanuts with higher or lower plant height by using the InDel molecular marker primer pair comprises the following steps:

[0015] (1) taking the DNA of the peanut material to be tested as a template, performing PCR amplification by using the InDel molecular marker primer pair to obtain a PCR amplification product;

[0016] (2) performing agarose gel electrophoresis detection on the amplification product and observing the electrophoresis detection result.

[0017] Further preferably, in step (2), the amplification product is subjected to agarose gel electrophoresis, when the length of the amplification product is 2132 bp, the gene marker band type of the peanut material to be tested is Rph1; when the length of the amplification product is 316 bp, the gene marker band type of the peanut material to be tested is rph1; the plant height is: the peanut material with the gene marker band type rph1 is higher or candidate higher than the peanut material with the gene marker band type Rph1.

[0018] The InDel molecular marker or the InDel molecular marker primer pair is applied to peanut molecular marker assisted breeding.

[0019] The method for identifying the plant height of peanuts by using the InDel molecular marker primer pair, wherein the InDel molecular marker primer pair is used to perform PCR amplification on the high-generation breeding material, and the amplification result is two forms of fragments, the long fragment represents the insertion of the InDel and is recorded as the band type Rph1, which is a plant with lower plant height; and the short fragment represents the deletion of the InDel and is recorded as the band type rph1, which is a plant with higher plant height.

[0020] The technical scheme has the following beneficial effects:

[0021] ((1) The present application develops a specific InDel molecular marker and primer pair by mining a 1816 bp deletion polymorphic fragment significantly associated with the plant height of peanuts, which can accurately distinguish peanuts with higher plant height from peanuts with lower plant height, realizes the molecular level accurate identification of the plant height trait, and solves the problem that the traditional phenotype identification relies on the mature period and is easily affected by the environment.

[0022] (2) The primer pair of the application is used for PCR amplification combined with agarose gel electrophoresis, which is simple and low in cost, and the result is intuitive, without the need for complex equipment, and is suitable for popularization and application in conventional breeding laboratories, and provides an efficient tool for rapid screening of peanut plant height.

[0023] (3) The application can determine the plant height genotype of peanut seedlings through DNA detection, realize early identification, avoid the lag of traditional breeding which needs to wait for the maturity of the plant to evaluate the plant height, significantly shorten the breeding period, and improve the early selection efficiency.

[0024] (4) In molecular marker-assisted breeding, the marker can be used to accurately screen breeding materials with higher plant height or ideal plant height, reduce the investment of manpower and material resources for invalid planting and later phenotype identification, reduce the breeding cost, and accelerate the breeding process of peanut varieties suitable for different planting needs, which has important significance for improving peanut yield and industry adaptability. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 is a schematic diagram of plant type comparison of two peanut varieties, wherein: **** represents P<0.0001 (Student's t test); Figure A is JH5: Jihua No. 5; Figure B is KX01-6: Kaixuan No. 01-6; Figure C is a schematic diagram of phenotype difference of main stem length of two peanut varieties; Figure D is a schematic diagram of phenotype difference of base branch length of two peanut varieties; Figure E is a schematic diagram of phenotype difference of base branch angle of two peanut varieties; and Figure F is a schematic diagram of phenotype difference of ratio of main stem length to base branch length of two peanut varieties.

[0026] Figure 2 is a schematic diagram of QTL positioning of plant type related traits based on BLUP value, wherein: the best linear unbiased prediction (BLUP) values of Figure A main stem length (MSL), Figure B base branch length (BBL) and Figure C ratio of main stem length to base branch length (RMB) are calculated from the data of corresponding traits in three environments; on the contrary, the qualitative plant type of each recombinant inbred line in Figure D is recorded according to the base branch angle as follows: 0 (≤40°), 1 (>40° to ≤60°) and 2 (>60°); the threshold value (dotted line) of QTL significance is 3.16.

[0027] Figure 3Figure 6 is a schematic diagram of the reliability and function of Rpa1 and Rph1 confirmed by near-isogenic line analysis under potting conditions, wherein Figure A, Figure F are the phenotype diagrams of Rpa1 and Rph1 near-isogenic lines at about 30 days after sowing; Figure B-E, Figure G-J are the comparison results diagrams of stem length, basal branch length, basal branch angle and the ratio of stem length to basal branch length of Rpa1 and Rph1 near-isogenic lines, respectively; the values of the test traits are represented by mean ± standard error; * represents P<0.05; ** represents P<0.01; *** represents P<0.001; **** represents P<0.0001; ns represents no significance (Student's t test).

[0028] Figure 4 Figure 7 is a schematic diagram of map-based cloning of Rph1, wherein: Figure A is a schematic diagram of the genomic location of Rph1 on chromosome B09 and annotated candidate genes, Figure B is a schematic diagram based on BAM file analysis, a 1816 bp deletion is identified in JH5, Figure C is a schematic diagram obtained by confirming PCR with specific primers, Figure D-F are schematic diagrams of the effect of the 1816 bp deletion on the expression levels of three candidate genes.

[0029] Figure 5 Figure 8 is an agarose gel electrophoresis diagram.

[0030] Figure 6 Figure 9 is a schematic diagram of the phenotypic differences of two haplotypes of Rph1 in 241 peanut germplasms, wherein Figure A, Figure B and Figure C are schematic diagrams of the phenotypic differences of main stem length (MSL), basal branch length (BBL) and the ratio of stem length to basal branch length, wherein: ** represents P<0.01; *** represents P<0.001; ns represents no significance (Student's t test), and "n" represents the number of peanut germplasms; DETAILED DESCRIPTION

[0031] The following examples illustrate the present application in detail. The various raw materials and equipment used in the present application are all conventional commercially available products, which can be directly obtained by market purchase. The experimental methods used in the following examples are conventional methods unless otherwise specified.

[0032] It should be understood that when used in the specification and the appended claims of the present application, the term "comprising" indicates the presence of the described features, integers, steps, operations, elements, and / or components, but does not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof.

[0033] It should also be understood that the term "and / or" used in the specification and the appended claims of the present application means any combination of one or more of the associated listed items and all possible combinations, and includes these combinations.

[0034] Reference in the specification to "one embodiment" or "some embodiments" means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the application. The appearances of the phrase "in one embodiment" or "in some embodiments" in various places in the specification are not necessarily all referring to the same embodiment, however, but can refer to one or more but not all embodiments. The terms "including," "comprising," "featuring," and variations thereof are meant to encompass the items listed thereafter and equivalents thereof as well as additional items.

[0035] In addition, in the description and drawings of the application specification and the appended claims, the terms "first", "second", "third", etc. are only used to distinguish the description, and cannot be understood as indicating or implying relative importance.

[0036] The technical solutions of the present application will be described below in conjunction with specific embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, not all. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor are within the scope of protection of the present application.

[0037] Example 1, Materials and Methods

[0038] I. Plant materials and field conditions

[0039] The recombinant inbred line (RIL) population containing 192 F9 individuals (Yang et al., 2023) constructed in the previous study was used to evaluate plant type-related traits in this study. Two parental peanut varieties, Jihua 5 (JH5) and Kaixuan 01-6 (KX01-6), showed opposite plant type phenotypes: JH5 was completely erect, while KX01-6 was a bushy type. The recombinant inbred line population was planted in three field environments and evaluated for plant type at the harvest stage. The three environments were Hainan in 2022 (HN2022), Hainan in 2023 (HN2023), and Shijiazhuang in 2023 (SJZ2023). The test stations in Hainan (109.76°E, 18.41°N) and Shijiazhuang (114.31°E, 38.21°N) are affiliated to the Institute of Crops, Oilseeds and Fibre Crops, Hebei Academy of Agriculture and Forestry Sciences. In addition, a natural population consisting of 241 accessions was selected to verify the effectiveness of the diagnostic markers, which was planted in Shijiazhuang test station in 2024. All test materials were planted in a completely randomized block design, with 3 replicates for each genotype. About 15 plants were planted in each row, with a row length of 3 meters and a row spacing of 0.4 meters.

[0040] II. Analysis of plant type traits

[0041] At harvest, 3 representative plants were selected from each plot to measure main stem length (MSL), basal branch length (BBL) and ratio of main stem to basal branch length (RMB). MSL was defined as the length of the internodes from the meristem where the first pair of lateral branches originated to the terminal leaflet. BBL was defined as the length of the longest basal branch from the point of attachment to the main stem to the terminal leaflet. Qualitative plant type of each recombinant inbred line was scored according to the angle between the main stem and the basal branch, with the following scoring criteria: 0 (≤ 40°), 1 (> 40° to ≤ 60°), 2 (> 60°). The broad-sense heritability (H2) of yield-related traits in different environments was estimated using QTL IciMapping v4.1 (L. Meng et al., 2015) and the following formula: H2= σg2 / (σg2+ σge / n + σe / nr), where σg2is the genetic variance component among recombinant inbred lines, σgeis the recombinant inbred line x environment interaction variance, σeis the residual variance, n is the number of environments, and r is the number of replications. 2 2 2 2 2 2 2 2 2 i i i i i i i i

[0042] III. QTL analysis, marker development and construction of near-isogenic lines

[0043] ​​​​​​​​​​​​​​​​​QTL mapping was performed using composite interval mapping (CIM) method in the R / qtl package (K. W. Broman, 2010) with data from three environments. The threshold for QTL significance was determined by 1000 permutation tests. According to the polymorphic SNP markers flanking the major QTL, we developed derived cleaved amplified polymorphic sequence (dCAPS), CAPS markers or Indel markers according to the sequencing results following the method described by Yang et al. (2019). These molecular markers were used to identify individuals homozygous and heterozygous at the putative loci in the F5 generation, and these heterozygous F5 individuals were selfed to form advanced mapping populations in the F2:3 and F3:4 generations.

[0044] IV. Genetic variation analysis after resequencing of parental genomic DNA

[0045] Genomic DNA was extracted from fresh leaves of JH5 and KX01-6 seedlings using CTAB method (J. J. Doyle, 1991). Libraries were prepared using TruSeq library construction kit and sequenced on the Illumina HiSeq platform. Raw data were aligned to the tetraploid peanut Tifrunner v2.0 reference genome (https: / / phytozome-next.jgi.doe.gov / ) using BWA (http: / / bio-bwa.sourceforge.net / ) with default parameters. SAMtools and Picard (http: / / picard.sourceforge.net) were used to remove duplicate reads, followed by variant calling. The criteria for filtering high-confidence SNPs and InDels were: mapping quality > 10; variant site depth > 5; and variant site genotype homozygous. In addition, since it is difficult to detect large fragment insertions and deletions using next-generation sequencing technology, the BAM files obtained from the above analysis were visualized using the Integrative Genomics Viewer (IGV) software (https: / / igv.org / doc / desktop / ) to search for potential large fragment InDel variations in the candidate region, and confirmed by PCR test using specific primers.

[0046] V. RNA extraction and expression analysis of candidate genes

[0047] High-quality total RNA was extracted from fresh stems using the RNAiso Plus reagent (Takara Bio) according to the manufacturer's protocol. Residual genomic DNA was removed by DNase treatment followed by purification. First-strand cDNA was synthesized using oligo(dT) primers and Moloney murine leukemia virus reverse transcriptase (Promega) with purified RNA as template. Real-time quantitative polymerase chain reaction (qPCR) analysis was performed in a 20-μL reaction system containing 2 μL cDNA (1:20 dilution), 0.5 μL forward / reverse primers, 10 μL TransStart Top Green qPCR SuperMix (Trans), and water to 25 μL. The PCR program was as follows: 95 °C for 1 min; 40 cycles of 95 °C for 15 s, 60 °C for 15 s, and 72 °C for 30 s. The relative expression of candidate genes was calculated according to the 2-ΔΔCT method with the peanut glyceraldehyde-3-phosphate dehydrogenase (GADPH) gene (accession number X56856) as the internal control.

[0048] Example 2, Results

[0049] I. Evaluation of plant type in parental and recombinant inbred lines

[0050] Reference Figure 1 Field observations showed that the two parental genotypes, JH5 and KX01-6, had significant differences in plant type at the harvest stage Figure 1 ). JH5 exhibited an erect growth habit, with most of the basal branches having an angle of growth below 30° Figure 1 A, E). In contrast, KX01-6 exhibited a bushy plant type, characterized by an angle of extension of the basal branches exceeding 60° Figure 1 B, E). In addition, the main stem of JH5 was significantly longer (46.57%) but the basal branches were significantly shorter (31.29%) than those of KX01-6 Figure 1 C, D). Notably, bushy and erect types generally have significant differences in basal branch angle and main stem to branch ratio, which are key distinguishing traits Figure 1 F). Overall, the significant differences observed between the two parents were considered sufficient to elucidate the genetic mechanisms of peanut plant type in the population of recombinant inbred lines derived from them.

[0051] In field trials, plant type of the recombinant inbred lines population was quantified by three traits: main stem length (MSL), basal branch length (BBL), and ratio of main stem to basal branch length (RMB). Table 1 summarizes the mean and range of these traits in three natural environments. We observed transgressive segregation in the phenotypes of 192 recombinant inbred lines in three environments, with the mean of each trait within the parental range. Meanwhile, all observed traits approximately conformed to normal distribution, as most absolute values of kurtosis and skewness were lower than 1 (Table 1). The broad-sense heritability (h2 b ) of the three traits was calculated as 70.74%-80.39% in three environments. Meanwhile, all observed traits were significantly different between parents, and the coefficient of variation (CV%) of these traits was also significantly different (20.03%-27.27%). These findings indicated that the observed variation of traits was mainly controlled by genetic factors of multiple loci, confirming that the recombinant inbred lines population was suitable for subsequent QTL mapping.

[0052] Table 1. Summary information of phenotypic variation and genetic analysis of the recombinant inbred lines population in three field environments

[0053]

[0054] Note: RILs, recombinant inbred lines; JH5, Jihua 5; KX01-6, Kaixuan 01-6; MSL, main stem length (cm); BBL, basal branch length (cm); RMB, ratio of main stem to basal branch length; h 2 b) Calculated based on data of three environments; SD, standard deviation; CV, coefficient of variation; HN, Hainan; SJZ, Shijiazhuang.

[0055] II. QTL identification of plant type-related traits

[0056] We detected 6 significant QTL for 3 traits. The LOD values of these QTL ranged from 3.27 to 9.77, and explained 6.14-24.14% of the phenotypic variation of 192 F9 recombinant inbred lines grown in three field environments (Table 2). Among them, qMSL_B09, qBBL_B09, qBBL_B05 and qRMB_B05 were detected in two or more environments, showing the most stable effects on the observed traits. Notably, qMSL_B09 and qBBL_B09 were located close to each other, suggesting that they were controlled by the same locus, and a similar relationship existed between qBBL_B05 and qRMB_B05. In contrast, qMSL_A06 and qRMB_A03 were likely to be micro-effect QTL, identified in only one environment, with explained phenotypic variation percentages (PVE%) of 6.14% and 9.13%, respectively. The negative additive effects of qMSL_A06 and qBBL_B05 indicated that the alleles increasing MSL and BBL came from parent KX01-6. In contrast, the positive additive effects of other QTL indicated that the alleles enhancing MSL, BBL and RMB came from parent JH5. These results strongly suggest that plant type-related traits in our recombinant inbred line population were genetically controlled by two major-effect QTL and at least two micro-effect QTL.

[0057] Table 2 High-confidence quantitative trait loci (QTL) for plant type traits in three environments

[0058]

[0059] Note: MSL, main stem length (cm); BBL, basal branch length (cm); RMB, ratio of main stem to basal branch length; HN, Hainan; SJZ, Shijiazhuang; QTL significance threshold determined by 1000 permutation tests was 3.16.

[0060] References Figure 2To achieve more precise genetic mapping, we also used BLUP values ​​of MSL, BBL, and RMB, along with qualitative plant architecture data, to define physical candidate regions regulating peanut plant architecture. As expected, qMSL_B09 and qBBL_B09 were co-located in a physical region of approximately 400 kb (B09 chromosome: 158.05–158.45 Mb), defined by flanking markers aligned with the peanut cultivar Tifrunner reference genome (https: / / www.peanutbase.org / ). Within this region, we named the inferred candidate gene regulating plant height Rph1 (Regulating plant height 1). Simultaneously, qRMB_B05, qQPA_B05, and qBBL_B05 were co-located or adjacent to a region of approximately 6.840 Mb (B05 chromosome: 154.040 Mb to the apex), and we named the inferred candidate gene regulating plant architecture Rpa1 (Regulating plant architecture 1).

[0061] III. Reliability and Effect Verification of the Two Major Loci

[0062] refer to Figure 3 To further confirm the reliability of Rpa1 and Rph1 and assess their impact on peanut plant architecture, several high-generation F5 plants heterozygous for both Rpa1 and Rph1 were selected using flanking markers. Subsequently, several near-isogenic lines (NILs) were developed from the offspring of these heterozygous plants. Phenotypic variation in these NILs was further characterized in pot experiments under greenhouse conditions. Lines exhibiting dominant Rpa1 and Rph1 phenotypes were named NIL_Rpa1 and NIL_Rph1, respectively, while their allelic counterparts were labeled NIL_rpa1 and NIL_rph1, respectively. Based on the genotypes predicted by the flanking markers, the dominant alleles in NIL_Rpa1 and NIL_Rph1 both originated from the parent KX01-6. At the initial flowering stage, these two groups of near-isogenic lines carrying opposite alleles exhibited significantly different plant architecture phenotypes. Figure 3 A, F). In the quantitative assessment, Rpa1 significantly increased the length of basal branches by 27.22% (A, F). Figure 3 C) and the angle of the basal branches is 140.08% ( Figure 3 D), but it reduced the ratio of main stem length to basal branch length by 22.91%. Figure 3 E). It has no significant effect on the length of the main stem. Figure 3 B). Rph1 significantly reduced the main stem length by 42.31% ( Figure 3 G) and the length of basal branches is 46.84% ( Figure 3 H). However, it affects the angle of the basal branches (Figure 3 I) or the ratio of the length of the main stem to the length of the basal branches ( Figure 4 J) had no significant effect. These results confirm that Rpa1 and Rph1 are reliable loci that strongly influence peanut plant architecture.

[0063] IV. Map-based cloning of Rph1

[0064] refer to Figure 4 According to the reference genome Tifrunner v2.0 annotation (https: / / www.peanutbase.org), the approximately 400kb confidence interval of qMSL_B09 containing Rph1 contains 43 putative genes. Figure 4 A). To identify the pathogenic gene for Rph1, we performed a comparative analysis of genomic variants using next-generation sequencing (NGS). Unfortunately, no SNPs or small InDel variants located in exons or promoter regions that could lead to gain-of-function or loss-of-function mutations were identified within the candidate regions. Using IGV software, we further examined the parental resequencing BAM files. A potential large deletion was detected in JH5, while the corresponding region in KX01-6 showed a wild-type sequence (…). Figure 4 B). Subsequently, we designed specific primers and confirmed the presence of a 1816 bp deletion in this region, the nucleotide sequence of which is shown in SEQ ID NO: 1 ( Figure 4 C), the specific primer sequence nucleotide sequence is shown in SEQ ID NO: 2 and SEQ ID NO: 3. This deleted region contains the exon regions of Ah19g561300 and Ah19g561500, as well as the promoter region of gene Ah19g561400 ( Figure 4 B). Expression analysis in peanut stems showed that none of the three candidate genes in JH5 ​​were expressed. However, in KX01-6, Ah19g561300 and Ah19g561500 were expressed, while Ah19g561400 was not expressed. ReagentD-F). This suggests that Ah19g561300 or Ah19g561500 can be the causal gene. Further annotation shows that Ah19g561300 belongs to the dual inhibitor / lipid transfer protein / seed storage 2S albumin superfamily (IPR016140). In contrast, Ah19g561500 is annotated as proteasome alpha / beta subunit (IPR001353), which is associated with the gene ontology terms GO:0004298 (threonine-type endopeptidase activity), GO:0005839 (proteasome core complex), and GO:0051603 (involved in cellular protein catabolic process proteolysis). However, further experimental validation is needed to determine which of these genes (i.e., Ah19g561300 and Ah19g561500) plays a role in regulating the high incidence of strains in the population.

[0065] V. Identification of the genetic effect of Rph1 in natural populations

[0066] PCR primers were designed for amplification and combined with phenotypic data for analysis.

[0067] F: ATCCTTGGCCATCTCTCTTCCTC (SEQ ID NO: 2);

[0068] R: GTAACGAAGGTGACGCATGTCAATTTG (SEQ ID NO: 3);

[0069] The reaction system and amplification conditions for PCR amplification are as follows:

[0070] Table 3 PCR amplification reaction system

[0071] Amount 10 x ExTag HS buffer 2.5 μL; 0.2 mM dNTP 2.0 μL DNA template 1.0 μL Forward primer (10 μM) 0.5 μL Reverse primer (10 μM) 0.5 μL ExTaq HS enzyme 0.2 μL 18.3 μL ddH2O Figure 5

[0072] Table 4 PCR amplification conditions are as follows:

[0073]

[0074] The amplified PCR products were detected by agarose gel electrophoresis, and routine band detection was performed in 1% agarose gel electrophoresis. Two bands of different sizes, 2132 bp and 316 bp, were amplified for different genotypes, and the agarose gel map is shown in Figure 6 .

[0075] When the length of the amplification product is 2132 bp, the gene marker band type of the peanut material to be tested is Rph1, and the nucleotide sequence of 2132 bp is shown in SEQ ID NO. 4;

[0076] When the length of the amplification product is 316bp, the genetic marker band type of the peanut material to be tested is rph1, and the nucleotide sequence of 316bp is shown as SEQ ID NO. 5. The height of the plant is: the peanut with the genetic marker band type rph1 is higher than or candidate is higher than the peanut with the genetic marker band type Rph1.

[0077] Reference Figure 6 , Table 5 and Table 6, in order to evaluate the application value of Rph1 in breeding program, we use the gene-specific InDel marker capable of specifically recognizing 1816bp deletion to determine the genotype of the natural population composed of 241 peanut germplasm.

[0078] Table 5 Specific results of natural population Indel marker genotyping

[0079]

[0080]

[0081]

[0082]

[0083]

[0084]

[0085]

[0086]

[0087]

[0088]

[0089] Table 6 Natural population Indel marker genotyping and correlation analysis results of main stem length, base branch length and main stem to base branch length ratio

[0090]

[0091] The analysis shows that 153 germplasms are Rph1 homozygous, and 88 are rph1 homozygous. The main stem length ranges of the two genotype populations are 29.0cm to 66.3cm and 25.9cm to 84.5cm, respectively, and the average values are 46.0cm and 50.5cm( Figure 6 A). The base branch length ranges of the two genotype populations are 30.7cm to 79.8cm and 28.6cm to 96.5cm, respectively, and the average values are 52.6cm and 57.5cm( Figure 6B). One-way ANOVA analysis showed that the main stem length and basal branch length of peanut germplasm carrying rph1 genotype were significantly higher than that of germplasm carrying Rph1 genotype (about 10%) (P<0.01), however, the ratio of main stem length to basal branch length had no significant difference ​ C). These results showed that Rph1 haplotype was closely related to plant type traits, indicating that the diagnostic InDel marker could be used for selection of ideal plant height in peanut design breeding. The height of the peanut material with the rph1 genotype was higher or higher than the peanut material with the Rph1 genotype.

[0092] Example 3, result analysis

[0093] Accurate phenotyping of plant type is a major methodological challenge that must be addressed prior to genetic studies. Although previous studies classified peanut plant type into four categories (Kayam et al., 2017), the four categories lack clear boundaries because the traits exhibit continuous variation. Therefore, different researchers can employ different classification strategies when conducting QTL mapping studies for genetic traits related to plant type. For example, in early studies, peanut plant type was described as a qualitative trait, simply classified as prostrate, erect, or intermediate, and genetic results indicated that the prostrate habit was dominant over the erect habit (Hull, 1933; Patel et al., 1936; Coffelt, 1974). However, researchers found it difficult to classify the intermediate and / or abnormal growth habits of F2 plants resulting from crosses between plants of different growth habits. Fonceka et al. (2012a,b) instead employed a continuous scale of 1 (prostrate) to 6 (erect) for quantitative phenotyping of the branching habit trait and found several QTL that controlled a wide range of morphological variation. In contrast, Kayam et al. (2017) employed a bulked segregant analysis (BSA) to circumvent subjectivity in phenotypic classification by selecting pure lines of the bushy and viney types for QTL mapping. In more recent studies, researchers increasingly view plant type as a quantitative trait controlled by multiple genes. To improve the accuracy of detection of relevant QTL loci, they use multidimensional phenotypic indices for evaluation. For example, Li et al. (2019) used lateral branch angle (LBA), main stem height (MSH), lateral branch length (LBL), expanded radius (ER), and plant type index (IOPT, defined as the ratio of the longest branch of the first pair of lateral branches to the main stem height) to measure plant type segregation in a recombinant inbred line population. In the present study, we employed MSL, BBL, and RMB, which correspond to MSH, LBL, and IOPT, respectively, used by Li et al. (2019). We did not employ LBA and ER because we found that these two parameters are affected by plant size. This is because the recombinant inbred line population is usually sown at a constant density. Smaller plants are less disturbed by neighboring plants, allowing their plant type to develop in a more viney form. Therefore, the LBA and ER measurements of smaller plants can be more accurate. In contrast, larger plants are more disturbed by surrounding plants, resulting in LBA and ER values that can be relatively smaller than their true values. Regardless, employing more objective parameters for evaluation of plant type is absolutely essential for subsequent fine mapping and map-based cloning of major genes.

[0094] Because most quantitative traits, including peanut plant type, are highly susceptible to environmental influences, breeders must invest significant effort and time to evaluate varieties in multiple environments. Marker-assisted breeding, by selecting markers linked to QTLs of interest, promises to deliver greater genetic gain in a shorter time. Therefore, several studies have been conducted to resolve the genetic basis of peanut plant type and identify potential QTLs. In this study, we identified two stable loci, Rpa1 and Rph1, associated with peanut plant type traits. Compared with published results, Rpa1, located on chromosome B05, is tightly linked or co-localized with multiple previously reported loci associated with these traits. For example, Li et al. (2019) located a QTL cluster associated with three plant type traits in the same genomic region on chromosome B05, with a physical interval of approximately 0.17 Mb (position 159,819,755-159,987,803). This interval falls completely within the region we located. In contrast, the locus Bunch1 associated with branching habit was finely mapped to a 1.1 Mb fragment on chromosome B05 (position 145,553,897-146,649,943) (Kayam et al., 2017). This interval is adjacent to but does not overlap with the region we located. Therefore, we speculate that Rpa1 and the QTL cluster identified by Li et al. (2019) might be controlled by the same gene. On the other hand, although Bunch1 and Rpa1 were located in two non-overlapping intervals, the observed different intervals might be due to differences in the evaluation methods. Therefore, Bunch1 and Rpa1 might also share a common genetic regulatory factor. Furthermore, Yu et al. (2023) also located a locus associated with LBA to a 6.82 Mb region on chromosome 15 (position 101,743,223-108,564,267), however, this interval is distal to most reported loci, suggesting that it might represent a new regulatory locus. However, despite several QTL mapping studies based on biparental and population-based studies on peanut plant type, fine mapping efforts on QTLs associated with plant height remain limited. Although more than 20 QTLs associated with plant height have been identified in peanut, their application is limited by low estimates of heritability, identification in only a single environment, or low resolution of the mapping (Shirasawa et al., 2012; Huang et al., 2015; 2016; Li et al., 2017; Lv et al., 2018). Based on the physical positions of the flanking markers of these QTLs, we found that all of the above-identified QTLs either overlap or are adjacent to the Rph1 locus we located on chromosome B09. Interestingly, Li et al. (2019) located a plant height QTL to the same region on chromosome B09 as the Rph1 locus.Notably, their recombinant inbred line population shares the same parent JH5 as our recombinant inbred line population, and in both studies, the favorable alleles came from JH5. This consistency supports the reliability of Rph1. Therefore, Rph1 is considered a new QTL locus that regulates plant height. However, it is worth noting that Li et al. (2019) did not fine map this locus and did not validate its genetic effect in a natural population. In contrast, this study addresses these limitations.

[0095] In crops such as rice, maize, and wheat, many genes associated with plant type have been discovered and cloned (Wang et al., 2022; Rastogi, 2025; Xiongtao et al., 2023), which have played a key role in elucidating the process of crop domestication. However, due to the limitations of genetic transformation techniques in peanut, despite several candidate genes being predicted by researchers, none have been confirmed. For example, several genes involved in plant hormone metabolism and light signal reception exist within this region, which have been identified as potential regulators of Bunch1. Notably, one of them, a gene encoding a FAR1-related protein, is considered a strong candidate (Kayam et al., 2019). In another report, some genes that play a role in light signal function, plant circadian rhythm pathways, and / or cytokinin-activated signaling pathways in response to light intensity are considered candidate genes (Li et al., 2019). Furthermore, Lv et al. (2018) predicted that the 3.4 Mb candidate interval containing the height-regulating loci qPHA09a and cqPHA09.d contains 161 genes, including transcription factors and enzymes involved in signal transduction and cell wall processes. In this study, we narrowed down the Rph1 locus to a ~400 kb candidate interval containing 43 putative genes. Further refinement through resequencing and qPCR analysis identified two candidate genes, Ah19g561300 and Ah19g561500, within this region. Ah19g561300 belongs to the dual-function inhibitor / lipid transfer protein / seed storage 2S albumin superfamily (IPR016140), while Ah19g561500 encodes a proteasome alpha / beta subunit (IPR001353). Interestingly, the functional annotations of these two genes differ from those of previously reported genes that control plant type. To validate these candidate genes, we designed primers for a 1816 bp InDel within this interval and screened 241 germplasm resources. The results provide supporting evidence that one of the genes regulates plant height. Therefore, we propose that the pathway by which Rph1 regulates peanut plant height may differ from previously characterized pathways.

[0096] Although the embodiments of the present application have been shown and described, it is to be understood that various modifications, substitutions, changes and alterations can be made to these embodiments without departing from the principles and spirit of the present application, and the scope of the present application is defined by the appended claims and their equivalents.

[0097] In the above embodiments, the description of each embodiment is focused on, and the part not described or recorded in a certain embodiment can be referred to the relevant description of other embodiments.

[0098] The above-described embodiments are only used to illustrate the technical solutions of the present application, rather than limit it; although the present application has been described in detail with reference to the foregoing embodiments, it should be understood by those skilled in the art that the technical solutions recorded in the foregoing embodiments can still be modified, or some technical features can be replaced by equivalents; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application, and should be included in the protection scope of the present application.

Claims

1. An InDel molecular marker for identifying the plant height of peanut, characterized in that, The nucleotide sequence of the InDel molecular marker is shown as SEQ ID NO: 4, and the deletion of the sequence shown as SEQ ID NO: 1 exists at the 279-2094 bp base of the sequence shown as SEQ ID NO:

4.

2. A primer pair for amplifying the InDel molecular marker of claim 1, characterized in that, The nucleotide sequences of the primer pair are shown as SEQ ID NO: 2 and SEQ ID NO:

3.

3. A kit comprising the primer pair of claim 2.

4. Use of the primer pair of claim 2 or the kit of claim 3 in identifying the plant height of peanuts.

5. Use of the primer pair of claim 2 or the kit of claim 3 in breeding peanut varieties with higher or lower plant height.

6. A method for identifying higher or lower height of peanut using the InDel molecular marker primer pair according to claim 2, characterized in that, The method comprises the following steps: (1) Using the DNA of the peanut material to be tested as a template, performing PCR amplification with the InDel molecular marker primer pair to obtain a PCR amplification product; (2) Performing agarose gel electrophoresis detection on the amplification product and observing the electrophoresis detection result; When the length of the amplification product is 2132 bp, the gene marker band type of the peanut material to be tested is Rph1; when the length of the amplification product is 316 bp, the gene marker band type of the peanut material to be tested is rph1; the plant height is: the peanut material with the gene marker band type rph1 is higher or is a candidate for being higher than the peanut material with the gene marker band type Rph1.

7. A method of detecting a peanut plant height Indel molecular marker characterized by: The InDel molecular marker primer pair of claim 2 is used to perform PCR amplification on high-generation breeding materials, and the amplification result is two forms of fragments with lengths of 2132 bp and 316 bp, the long fragment with a length of 2132 bp indicates the insertion of InDel and is recorded as the band type Rph1, which is a plant with lower plant height; the short fragment with a length of 316 bp indicates the deletion of InDel and is recorded as the band type rph1, which is a plant with higher plant height.

Images